ID: 1157153677

View in Genome Browser
Species Human (GRCh38)
Location 18:45244134-45244156
Sequence AGATTGGTGGGCTGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157153677 Original CRISPR AGATTGGTGGGCTGCCCAGG GGG (reversed) Intronic
900213527 1:1468758-1468780 AGAGGGGTGGGCTTCACAGGAGG + Exonic
900221089 1:1509574-1509596 AGAGGGGTGGGCTGCACAGGAGG + Intergenic
900927237 1:5713295-5713317 AGATAGGAGGGGTTCCCAGGCGG - Intergenic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901240252 1:7688757-7688779 AGGTTGCTGGGCTGCTCAGAAGG - Intronic
901633021 1:10657022-10657044 AGACAGGTGGGCAGCCGAGGGGG - Intronic
905657421 1:39693723-39693745 AGACAGAAGGGCTGCCCAGGAGG - Intronic
906504891 1:46371685-46371707 AGATTGTTGGGAGGCCGAGGCGG - Intergenic
907246683 1:53113558-53113580 AGATGGCAGGGCTGCTCAGGAGG - Intronic
908945914 1:69496754-69496776 AGATTCATGAGATGCCCAGGTGG + Intergenic
915368089 1:155326503-155326525 TGACTGGTGGGCTGCTCTGGGGG + Intronic
917020700 1:170583119-170583141 ACATTGCTGGGCTGCTCAGAAGG + Intergenic
919678557 1:200410238-200410260 TGATTGGTGGGCTGCACTGAAGG + Intergenic
919731395 1:200915860-200915882 ACCTTGGCGGGCAGCCCAGGGGG - Intergenic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
1064424925 10:15222153-15222175 AGAGAGGTGAGCTGCACAGGAGG - Intronic
1066294457 10:34042152-34042174 AGCTTAGTGGGGTGCCAAGGAGG + Intergenic
1067288331 10:44923706-44923728 AGAGGTGTGGGCTGGCCAGGAGG - Intronic
1067811185 10:49428631-49428653 AAGATGGTGGTCTGCCCAGGCGG - Intergenic
1070502333 10:77083576-77083598 AGAGTTTTGGGATGCCCAGGTGG + Intronic
1070668553 10:78362347-78362369 GGAGGTGTGGGCTGCCCAGGTGG - Intergenic
1070732236 10:78838464-78838486 AGATTGTTGGGTTGCTCACGGGG - Intergenic
1071516803 10:86303397-86303419 AGAGTGGAGCACTGCCCAGGAGG + Intronic
1072799459 10:98383078-98383100 CAATTGGAGGACTGCCCAGGTGG - Intergenic
1073423102 10:103440193-103440215 AGAATCGTGGGCTGATCAGGAGG + Intronic
1076427892 10:130380522-130380544 GGATGGATGGGCTGCCCTGGTGG + Intergenic
1076602398 10:131667303-131667325 AGATGAGAGGGCTGCCCAGCAGG - Intergenic
1078096595 11:8301152-8301174 AGATTGGTGGGCTCCCAGGCAGG - Intergenic
1078759987 11:14244072-14244094 TGATTTGTGAGCTGCCCAGAAGG - Intronic
1079833508 11:25301154-25301176 ACATTGGTGGGCCCTCCAGGTGG - Intergenic
1084063241 11:66689079-66689101 AGCTGGGTGAGCTGCCAAGGGGG - Exonic
1084459394 11:69287739-69287761 ACCCTGGTGGGCTGACCAGGTGG - Intergenic
1084963841 11:72733154-72733176 AGATGTGGGGGCTGCACAGGTGG + Intronic
1085474767 11:76783046-76783068 AGATTGCTGGGGCGCGCAGGGGG + Intronic
1088034804 11:105298511-105298533 GGATTTGTAGGCTGCCCAGGTGG + Intergenic
1089970596 11:122689956-122689978 GGTTTGGTGGGCTGCCCACACGG - Intronic
1094069454 12:26396860-26396882 AGATAGCTGGGATGCCCAAGTGG - Intronic
