ID: 1157152630

View in Genome Browser
Species Human (GRCh38)
Location 18:45233502-45233524
Sequence CCTATTTCATGGTCTTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157152623_1157152630 13 Left 1157152623 18:45233466-45233488 CCTAGAAGCACTGGAAGAAACCA 0: 1
1: 1
2: 2
3: 28
4: 302
Right 1157152630 18:45233502-45233524 CCTATTTCATGGTCTTGCCCGGG 0: 1
1: 0
2: 1
3: 11
4: 122
1157152624_1157152630 -7 Left 1157152624 18:45233486-45233508 CCAAACAAAAAAGTCCCCTATTT 0: 1
1: 0
2: 2
3: 20
4: 224
Right 1157152630 18:45233502-45233524 CCTATTTCATGGTCTTGCCCGGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157152630 Original CRISPR CCTATTTCATGGTCTTGCCC GGG Intronic
903576476 1:24342561-24342583 CCCATTTCCTGGTCTTGTTCTGG + Intronic
903620671 1:24695863-24695885 CCTGTGTCATGGCCCTGCCCTGG + Intergenic
907393597 1:54174613-54174635 CCTATTTCCTCTTCTAGCCCTGG - Exonic
907617579 1:55940088-55940110 CCTAGTTCATGGACTTGGACAGG - Intergenic
908704158 1:66931923-66931945 CTTCTTTCATGGTGTTGCTCAGG + Intronic
912171204 1:107101575-107101597 TCTATTACATGGTCTTGCTCAGG - Intergenic
913430211 1:118781719-118781741 CCTATTCAATCATCTTGCCCAGG + Intergenic
920881061 1:209880919-209880941 CCTATTTCACAGTCTTGCAAAGG + Intergenic
921110777 1:212034864-212034886 GCTTTTTTATGGTCTTGGCCAGG + Intronic
921408656 1:214810876-214810898 CATATTTCATGGTGTTCCCAAGG + Intergenic
921972490 1:221165423-221165445 CCTATTTCCTTCTCTTGCCTTGG + Intergenic
923617827 1:235552356-235552378 CCTACAACATGGTCATGCCCAGG + Intronic
1064227230 10:13497907-13497929 AGTATTTCATGGTTTTGCTCTGG - Intronic
1066257749 10:33696722-33696744 CCTATTTGATCATCTTGCTCAGG + Intergenic
1071044650 10:81359207-81359229 CTTATTTCATTGTCTTTCCTTGG - Intergenic
1071226399 10:83534367-83534389 CTTATTTCATGCTCTTGTCTTGG - Intergenic
1075352214 10:121734100-121734122 CCTATTTCTTGATCTTCGCCAGG - Intergenic
1075632835 10:124011510-124011532 CCTGACTAATGGTCTTGCCCGGG - Intronic
1081056709 11:38418141-38418163 CCGATATCCTGGTATTGCCCAGG + Intergenic
1083820654 11:65169592-65169614 GCTGTTTCATGGTCTCCCCCAGG - Intergenic
1086817722 11:91393909-91393931 CCTACTCCATGGTCATTCCCTGG - Intergenic
1089325438 11:117653514-117653536 CCTAGCTCATGGGCTAGCCCGGG - Intronic
1089965723 11:122653745-122653767 CCTAGTTCATAGTCTTGTCAAGG + Intergenic
1090951335 11:131476168-131476190 CCCATTTTATGTTCTTGCCTAGG + Intronic
1093213408 12:16334205-16334227 CCTACTTCATGGTTTTGCCTAGG + Intergenic
1096320350 12:50606685-50606707 TCTTTTTGATGGTCTCGCCCAGG + Intronic
1097120468 12:56727461-56727483 CCTGTTTCACCGTGTTGCCCAGG + Intronic
1097308657 12:58095549-58095571 CCTATTACATGGTGATGGCCAGG - Intergenic
1104660172 12:130606351-130606373 CCTTTTTTATGGCCTAGCCCAGG - Intronic
1106354731 13:28970073-28970095 CATATTACATGGTTTTGGCCAGG - Intronic
1107482921 13:40799959-40799981 CCTCTTTGTTGGTCTTGCCTTGG + Intronic
1108269520 13:48745921-48745943 CCTACTTCATAGTATTGCCAAGG + Intergenic
1108719250 13:53113506-53113528 CGGATTTCACGGTGTTGCCCAGG - Intergenic
1110279387 13:73675243-73675265 CCTAATATATGGTTTTGCCCTGG - Intergenic
1110788625 13:79562125-79562147 CATATTTCAGGGTATTGTCCAGG + Intergenic
1111404719 13:87788533-87788555 CATATTTTATGGTCTCTCCCAGG - Intergenic
1116009371 14:39332858-39332880 CCTATTTCGACGTCTTGCCTGGG + Intronic
1122519656 14:102334310-102334332 CTTATTCCAGGGCCTTGCCCAGG + Intronic
