ID: 1157155584

View in Genome Browser
Species Human (GRCh38)
Location 18:45262394-45262416
Sequence CTGGCTAACTCCCCTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157155584_1157155591 8 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155591 18:45262425-45262447 ACCGCAGGGATTCTGAGGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 207
1157155584_1157155593 9 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155593 18:45262426-45262448 CCGCAGGGATTCTGAGGAAGGGG 0: 1
1: 0
2: 0
3: 23
4: 203
1157155584_1157155594 30 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155594 18:45262447-45262469 GGATGCTGCAGTCATCATTCTGG 0: 1
1: 0
2: 0
3: 11
4: 150
1157155584_1157155590 7 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155590 18:45262424-45262446 CACCGCAGGGATTCTGAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 160
1157155584_1157155586 -7 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155586 18:45262410-45262432 TAGCCAGGCAATCACACCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1157155584_1157155589 3 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155589 18:45262420-45262442 ATCACACCGCAGGGATTCTGAGG 0: 1
1: 0
2: 2
3: 3
4: 103
1157155584_1157155587 -6 Left 1157155584 18:45262394-45262416 CCAGCAAAAGGGGAGTTAGCCAG 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1157155587 18:45262411-45262433 AGCCAGGCAATCACACCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157155584 Original CRISPR CTGGCTAACTCCCCTTTTGC TGG (reversed) Intronic
902065596 1:13683240-13683262 CTTCCTAACTCCCCATTTCCAGG - Intergenic
902296597 1:15471766-15471788 CTGGCTAAGACCCCCTTTACAGG + Intronic
902299396 1:15491067-15491089 CTGGCTAAGACCCCCTTTACAGG + Intronic
905219248 1:36432782-36432804 CTGGCTTACTCCTGTTTTCCTGG - Intronic
905379970 1:37554817-37554839 TTGGCTAACTTCCCTACTGCTGG - Intergenic
906264844 1:44420754-44420776 CTGTATAACTCCCATTTTGCAGG - Intronic
910001624 1:82349367-82349389 CGGGCTTTCCCCCCTTTTGCTGG - Intergenic
919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG + Intergenic
1069839237 10:71328797-71328819 CTGGCTACCTTCCCTATGGCAGG - Intronic
1073475163 10:103747738-103747760 CAGGCAAACTCCCCTGTGGCTGG - Intronic
1075557980 10:123447197-123447219 CTGGCTACCTCCACTGCTGCAGG - Intergenic
1075875129 10:125799796-125799818 CTGGCTGAGTCCTCCTTTGCTGG + Intronic
1076307640 10:129476226-129476248 CTGGGTCACTTCCCTTTAGCTGG + Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078465725 11:11548726-11548748 TTGACCAACTCCACTTTTGCAGG + Intronic
1079408556 11:20165616-20165638 CTGGCCCACTCCCCTTGTCCTGG + Intergenic
1079733855 11:23970893-23970915 CTTGCTTCCTCCCCTTTGGCTGG - Intergenic
1080966620 11:37220404-37220426 CTGGCTAGCCCCACATTTGCAGG - Intergenic
1084832534 11:71780885-71780907 CTGGCTATCTTTCCTTTTGCCGG + Intergenic
1096666978 12:53172436-53172458 CTGGCTTACTCTCCTTCTCCAGG - Exonic
1100707002 12:97211716-97211738 TTGGCAAACTCTCCTTTTCCTGG + Intergenic
1109797921 13:67341128-67341150 CTGGCTAGCTGCCCCTTTGAAGG + Intergenic
1119545557 14:75469123-75469145 CTGGCTAACTGACTTTCTGCAGG - Intronic
1122407553 14:101509290-101509312 CTGGCTATGACCCCTATTGCTGG + Intergenic
1127596230 15:60485247-60485269 CAGGATAACTTCCCTTTTGTGGG - Intergenic
1128323501 15:66708044-66708066 CTGGCTGACTGCTCTTCTGCAGG + Intronic