1094830776 12:34299182-34299204 AAATTGGTGGGCTGAAAAGGGGG + Intergenic
1095936735 12:47691990-47692012 AGATTTGTGGGAGGCCGAGGCGG - Intronic
1096113018 12:49040217-49040239 AAATTGGGGGGCTGCCCACTTGG + Exonic
1100436154 12:94573286-94573308 AGATTGGGGTGCTGACCGGGTGG - Intronic
1101574752 12:105987163-105987185 AGCTCTGTGGGCTGGCCAGGTGG + Intergenic
1103197220 12:119055183-119055205 AGATTTATGGGCTACACAGGAGG + Intronic
1103567395 12:121823368-121823390 AGCTTGGTGGGCTCTACAGGTGG - Exonic
1107808021 13:44172942-44172964 AAATTGGTGGGCTTGCCAGAGGG + Intergenic
1111978892 13:94996559-94996581 AGATTGGTGGGCTGGAAAAGTGG - Intergenic
1112263492 13:97900363-97900385 AAATAGGTCAGCTGCCCAGGTGG - Intergenic
1113462564 13:110492213-110492235 AGAGTCGTGGGCTGTGCAGGAGG + Intronic
1113799958 13:113081105-113081127 AGAATGATGGCCTGCCCAGCAGG - Intronic
1116764913 14:49058693-49058715 AGCTTGGTGGGCTTCACAGAAGG - Intergenic
1118004676 14:61554616-61554638 AGAGTAGTGGGCAGCCCTGGGGG + Intronic
1122104482 14:99441761-99441783 AGAGGGCTGGGCTGCCCAGATGG - Intronic
1122271487 14:100570300-100570322 AGGTTGCTGAGCTGCCCTGGTGG + Intronic
1122824270 14:104362122-104362144 AGAAGGCTGGGCTGGCCAGGAGG + Intergenic
1123472382 15:20565015-20565037 AGGTTGGAGGGCTGCCCTGCAGG - Intergenic
1123645621 15:22435338-22435360 AGGTTGGAGGGCTGCCCTGCAGG + Intergenic
1123732687 15:23160006-23160028 AGGTTGGAGGGCTGCCCTGCAGG - Intergenic
1124589362 15:31039849-31039871 AGCCTGGTGGGCTGGTCAGGTGG + Intronic
1127099469 15:55550511-55550533 AGATTGAGGTGCTGCCCAGCTGG - Intronic
1127838612 15:62810615-62810637 TGGCTGGTGGGCTGCCCACGTGG + Intronic
1128999414 15:72319985-72320007 AGGGCGGGGGGCTGCCCAGGGGG + Exonic
1131525998 15:93153132-93153154 GCATTGATGGGCTCCCCAGGAGG - Intergenic
1134522557 16:14925276-14925298 TGATTGGGGGTCTGCCCAGAGGG + Intronic
1134550072 16:15134780-15134802 TGATTGGGGGTCTGCCCAGAGGG - Intronic
1134710227 16:16323927-16323949 TGATTGGGGGTCTGCCCAGAGGG + Intergenic
1134718397 16:16368215-16368237 TGATTGGGGGTCTGCCCAGAGGG + Intergenic
1134949376 16:18344718-18344740 TGATTGGGGGTCTGCCCAGAGGG - Intergenic
1134956355 16:18383944-18383966 TGATTGGGGGTCTGCCCAGAGGG - Intergenic
1136365761 16:29808503-29808525 AGCTTGGTGGGCTGGGGAGGGGG - Intronic
1139391841 16:66610274-66610296 AGAGTGACTGGCTGCCCAGGGGG - Intronic
1139678266 16:68539845-68539867 AGATGGATGGGATGCCCAGGAGG - Intronic
1141714751 16:85720361-85720383 AACTGGGAGGGCTGCCCAGGAGG - Intronic
1142302029 16:89264476-89264498 ATCTTGCTGAGCTGCCCAGGTGG + Intergenic
1143712010 17:8741797-8741819 AGATTGCTGGGCCACCCATGGGG + Intronic
1143722639 17:8823410-8823432 AGATGGGTTGGGTGCCCATGCGG + Exonic
1146029749 17:29355535-29355557 AGATGGGAGGATTGCCCAGGAGG - Intergenic