1122533879 14:102448515-102448537 CCTAGTTGATGCTCTTGCCCTGG + Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123879839 15:24667150-24667172 CGTGTATCATGGTCTTGGCCTGG - Intergenic
1124723459 15:32133612-32133634 TCTTTTTCATCGTCTTGCACTGG - Intronic
1126949013 15:53858712-53858734 CCTATTTCATTATCTGGGCCAGG - Intergenic
1128887864 15:71304943-71304965 ACTATTTTTTGTTCTTGCCCAGG + Intronic
1130226981 15:82066563-82066585 CCTATTTCTAGGACCTGCCCAGG - Intergenic
1130573359 15:85068738-85068760 CCTCTTTCCTAGTCTTGTCCAGG + Intronic
1131891551 15:96977512-96977534 CCTATTTCATGGTCTTCCAATGG + Intergenic
1139850587 16:69949780-69949802 AGGATTTCATCGTCTTGCCCAGG - Intergenic
1139879571 16:70172692-70172714 AGGATTTCATCGTCTTGCCCAGG - Intergenic
1140372953 16:74422856-74422878 AGGATTTCATCGTCTTGCCCAGG + Intergenic
1141940299 16:87271588-87271610 CCTATTCCATTGTCTTGCCTTGG + Intronic
1147176547 17:38659385-38659407 CCTATTTCTAGATCTTGCCAGGG - Intergenic
1147688607 17:42301545-42301567 CCTAGTTCACCGTGTTGCCCAGG + Intronic
1148033606 17:44640717-44640739 AGAATTTCATGCTCTTGCCCAGG + Intergenic
1154479190 18:14800348-14800370 CCCATCTCGTTGTCTTGCCCAGG + Intronic
1155544257 18:26899297-26899319 CCTACTTCAGGGTCTTCCTCTGG + Intergenic
1155858214 18:30862442-30862464 ACTATTTTATGGCCTTTCCCTGG + Intergenic
1157152630 18:45233502-45233524 CCTATTTCATGGTCTTGCCCGGG + Intronic
1161395774 19:4044162-4044184 CCTCTTCCAGGGTCTTCCCCTGG - Intergenic
1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG + Intronic
926060059 2:9799649-9799671 CCTATCTCATTGTGTTGCCGTGG + Intergenic
927454218 2:23235567-23235589 CCTGTTTCATGCACTTGCCAGGG + Intergenic
929647487 2:43642454-43642476 TTTATTTTATTGTCTTGCCCTGG + Intronic
936432496 2:112476626-112476648 CCTATTTCCTGGCCCTGCTCAGG - Intergenic
941465663 2:165823511-165823533 TCTATTTCATGGGTTTGCCATGG - Intergenic
946182594 2:217957460-217957482 CTTATTTCATGGTTTTTACCTGG - Intronic
948178596 2:235962584-235962606 CCTCTCTCATGGTCTCACCCAGG - Intronic
1169393096 20:5206041-5206063 ACTATTTCATGGCATTGTCCAGG + Intergenic
1169698231 20:8415841-8415863 CCAGATTCATGGTGTTGCCCTGG - Intronic
1171149009 20:22810525-22810547 CCTATTTCCTGGGCTTCTCCTGG - Intergenic
1172580201 20:36041415-36041437 CCTGTTTCATGGAGATGCCCAGG - Intergenic
1174751095 20:53112091-53112113 CCTATTACCTGGTTTTGCCTGGG - Intronic
1176113455 20:63421099-63421121 CCTCCTTCATGCTCTTTCCCTGG - Intronic
1176800561 21:13425043-13425065 CCCGTCTCATTGTCTTGCCCAGG - Intergenic
1182040231 22:27232765-27232787 CCTATTTCAGGGGCTGGCCATGG + Intergenic
1185332278 22:50257141-50257163 CATGTTTCATGAGCTTGCCCAGG + Exonic
951982325 3:28579058-28579080 CCTATTTCATAGACTTTCCGAGG - Intergenic
953150168 3:40317457-40317479 ATGTTTTCATGGTCTTGCCCTGG + Intergenic
956021839 3:64941467-64941489 CCTGTTTCAGGGTCTTGCCCAGG + Intergenic
961994867 3:131231794-131231816 CCCTTTCCCTGGTCTTGCCCTGG + Intronic
962686143 3:137849562-137849584 ACTACTTCCTGGTCTTTCCCAGG - Intergenic
963693846 3:148539984-148540006 GCTATTTCATGATGTTGCCTTGG - Intergenic
967047329 3:185749816-185749838 CCTAATTCATGCTCTTGGCTTGG - Intronic
971300569 4:25439123-25439145 CCTATTTAAGGGTCTTGCCTGGG + Intergenic
971362500 4:25950890-25950912 CCACTTTCATGGTGTTGCCCTGG - Intergenic
971443091 4:26711107-26711129 TCTATGTCATGGTATTGCCTAGG + Intronic
974955934 4:68641318-68641340 CCTATGTCTTGGTATTGCCTAGG + Intronic
