ID: 1157149013

View in Genome Browser
Species Human (GRCh38)
Location 18:45195947-45195969
Sequence GAGTATCCCTGAGCCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157149013_1157149015 -4 Left 1157149013 18:45195947-45195969 CCAGAGTAGGCTCAGGGATACTC No data
Right 1157149015 18:45195966-45195988 ACTCCAGCACAGCCACGTGGTGG 0: 25
1: 83
2: 182
3: 235
4: 317
1157149013_1157149018 10 Left 1157149013 18:45195947-45195969 CCAGAGTAGGCTCAGGGATACTC No data
Right 1157149018 18:45195980-45196002 ACGTGGTGGAAGAAGATTTATGG 0: 33
1: 64
2: 108
3: 112
4: 216
1157149013_1157149019 21 Left 1157149013 18:45195947-45195969 CCAGAGTAGGCTCAGGGATACTC No data
Right 1157149019 18:45195991-45196013 GAAGATTTATGGACAGAAAAAGG 0: 129
1: 235
2: 293
3: 283
4: 647
1157149013_1157149014 -7 Left 1157149013 18:45195947-45195969 CCAGAGTAGGCTCAGGGATACTC No data
Right 1157149014 18:45195963-45195985 GATACTCCAGCACAGCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157149013 Original CRISPR GAGTATCCCTGAGCCTACTC TGG (reversed) Intergenic
No off target data available for this crispr