1146133204 17:30296002-30296024 AGATTGGTGGACAGCAAAGGAGG - Intergenic
1147491060 17:40866867-40866889 GGATTTGGGGGCAGCCCAGGAGG - Exonic
1147552262 17:41452083-41452105 TGCTTGGTTGGCTGTCCAGGTGG - Intergenic
1148863058 17:50614523-50614545 AGAAGGTTGGGCTGCCAAGGAGG - Intronic
1151993426 17:77593315-77593337 AGATTTCTGGGCCACCCAGGGGG - Intergenic
1152214371 17:79024028-79024050 AGCCTGGCGGGCTCCCCAGGGGG + Intronic
1152688328 17:81705828-81705850 AGATGCGTGGGGTGCCCATGGGG + Intronic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1159420066 18:68206304-68206326 AGATGGCTGGGCTGTGCAGGGGG + Intergenic
1160308569 18:77766564-77766586 AGATAGGTCAGTTGCCCAGGTGG + Intergenic
1161933375 19:7355990-7356012 AGATCGCTGGGCTGCCCCTGAGG - Intronic
1163603288 19:18261203-18261225 AGATTGGTGGGCTACACTTGGGG + Intronic
1164857630 19:31537314-31537336 AGATGCGTGGGTTCCCCAGGAGG - Intergenic
1166693022 19:44835460-44835482 AGCTGGGTGGGCTGCCCACCTGG - Intergenic
925138228 2:1534188-1534210 AGATTGGGGGGTTGCACACGGGG - Intronic
926739232 2:16097328-16097350 AGCTTGCTGGGCAGCCCAGGTGG + Intergenic
926767891 2:16338255-16338277 ACAGTGGTGGGCTGGGCAGGTGG - Intergenic
931983113 2:67715177-67715199 TGTTTGGTGGGCTGACCAGGTGG - Intergenic
932411203 2:71549091-71549113 AGAGTGATGGGCAGGCCAGGTGG + Intronic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
934309686 2:91851958-91851980 AGATGGGGCGGCTGCCCGGGCGG - Intergenic
934613727 2:95758641-95758663 GGCTTGGAGGGCTGCCCAGTTGG + Intergenic
934840549 2:97621594-97621616 GGCTTGGAGGGCTGCCCAGTTGG - Intergenic
935630582 2:105210569-105210591 AGATGGGGCGGCTGGCCAGGCGG + Intergenic
938852518 2:135275318-135275340 AGATGGGGTGGCTGGCCAGGCGG + Intronic
939606446 2:144261101-144261123 AGATTGGTAGGCTGTACAGAGGG - Intronic
945975575 2:216267952-216267974 AGATTGGTGGCCGTCACAGGAGG + Intronic
945975808 2:216269834-216269856 AGAGTGGTGGGTTTCCCAAGTGG - Intronic
946269939 2:218583005-218583027 AGACTGGTGTGCTGTCAAGGTGG - Exonic
946482840 2:220073557-220073579 AGATTGTTGGGAGGCCGAGGCGG - Intergenic
948446587 2:238038233-238038255 AGGCTGGTGTGCTGCCAAGGAGG + Intronic
948721004 2:239899872-239899894 TGATTGGTGGGCTTCCCGGCTGG - Intronic
948878239 2:240841489-240841511 AGATCTGGGGGCAGCCCAGGAGG + Intergenic
1171113556 20:22505014-22505036 AGACTGCTGGGCTGTCCAAGTGG + Intergenic
1174203334 20:48822265-48822287 AGACCTCTGGGCTGCCCAGGTGG - Intronic
1179815643 21:43904479-43904501 AGATAGCTGGGCTCCCCACGGGG - Intronic
1180119701 21:45738703-45738725 AGATGGGGGGGCTACCCAGGGGG - Intronic
1180119952 21:45739477-45739499 AGATCGGGGGGCCACCCAGGAGG - Intronic
1181608146 22:23992912-23992934 AGATTGGTGGCATGCGCATGTGG - Intergenic
1184658118 22:45952357-45952379 AGATTAGTGGGCGGGCCGGGCGG - Intronic