975464892 4:74698135-74698157 CCCATATCATGGCCATGCCCTGG - Intergenic
976895749 4:90108875-90108897 CCCAGTTTAGGGTCTTGCCCTGG + Intergenic
978089686 4:104699810-104699832 TCTTTTTCATGATCTTCCCCTGG - Intergenic
978865406 4:113503149-113503171 CCTATCTCATGGCCTCGCCAGGG - Intronic
979284712 4:118909431-118909453 CCTGTTCCCTGGACTTGCCCAGG + Intronic
981155438 4:141429333-141429355 CCTCTTTCATGGTTTTGTCAAGG - Intergenic
983663818 4:170159740-170159762 CCTTTTGCTTGGTCTTGCTCTGG + Intergenic
986254554 5:6091344-6091366 ACTAATTCATGGACTTGCCATGG + Intergenic
988398021 5:30721520-30721542 CCTATTTAATGTCATTGCCCAGG + Intergenic
990778874 5:59335415-59335437 TCTATTTCACAGTCTTGCTCAGG + Intronic
993382724 5:87226144-87226166 TCTATTTCATAATCTTACCCAGG - Intergenic
995205014 5:109469712-109469734 CTTTTTTCAAGATCTTGCCCAGG + Intergenic
996041753 5:118822009-118822031 CCTAACTCCTGGTCTTGCCAGGG + Intergenic
1005807085 6:29484244-29484266 CCTACTTCATGGCTTTGCCTTGG + Intergenic
1005838706 6:29725873-29725895 CATATTTCTTGATCCTGCCCTGG + Intronic
1007744935 6:44037981-44038003 CCTATTTCATGTTCTCGTCTGGG + Intergenic
1008209417 6:48702598-48702620 CCTATTACATTATCTTGCCAAGG - Intergenic
1008915050 6:56778213-56778235 CCTAATTCATGGTGTTGCTTAGG - Intronic
1011594440 6:89002831-89002853 CCTTTTCCATGGTGTTGCACTGG + Intergenic
1014095459 6:117454826-117454848 TGTATTTCATGGCCTTACCCTGG - Intronic
1015097172 6:129429711-129429733 CCTATCTCATACCCTTGCCCAGG + Intronic
1016654022 6:146497098-146497120 CCCTTTTCATGGTCATGCCAGGG + Intergenic
1019499925 7:1359781-1359803 TCGATTTCATGGTGTGGCCCGGG + Intergenic
1026434298 7:70381110-70381132 CCTATTTCAGTGTTTTCCCCAGG - Intronic
1026501090 7:70943992-70944014 CCTAGTGCATGGTCTAGCCCAGG + Intergenic
1028199401 7:87943445-87943467 GTTATTTCTTGGTCTGGCCCAGG + Intronic
1030574440 7:111268368-111268390 CCTAGCTCATGGTTTTGCCCAGG + Intronic
1030604905 7:111630052-111630074 CTTATTACATCCTCTTGCCCAGG + Intergenic
1032496204 7:132364679-132364701 CCCATTCCGTGGTCTTGCTCAGG + Intronic
1035890000 8:3332969-3332991 CCTCTTTCAAGGGCTTTCCCTGG - Intronic
1036612382 8:10361448-10361470 CCTATTTCAAAATTTTGCCCAGG - Intronic
1041034294 8:53772458-53772480 CCTTTTTCATGGACTTGCTCTGG + Intronic
1041970304 8:63733789-63733811 CCTATTTCTTCTTCTTCCCCAGG + Intergenic
1042297331 8:67235635-67235657 CCTATTTCAGTATGTTGCCCGGG - Intronic
1043054165 8:75416233-75416255 CTGATTTCATTGTCTTGCTCAGG + Intronic
1045390476 8:101709977-101709999 CCTATTTGGCTGTCTTGCCCAGG - Intronic
1047595481 8:126373725-126373747 CCTATTTTATTGTGTTGCTCAGG - Intergenic
1048996343 8:139795971-139795993 CCCATTTCATGCTCTTACCAAGG - Intronic
1050293227 9:4178543-4178565 CTTGTTTCATGGTTTTGCCTAGG + Intronic
1055012079 9:71578042-71578064 CCTATTTTATGGTCTGGTGCTGG - Intergenic
1055783673 9:79848016-79848038 TGTGTTTCATGGTCTTGGCCTGG - Intergenic
1057060064 9:91995839-91995861 CCTGTTTGATCGTTTTGCCCTGG - Intergenic
1059987284 9:119832850-119832872 CTTCTTTCATGCTCTTGCCCTGG - Intergenic
1186835138 X:13430194-13430216 CCTCTGTCATGGTCTTGCAATGG + Intergenic
1190262738 X:48808011-48808033 GTTATTTCCTTGTCTTGCCCAGG + Exonic
1192210666 X:69125822-69125844 CCTATTTTATGGTCTTACTGGGG - Intergenic
1197671972 X:129286870-129286892 GCTATTTCATTTTTTTGCCCTGG - Intergenic
1200811467 Y:7489894-7489916 CCAATGTCATTGTCCTGCCCTGG - Intergenic