ID: 1157157338

View in Genome Browser
Species Human (GRCh38)
Location 18:45280799-45280821
Sequence CTCTTCAGAGATGATTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157157338 Original CRISPR CTCTTCAGAGATGATTCAAG AGG (reversed) Intronic
901673340 1:10868434-10868456 CTGCTCAGAGATGAGCCAAGAGG + Intergenic
904217328 1:28931980-28932002 ATCTTAAGAGATGAACCAAGAGG + Intronic
905005591 1:34707196-34707218 TTCCTCAGAAATGTTTCAAGAGG + Intergenic
916605173 1:166335318-166335340 CTCTCCACAGATGGTTCAGGTGG + Intergenic
918679863 1:187340342-187340364 CTCTTCACAGAGGAATAAAGAGG + Intergenic
921815087 1:219554433-219554455 CTCTTCACAGATGTTTTTAGGGG - Intergenic
922415772 1:225421669-225421691 CTATTCAAAGATGATTTTAGTGG - Intronic
923290065 1:232536448-232536470 CTCATAAGCAATGATTCAAGAGG - Intronic
923438015 1:233986988-233987010 AGCTTCAGAAATGATGCAAGAGG + Intronic
923845967 1:237732916-237732938 CTCTTCTGAGGAGATTCATGTGG - Intronic
924359692 1:243225007-243225029 CTTTTTTTAGATGATTCAAGGGG + Intronic
924492064 1:244548126-244548148 CTCTTCAGTGATCATTCAGATGG - Intronic
1064644729 10:17449456-17449478 CCCTGCAAAGATGTTTCAAGTGG - Intronic
1067258261 10:44664088-44664110 GTCTTCAGAGAAGATTGAACAGG + Intergenic
1067959129 10:50828152-50828174 CTCTGAAGAGATGATTGAAAAGG - Exonic
1070401805 10:76059309-76059331 CTCTCCAGAGCTGATTAGAGTGG + Intronic
1071230305 10:83578936-83578958 GGCTTCATAGATGTTTCAAGAGG + Intergenic
1071711738 10:88056506-88056528 GTCTTAAGAGATGATACTAGAGG - Intergenic
1071995523 10:91144628-91144650 CTCATCAGAGCTGAATCAAATGG + Intergenic
1072298687 10:94038118-94038140 CTTTTCAGAGGTCATTCAAAGGG - Intronic
1073485785 10:103818344-103818366 CACTGCAGAGATGATTGCAGAGG - Intronic
1074111433 10:110425389-110425411 CTCTTCGGAGATGGCTCAAGTGG + Intergenic
1079303185 11:19297596-19297618 TTCTTCAGAGAAGATTCAACAGG + Intergenic
1082752861 11:57039577-57039599 CTCTCCAGAGATGGTCCAGGAGG - Intergenic
1083546352 11:63551873-63551895 CTCATCAGAGAACATTCCAGTGG - Intergenic
1085735552 11:79035994-79036016 CACTAAAAAGATGATTCAAGAGG - Intronic
1086356695 11:86008692-86008714 CTCCTCAAACATGTTTCAAGAGG + Intronic
1086576370 11:88342668-88342690 CTCCTTAGAGATCATTTAAGTGG - Intergenic
1087375597 11:97335975-97335997 CTCTTCAAAGAGGAGTCAAGTGG - Intergenic
1098717801 12:73854124-73854146 CTCTTTAGAGATTAGTTAAGTGG - Intergenic
1098997837 12:77142149-77142171 CTCCTCAGAGAAGTTTCAACTGG - Intergenic
1099931195 12:89076948-89076970 CTCATGAGAAATGCTTCAAGTGG + Intergenic
1102354809 12:112223858-112223880 CTCTTCTGGGATGAATTAAGTGG - Intronic
1104837521 12:131801037-131801059 TTCTTCAGTGATGAGTCAAATGG + Intergenic
1105588220 13:21764344-21764366 AGCTTCAGAGAGGATTCAATGGG - Intergenic
1105697894 13:22908535-22908557 CTTCTCAGAGATTATTTAAGTGG - Intergenic
1112230254 13:97582850-97582872 CTCTTCAGAGTTCAGTCAACTGG - Intergenic
1113653154 13:112052209-112052231 CTCATCACAGGTGATTCCAGGGG - Intergenic
1118181027 14:63493417-63493439 CACTTGAGAGAGGATTGAAGCGG - Intronic