1185379823 22:50503255-50503277 AGGTTGGGGGGCTGCCCCTGGGG - Exonic
1185383430 22:50520963-50520985 AGAGTGCTGCCCTGCCCAGGAGG + Exonic
953024429 3:39136713-39136735 AGGCTGGTGGCCTGCCCAAGTGG - Intronic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
954052598 3:47993381-47993403 ATATTGGTGGTCTGCCACGGTGG - Intronic
954372037 3:50174118-50174140 AGTTTGGTGGGATCCACAGGTGG + Intronic
960120942 3:113948122-113948144 AGATGGGTCGGCTTCCCCGGAGG - Exonic
965489837 3:169322428-169322450 AGACTAGTGAGCTGCCAAGGAGG - Intronic
966533310 3:181004431-181004453 AGCTTGCTGGGCTCCACAGGGGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966902107 3:184493969-184493991 AGACTGGTGGGCTGAACAAGAGG - Intronic
967165575 3:186776623-186776645 AGAATCGTGGGCTCCCCAGTTGG + Intergenic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
970231488 4:13915639-13915661 AGACAGGTTGGCTTCCCAGGAGG + Intergenic
973728400 4:53799455-53799477 AGCCTGGTGGGCAGCCAAGGTGG - Intronic
974378885 4:61112038-61112060 AAACTGGTGGAATGCCCAGGTGG + Intergenic
974737826 4:65961583-65961605 ACGATGGTGGGCTGCACAGGGGG + Intergenic
975321944 4:73018748-73018770 AGATTGATGGGCAGCCCTGGTGG + Intergenic
981159007 4:141474589-141474611 AGATAGGTGGTCTGACCGGGTGG + Intergenic
981609394 4:146577284-146577306 ATCTTGGAGGGCTGCCCAGGCGG + Intergenic
983835689 4:172380467-172380489 AGATGGCTGGGCTGCCCAGCAGG - Intronic
985199003 4:187464607-187464629 AGACTGGCTGGCTGCCTAGGGGG - Intergenic
985639397 5:1056659-1056681 AGATCGCATGGCTGCCCAGGAGG + Intronic
987547634 5:19333395-19333417 GGAGTGGTGGGGTGCACAGGGGG + Intergenic
995348293 5:111146314-111146336 AGATTGCTGCCCTGCCCAGGAGG - Intergenic
997182369 5:131843368-131843390 AAATTTGTGGCCTGACCAGGTGG - Intronic
998577028 5:143327699-143327721 AGATTTAAGGGCTGCCCAGCTGG - Intronic
1000293604 5:159893789-159893811 AGATTTGGGGGCTGCCCTGATGG + Intergenic
1002368235 5:178729792-178729814 AGATTTTTGGGATGCCAAGGCGG - Intronic
1002625448 5:180524590-180524612 GGAATGGTTGGCTGCCTAGGTGG + Intronic
1003177841 6:3766408-3766430 AGATAGCTCGTCTGCCCAGGCGG + Intergenic
1006340979 6:33446888-33446910 AGAGTGGTGGGCTCTCCTGGTGG - Intronic
1006581506 6:35080255-35080277 AGATTTGGGGGGTGCCCAGGTGG - Intronic
1007276168 6:40675555-40675577 AGTTTGGAGGGCTGCAGAGGGGG - Intergenic
1007716305 6:43858130-43858152 AGTTTTGTGGGAAGCCCAGGAGG - Intergenic
1007750971 6:44071688-44071710 GGTTTGGTGGTCTGCCCTGGAGG + Intergenic
1010030338 6:71266237-71266259 AGATGGGGCGGCTGGCCAGGCGG + Intergenic
1011628174 6:89300094-89300116 AGAATGTTGTCCTGCCCAGGAGG - Intronic
1012868571 6:104646319-104646341 TGTTTGGTGTGTTGCCCAGGTGG - Intergenic
1013263336 6:108469132-108469154 TGATTGGTGGGCTTCACTGGAGG + Intronic
1014411313 6:121125391-121125413 AGATAGGTGCGCTTCCCAGCAGG + Intronic