1132438730 15:101836939-101836961 CTGGCTAGCTTCCATTCTGCAGG + Intergenic
1133363095 16:5189457-5189479 CTGGCTGACTCCCTTTGGGCTGG + Intergenic
1137285622 16:47013933-47013955 CTGGCTACCTCCCTTTCTCCAGG + Intergenic
1138826488 16:60326669-60326691 TTGGCTCATTCCACTTTTGCTGG + Intergenic
1143437538 17:6940278-6940300 CTGGCCAACTACCCTTCAGCTGG - Intronic
1145930510 17:28682017-28682039 CTGGGTAACTCCCCTTGCTCAGG - Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1147547445 17:41413466-41413488 CTGGCTAGCTGCCCTTTTCCAGG - Intergenic
1148957126 17:51363091-51363113 CTTTCTAAGGCCCCTTTTGCAGG + Intergenic
1149886826 17:60348437-60348459 CTTGATAAGTCCCCTTTTCCTGG - Intronic
1151491409 17:74433909-74433931 CTGGCTGTCTCCCCGGTTGCTGG + Intronic
1157155584 18:45262394-45262416 CTGGCTAACTCCCCTTTTGCTGG - Intronic
1157796238 18:50578215-50578237 CTGGCCACTTCCCCTTTTCCAGG - Intronic
1164649725 19:29882980-29883002 CGTGCTAACTCCCCATCTGCTGG - Intergenic
1166762311 19:45232585-45232607 GTGGCTAACTCCCTTTTCTCTGG + Intronic
1168500401 19:56888201-56888223 CTTCCTACCTCCCCTGTTGCTGG + Intergenic
927779574 2:25928627-25928649 CTGGCTACCTTCCCTTCTGGAGG + Exonic
938114044 2:128591389-128591411 CTGCCTTCCTCCCCTGTTGCTGG + Intergenic
938793983 2:134703127-134703149 CTGGCTTACTCCCTTTTAGGGGG - Intronic
939364008 2:141209313-141209335 AGGGCTTTCTCCCCTTTTGCTGG + Intronic
940114389 2:150192339-150192361 CTGGCTTCATCCCCTTTTCCAGG - Intergenic
942474243 2:176299303-176299325 CTGGCTAACTCACCTATTCCAGG - Intronic
947507469 2:230719843-230719865 CTGGTTCCCTCCCCTTTTGCTGG + Intronic
1171313973 20:24169801-24169823 CAGGCTAAGTCCCATTTTGGGGG + Intergenic
1175112366 20:56657643-56657665 CTGGCTCACTCCCATTATTCAGG - Intergenic
1175574304 20:60049258-60049280 CTGCCTAACACCCCTCATGCTGG + Intergenic
1184082731 22:42235747-42235769 TAGGTTAACTCCACTTTTGCAGG - Intronic
1185331419 22:50253660-50253682 CTGGCCACCTCCCCTTTCCCTGG - Intronic
950655592 3:14434429-14434451 GTGTCTATCTCCCCTTCTGCAGG + Intronic
956815697 3:72906333-72906355 CTCGCTACCTCCCCTCCTGCAGG + Intronic
957322505 3:78650469-78650491 CTTGCTAAGTCCCCTTGTGACGG + Intronic
959096342 3:101960649-101960671 TTGTCTATCTCCCATTTTGCAGG - Intergenic
965811628 3:172596912-172596934 CTGGCTGCCTCCGCTTTTGAGGG + Intergenic
969515702 4:7647065-7647087 CTGGCTACCTCCTGTTTTTCGGG - Intronic
973983747 4:56329187-56329209 CTGGCAAACTCACATATTGCTGG + Intergenic
974963795 4:68735802-68735824 CTGGTAAAATACCCTTTTGCTGG + Intergenic
977176866 4:93829115-93829137 CTGGCTGGCTCCCACTTTGCAGG + Exonic
981342424 4:143637378-143637400 CTGGCTATCTCCCATGTTCCTGG + Intronic
981490194 4:145331294-145331316 CTGGCTGCCTCCCCTCCTGCTGG - Intergenic
984575683 4:181445486-181445508 ATGGCTAACATGCCTTTTGCTGG + Intergenic
1002453912 5:179335124-179335146 CTGGATACGTCCCCCTTTGCTGG - Intronic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1002787741 6:417293-417315 GTGGCACACTCCCCTTCTGCAGG + Intergenic
1005328057 6:24721103-24721125 CTCTCAAACTCCCCTTTTGAGGG - Intergenic
1009487031 6:64237303-64237325 CTGAGTAAAACCCCTTTTGCAGG + Intronic
1011015106 6:82745937-82745959 CTAGCTAACTGACCTTATGCTGG + Intergenic
1013412021 6:109891206-109891228 CTGGAACACTCCACTTTTGCTGG - Intergenic
1017415785 6:154219298-154219320 CTGTCTCACTCACCTCTTGCTGG + Intronic
