ID: 1157157274

View in Genome Browser
Species Human (GRCh38)
Location 18:45280384-45280406
Sequence GGTGTTAAGGGGCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157157269_1157157274 -2 Left 1157157269 18:45280363-45280385 CCAGGTTCAAAGGCATATAAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1157157267_1157157274 -1 Left 1157157267 18:45280362-45280384 CCCAGGTTCAAAGGCATATAAGG 0: 1
1: 0
2: 2
3: 7
4: 118
Right 1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157157274 Original CRISPR GGTGTTAAGGGGCCACAAGC AGG Intronic
903771456 1:25766997-25767019 TGTGTGAAGGGGGCACGAGCTGG - Intronic
906562347 1:46768489-46768511 GGTGTTAAGAGTCCACAGACTGG + Intronic
909766631 1:79364564-79364586 TGTGTTAATGGGCTTCAAGCAGG - Intergenic
915531282 1:156503552-156503574 GGTTTTAAAGGGCCAGGAGCAGG + Intergenic
916525044 1:165601786-165601808 AGTGATAAGTGGCCACAAGGTGG + Intergenic
917120968 1:171644316-171644338 TGTGTAAAGGGGCCAGATGCAGG - Intronic
923869186 1:237972414-237972436 GGTGTTAAGGAGTCACAGGTGGG + Intergenic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1063823774 10:9869583-9869605 GGTTTTAAGGTGACATAAGCAGG + Intergenic
1067669205 10:48304430-48304452 AGTGTTAAAGGGCCACAAAGGGG - Intergenic
1068849623 10:61721697-61721719 GGTGAAAGGGAGCCACAAGCAGG - Intronic
1069659643 10:70115162-70115184 TGTGTTAAGTGGCCACCAGGAGG + Intronic
1071683264 10:87728877-87728899 GGTCTTCAGAGGCCACAAACAGG - Intronic
1071849573 10:89554921-89554943 GGTGTTGAGGCTCCGCAAGCAGG + Intronic
1073102577 10:101014366-101014388 GGTGGTATGGGGGCACAAGTGGG + Intronic
1075668744 10:124248739-124248761 GGAGTGAGGTGGCCACAAGCAGG + Intergenic
1077033084 11:478994-479016 GGTGTGAAGGAGCCAGGAGCCGG + Intronic
1078315303 11:10289310-10289332 TGTTCTAAGGGGCCACGAGCAGG - Intronic
1079881398 11:25931954-25931976 GGTGTTAATGGGCCACATGTAGG - Intergenic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1083163291 11:60868609-60868631 GCTGTTCTGGGGCAACAAGCAGG + Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1089653494 11:119930659-119930681 GGTGTTAAAGGGCCAGCACCTGG + Intergenic
1090497219 11:127225176-127225198 GTTGTTAAGGAGCTATAAGCTGG - Intergenic
1091255664 11:134182835-134182857 CGTGTTTAGGGGAAACAAGCGGG + Intronic
1096984176 12:55745433-55745455 GGTGGGAAGGGGACACCAGCTGG + Intronic
1100605721 12:96150539-96150561 GAGTTTAAGGGGCCACCAGCTGG - Intergenic
1103735697 12:123059466-123059488 GGTGCTAAAGGGCCAGAAGGTGG - Intronic
1104411619 12:128562899-128562921 GGGGTGATGGAGCCACAAGCTGG - Intronic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1105402615 13:20109365-20109387 GGTGTGAAGGGGTCAAAAGCTGG - Intergenic
1108747277 13:53408794-53408816 GGGGTTAAGGGCCCAGAAGTGGG + Intergenic