1017606761 6:156142995-156143017 AGATTTGTGGGTGGCCAAGGTGG - Intergenic
1019503505 7:1377642-1377664 AGGGTCCTGGGCTGCCCAGGTGG - Intergenic
1019850143 7:3546637-3546659 GCTGTGGTGGGCTGCCCAGGGGG + Intronic
1021480195 7:21107080-21107102 AGATGGGAGGATTGCCCAGGAGG - Intergenic
1021694863 7:23266877-23266899 AGATGGCTGGGCTGCAGAGGCGG - Intronic
1023594513 7:41814939-41814961 AGAAAGGAGGGCAGCCCAGGGGG + Intergenic
1023689231 7:42768988-42769010 AGATTGGTAATTTGCCCAGGAGG - Intergenic
1029774596 7:102677201-102677223 AGGCTGGTGGGCTGCCTATGGGG + Intergenic
1031124398 7:117756875-117756897 AGGTAGGTGGGCATCCCAGGGGG - Intronic
1034469163 7:151246500-151246522 TTAGAGGTGGGCTGCCCAGGGGG + Intronic
1034638592 7:152585828-152585850 AGATGGGGCGGCTGGCCAGGTGG + Intergenic
1035354968 7:158271035-158271057 AGGTTGGGGGGAGGCCCAGGTGG - Intronic
1036453789 8:8891740-8891762 AGAGTGGAGGGATGCCCAGGAGG - Exonic
1037701636 8:21280637-21280659 AGGTGGGTGGGCTGCCCTGTGGG - Intergenic
1039441768 8:37599996-37600018 AGGTTGGTGATCTGCCCAGGAGG + Intergenic
1041231397 8:55756753-55756775 AGGTTGGGGGGCTGCTGAGGGGG + Intronic
1041286932 8:56272111-56272133 AGATGGGTCGGCTGGCCGGGCGG + Intergenic
1044723018 8:95168797-95168819 GGATTGTTGGTCTGCCCTGGGGG + Intergenic
1047312367 8:123703340-123703362 GGGTGGGTGGGCTGCCTAGGGGG + Intronic
1047392512 8:124464879-124464901 AGCTTGGTGTGCTTCCCTGGTGG - Intergenic
1050301657 9:4264917-4264939 AGCACGGTGGGATGCCCAGGTGG + Intronic
1051681589 9:19612986-19613008 AGCTTGGTGACCTGCCCAGATGG - Intronic
1055321505 9:75087843-75087865 TGATAGGTGGCCTGCCGAGGAGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1059329973 9:113528756-113528778 GGAATGGTGGGCTGTGCAGGTGG - Intronic
1059376730 9:113887720-113887742 AGGTGGGTGAGCGGCCCAGGCGG + Intronic
1060498440 9:124134785-124134807 AGGCAGGTGGGCTGCCCTGGGGG + Intergenic
1060803228 9:126557721-126557743 ACTTGGGGGGGCTGCCCAGGAGG - Intergenic
1061239357 9:129360208-129360230 AGGTGAGTGGCCTGCCCAGGCGG - Intergenic
1061678063 9:132229483-132229505 AGGGTGATGGGCTGGCCAGGTGG - Intronic
1062480562 9:136749000-136749022 AGAATGGTGGGTGGGCCAGGAGG - Intergenic
1062612322 9:137380606-137380628 GGATTGGGGGGATGCCCAGAGGG - Intronic
1185677584 X:1861255-1861277 AGATGAGCAGGCTGCCCAGGAGG - Intergenic
1187732644 X:22271451-22271473 AGATTGGTGGGCATAGCAGGAGG - Intergenic
1194991916 X:100555621-100555643 AGATGGGGTGGCTGGCCAGGCGG - Intergenic
1194991969 X:100555749-100555771 AGATGGGGTGGCTGGCCAGGCGG - Intergenic
1195880971 X:109592257-109592279 GGGTTGGTGGTCTGCCAAGGAGG - Intergenic
1201441081 Y:14009069-14009091 AGACTGGTGGACTTCCCACGGGG - Intergenic
1201443490 Y:14033639-14033661 AGACTGGTGGACTTCCCACGGGG + Intergenic
1202046164 Y:20738870-20738892 AGACTGCTGGGATGGCCAGGAGG - Intergenic