ID: 1157153828

View in Genome Browser
Species Human (GRCh38)
Location 18:45245227-45245249
Sequence CAAGGGCTACAGGAATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157153828_1157153832 -4 Left 1157153828 18:45245227-45245249 CCTGGGGATTCCTGTAGCCCTTG No data
Right 1157153832 18:45245246-45245268 CTTGAATCATTTTATAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157153828 Original CRISPR CAAGGGCTACAGGAATCCCC AGG (reversed) Intronic