1111938588 13:94584619-94584641 GGTGTTTAGAGGCCACAGTCTGG - Intronic
1114702570 14:24693823-24693845 TGTGTTAAGGGACCCCACGCAGG + Intergenic
1116985901 14:51220041-51220063 GGTGTTAAGGAGCCACTAGGTGG - Intergenic
1122036329 14:98951716-98951738 GGTGCTAAGTGGCCTCAAGAAGG - Intergenic
1125107587 15:35991545-35991567 TGTGCTAATGGGCCACAACCAGG + Intergenic
1129797251 15:78387196-78387218 GGTATCAAGGGGAGACAAGCTGG + Intergenic
1134172144 16:11976966-11976988 GGTGAGCAGGGGCCACGAGCCGG - Intronic
1136021870 16:27445643-27445665 GGGCTTAAGGGGCCACTAGGTGG + Intronic
1139921558 16:70463729-70463751 GGTGTTCAGCAGCCACCAGCAGG - Exonic
1140986485 16:80162583-80162605 GGAGTTGAGGGGCCTCAAGGAGG + Intergenic
1146920164 17:36704727-36704749 GGTGTTAAGAGGCCCAAACCAGG - Intergenic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1153865166 18:9260968-9260990 GGTGGTAAGGGACCACAGGAGGG - Intronic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1157517127 18:48318821-48318843 GGTATGGAGGGGCCCCAAGCAGG + Intronic
1162095848 19:8309548-8309570 GGTGTGCAGAGGCCACAAGGAGG - Intronic
1165304625 19:34995936-34995958 GGTGGTAAGGGGGCTTAAGCGGG + Intronic
1166322243 19:42025641-42025663 GGTGTTTAGGGGTCAAAATCAGG - Intronic
1166448859 19:42880875-42880897 GGTGTTAGGTGGCCACATCCCGG + Intronic
1167197774 19:48042537-48042559 GGTGATAAGGGACCGCAAGGAGG - Intronic
1168473462 19:56659669-56659691 CGTGTGGAGGTGCCACAAGCTGG - Intergenic
937434301 2:121867525-121867547 GGTGTTAGGGGAGCAGAAGCAGG - Intergenic
938147477 2:128848821-128848843 GGTCTTCAGTGGACACAAGCTGG - Intergenic
946460356 2:219863315-219863337 GGTGGCAATGGGCCACAAGGGGG + Intergenic
947092010 2:226522213-226522235 GAGGTTAAAGGGCCACAGGCTGG - Intergenic
947982917 2:234425576-234425598 GGTCTGAAGGGACCACCAGCAGG - Intergenic
1172523727 20:35585010-35585032 AGTGTTCAGGGGCCCCTAGCTGG + Intergenic
1176026963 20:62990704-62990726 GGTACTAAGTGCCCACAAGCCGG - Intergenic
1180976693 22:19852546-19852568 GGTGGGAAGAGGCTACAAGCGGG + Intronic
1181633830 22:24165200-24165222 GGAGTTCAGGGGCCTCCAGCTGG + Intronic
1184198929 22:42951680-42951702 GGTGTGAAGCGGCCACATTCTGG - Intronic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1185016621 22:48347041-48347063 GGCGTGAAGGAGCCACAAGCGGG - Intergenic
950416114 3:12869783-12869805 GGTGGGAAGGGGCCACAGGTGGG - Intronic
952630599 3:35461466-35461488 AGTGTTACGGGGCCACAATCAGG - Intergenic
953194627 3:40720852-40720874 GGTGGAAACAGGCCACAAGCTGG - Intergenic
953741389 3:45541998-45542020 AGTATTTAGGGGCCACCAGCAGG - Intronic
954284715 3:49610736-49610758 GGTATTAAGGGGTCCCAGGCAGG + Intronic
956681601 3:71786008-71786030 GGGCTTAAGGGGCCTCAGGCTGG - Intergenic
961387202 3:126529437-126529459 GGTGTTAAGGGTGCAGATGCTGG + Intronic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
