ID: 1157147033

View in Genome Browser
Species Human (GRCh38)
Location 18:45174289-45174311
Sequence CCATCAGTAAAGAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157147033_1157147036 0 Left 1157147033 18:45174289-45174311 CCATTTTTCTTCTTTACTGATGG No data
Right 1157147036 18:45174312-45174334 ATTTCCAGGTGACTGACAGATGG No data
1157147033_1157147039 9 Left 1157147033 18:45174289-45174311 CCATTTTTCTTCTTTACTGATGG No data
Right 1157147039 18:45174321-45174343 TGACTGACAGATGGTTGTAAGGG No data
1157147033_1157147038 8 Left 1157147033 18:45174289-45174311 CCATTTTTCTTCTTTACTGATGG No data
Right 1157147038 18:45174320-45174342 GTGACTGACAGATGGTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157147033 Original CRISPR CCATCAGTAAAGAAGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr