ID: 1157145646

View in Genome Browser
Species Human (GRCh38)
Location 18:45159659-45159681
Sequence TGACCCCTGGTTCCCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157145639_1157145646 23 Left 1157145639 18:45159613-45159635 CCATCAGGGGATGTGGGAGGCAG No data
Right 1157145646 18:45159659-45159681 TGACCCCTGGTTCCCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157145646 Original CRISPR TGACCCCTGGTTCCCACAGG AGG Intergenic
No off target data available for this crispr