1017576573 6:155811615-155811637 CTGGCTAACTCACCTCTCTCTGG + Intergenic
1021940944 7:25678559-25678581 TTTGCTAATTCCCCTTTGGCAGG - Intergenic
1023631945 7:42173758-42173780 CTGGGTAACTCCCCTGTTGCAGG - Intronic
1025823996 7:64996214-64996236 CTGGAACACTCCACTTTTGCTGG - Intronic
1026793772 7:73352526-73352548 CTGGCTGACCCCCATTCTGCAGG + Intronic
1031227623 7:119060716-119060738 CTGTATAACTCCTCTTTTCCTGG - Intergenic
1035970301 8:4240362-4240384 CTGGCTATGCCCCATTTTGCAGG + Intronic
1041776139 8:61525258-61525280 CAGGCTAACTCCACTTTTCAAGG + Intronic
1043291904 8:78612441-78612463 CAGGCTTACTCCCCTTTTCTTGG + Intergenic
1043350253 8:79352312-79352334 CTGGCTAACTGCCTGTGTGCAGG + Intergenic
1046485180 8:114877946-114877968 CTGGCTAAGTCTCCCTTTGGGGG - Intergenic
1046789763 8:118308442-118308464 CTGCTTCACTCCCATTTTGCAGG + Intronic
1051015135 9:12465141-12465163 CAGTCAAACTCCCCTTTTGTGGG + Intergenic
1057207387 9:93181859-93181881 CTGGCTATATGCCCTTTGGCAGG - Intergenic
1057950936 9:99368636-99368658 CTGGCTGACCCCCCTCCTGCTGG - Intergenic
1060039382 9:120286682-120286704 CTGGCTAAGTGCCCTTCAGCAGG - Intergenic
1060826047 9:126688677-126688699 CTGGCTGAATCCCCTTGTTCAGG - Intronic
1186747199 X:12582502-12582524 CTGGCAAACTCCCCTGTGGGAGG + Intronic
1186920354 X:14271900-14271922 CTCACTAACTTCACTTTTGCTGG + Intergenic
1188428563 X:30077909-30077931 CTTGCAATCTCTCCTTTTGCTGG + Intergenic
1189559394 X:42176804-42176826 CTTGCTAACTTCCCTTCTGCAGG - Intergenic
1193829985 X:86278705-86278727 CTGGCTTCATCCCCTTTTCCAGG - Intronic
1194257472 X:91652471-91652493 CTGGCAAATTCCCCGTGTGCTGG - Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1200576130 Y:4891417-4891439 CTGGCAAATTCCCCGTGTGCTGG - Intergenic
1200698430 Y:6381732-6381754 CTGGCAAACTCCCGATTTGAGGG - Intergenic
1200705888 Y:6442130-6442152 CTGGCAAACTCCCGATTTGAGGG - Intergenic
1200706830 Y:6450270-6450292 CTGGCAAACTCCCGATTTGAGGG - Intergenic
1200707780 Y:6457484-6457506 CTGGCAAACTCCCTATTTGAGGG - Intergenic
1200709085 Y:6467838-6467860 CTGGCAAACTCCTGTTTTGAGGG - Intergenic
1200914707 Y:8561366-8561388 CTGGCAAACTCCCAATTTGAGGG + Intergenic
1200915559 Y:8568295-8568317 CTGGCAAACTCCCAATTTGAGGG + Intergenic
1200927507 Y:8667809-8667831 CTGGCAAACTCCCAATTTGAGGG + Intergenic
1200936217 Y:8740706-8740728 CTGGCAAACTCCCAATTTGAGGG - Intergenic
1200939309 Y:8765669-8765691 CTGGCTAAATCCCAATTTGAGGG - Intergenic
1200962096 Y:9005052-9005074 CTGTCAAACTCCCATTTTGAGGG + Intergenic
1200981806 Y:9269450-9269472 CTGGCAAACTCTCAATTTGCAGG - Intergenic
1201025027 Y:9696871-9696893 CTGGCAAACTCCTGTTTTGAGGG + Intergenic
1201026332 Y:9707224-9707246 CTGGCAAACTCCCTATTTGAGGG + Intergenic
1201027282 Y:9714438-9714460 CTGGCAAACTCCCGATTTGAGGG + Intergenic
1201028222 Y:9722578-9722600 CTGGCAAACTCCCGATTTGAGGG + Intergenic
1201035684 Y:9782967-9782989 CTGGCAAACTCCCGATTTGAGGG + Intergenic
1202128613 Y:21590280-21590302 CTGGCAAACTCTCAATTTGCAGG + Intergenic
1202130411 Y:21604001-21604023 CTGGCAAACTCCCAATTTGAGGG - Intergenic
1202180593 Y:22136569-22136591 CTGGCTAACTCCTGATTTGATGG - Intergenic
1202181529 Y:22143921-22143943 CTGGCAAACTCCCAATTTGAGGG - Intergenic
1202209831 Y:22442479-22442501 CTGGCAAACTCCCAATTTGAGGG + Intergenic
1202210767 Y:22449830-22449852 CTGGCTAACTCCTGATTTGATGG + Intergenic