981210833 4:142102644-142102666 GGTGTTAAAGGGCCTCAACCAGG + Intronic
982419510 4:155177731-155177753 GGTGTGTAGGGTGCACAAGCTGG - Intergenic
982476084 4:155852750-155852772 GGTGTGCATGGGACACAAGCTGG + Intronic
992679848 5:79142834-79142856 GGTGTTCAGGGGTCACAAACTGG - Intronic
997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG + Intronic
997752830 5:136365303-136365325 GGTGTTGAGTCGCCAGAAGCTGG + Exonic
998038680 5:138937312-138937334 GGTGTTAGAGGGCAAAAAGCTGG + Intergenic
999440232 5:151595251-151595273 AGTGTAAAGGGGCCTCAACCTGG - Intergenic
1004013942 6:11715403-11715425 GTAATTAAGGGGCCACAAACAGG - Intronic
1007664520 6:43506414-43506436 GGGGCTCAGGGGCCTCAAGCTGG + Exonic
1011280208 6:85669946-85669968 GGTATTTAGAGGCCACAATCTGG + Intergenic
1018983137 6:168615277-168615299 GGTGTGAAGAGGCCCCATGCTGG - Intronic
1031915604 7:127560078-127560100 GGCTTTGAGGGGCCACAAACAGG - Intergenic
1032398631 7:131608414-131608436 GCTGTGAACGGGCTACAAGCCGG + Intergenic
1035239808 7:157522233-157522255 GGTGCTAAGGGGCACCAAGCTGG - Intergenic
1035572361 8:681119-681141 GGGGTGCAGAGGCCACAAGCTGG - Intronic
1035830377 8:2688719-2688741 AGTGGTAAGGGGCCAGGAGCAGG - Intergenic
1037631527 8:20661049-20661071 GGTGAGAAGGGGCCAGATGCTGG - Intergenic
1038583326 8:28769019-28769041 CCTGTTAATGGGCCTCAAGCTGG - Intronic
1038749519 8:30282702-30282724 GCTCTTAACGGGGCACAAGCAGG - Intergenic
1039842497 8:41304039-41304061 GGTGTTCAGGGGCCGAGAGCTGG - Intronic
1041775623 8:61519750-61519772 GATGGAAGGGGGCCACAAGCCGG + Intronic
1042194171 8:66218205-66218227 GGTTTTAATGAGGCACAAGCTGG - Intergenic
1042520253 8:69703972-69703994 GGTGTTCAGGGTCGACAAGTTGG + Intronic
1042924156 8:73950051-73950073 GGTATTTAGGGGCCCCAATCTGG - Intronic
1043285034 8:78517270-78517292 GTTGGTACAGGGCCACAAGCAGG - Intronic
1044926537 8:97214008-97214030 GGTGTTAGAGGGCCACTGGCAGG - Intergenic
1045246393 8:100445192-100445214 TGTGTTAAAAGGTCACAAGCTGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1051939398 9:22486961-22486983 GGTGTTAAGAGGTCAAAAGCGGG + Intergenic
1052342894 9:27380665-27380687 GGTGGGGAGGGGCCAGAAGCTGG - Intronic
1052935219 9:34087401-34087423 GGTTTTAAGGGGCCTGGAGCTGG - Exonic
1053223035 9:36327271-36327293 GGGGTAAAGGGGCCACGATCAGG + Intergenic
1058530571 9:105901653-105901675 GGTGCTCAGGGGCCACCTGCTGG - Intergenic
1062375592 9:136260470-136260492 AGTCTCAAGGGGCCACATGCTGG - Intergenic
1191750134 X:64533632-64533654 GGTGTTAAGTGGCCATCAGAAGG - Intergenic
1193256674 X:79356560-79356582 GCTGTTAAGGGGTCAGAAGTTGG - Intergenic
1197648369 X:129040949-129040971 GGGGTTCAGGGTCCTCAAGCTGG - Intergenic
1198073542 X:133172739-133172761 GGTGGTAAGGGGGCAGTAGCAGG + Intergenic