1121080693 14:91105656-91105678 TTCTTCAGAGACACTTCAAGGGG + Intronic
1127153695 15:56106364-56106386 TTCTTCTGACATGATTCAGGAGG - Intronic
1127259945 15:57320106-57320128 CTCGTCAAAGTTGATTCCAGGGG + Intergenic
1128086287 15:64888816-64888838 CTCGTCAGAGCTGACTCCAGGGG + Intronic
1129084872 15:73078428-73078450 GTCTTCAAGGATGATTCAGGAGG + Intronic
1130916863 15:88312009-88312031 CTCACCAGAGATTATTCATGAGG - Intergenic
1130993757 15:88892687-88892709 CTCTCCAGAGAAGACTAAAGGGG + Intronic
1131931306 15:97445234-97445256 TTCATCAGAGATGATTCCTGGGG + Intergenic
1133400514 16:5482966-5482988 CTATTCAGAGAAAATTCAAAGGG - Intergenic
1133815860 16:9196911-9196933 CTCATGAGAGAAGATTTAAGGGG + Intergenic
1134429024 16:14183676-14183698 CTATTCAGAGATGATTCTGGGGG + Intronic
1135171553 16:20188544-20188566 CTCTTCACTCATGATTGAAGTGG - Intergenic
1136749599 16:32622123-32622145 CTCTTCTGAAAAGATTCAGGAGG + Intergenic
1137728802 16:50674820-50674842 CTCTTGAAAGATGATTGAAAAGG - Intronic
1138549374 16:57739260-57739282 CTCTTCAGAGTTGATTCCCACGG - Intronic
1139168203 16:64596607-64596629 TTATTTTGAGATGATTCAAGAGG - Intergenic
1146725900 17:35155475-35155497 TTCTTCAGTTTTGATTCAAGGGG + Intronic
1150735974 17:67739921-67739943 TTCTTAAGAGATGATTAAGGGGG - Intronic
1151164560 17:72192628-72192650 TTCATCATGGATGATTCAAGAGG + Intergenic
1203184602 17_KI270729v1_random:102198-102220 CTATTCAGTGATGATTCCATTGG + Intergenic
1153295523 18:3542489-3542511 ATCTTTAGAGATCATCCAAGTGG - Intronic
1154135073 18:11770368-11770390 TTTTTCAGAGATGATTCTAAAGG - Intronic
1155222351 18:23697184-23697206 CTCTTCAGAAATCATTTCAGTGG - Intronic
1156652157 18:39237205-39237227 CTCTTCAGACATGAATCTACAGG - Intergenic
1157157338 18:45280799-45280821 CTCTTCAGAGATGATTCAAGAGG - Intronic
1159639234 18:70844140-70844162 CTCTTCTGAGAAGAGCCAAGAGG + Intergenic
1160373625 18:78394561-78394583 TTCTTCAGAGATGGTTGAATAGG - Intergenic
1164434745 19:28219526-28219548 CTCTCCAGAGGTGATTCTTGTGG - Intergenic
1164913955 19:32034945-32034967 TTGTTCAGAGATGCTTCAACAGG + Intergenic
925721402 2:6831450-6831472 CCCATCAGAGATAATGCAAGTGG + Intergenic
925730089 2:6913663-6913685 CACTGCAGAGATTATTCGAGAGG + Intergenic
926868780 2:17389738-17389760 CCCTTCAGAAATGTTTCATGTGG - Intergenic
927585454 2:24299490-24299512 CTCTCTAGAGAGGAATCAAGAGG - Intronic
927725513 2:25419409-25419431 CTCTTCAGAGATGATGTGCGGGG + Intronic
928876757 2:36049076-36049098 CTCTGCACAGATCATGCAAGTGG + Intergenic
941180600 2:162254743-162254765 CCCTTCAGAGTTGTCTCAAGTGG + Intergenic
943123010 2:183760897-183760919 CTCTTCAGAGAGGACTCAGCTGG + Intergenic
944699454 2:202233605-202233627 CTCAGCTGAGATGACTCAAGTGG - Intronic
947262914 2:228244214-228244236 TTCTTTAGAGTTGATTCTAGAGG + Intergenic
1172179588 20:32993578-32993600 CTTTTCAGAAATGTTTGAAGTGG - Intronic
1174572295 20:51510481-51510503 CTCTTTTGAGATGAATCAAGTGG + Intronic
1174703059 20:52628595-52628617 CTCTTGAGTGATGATGCAAAAGG + Intergenic
1178542500 21:33465642-33465664 CTCTCCAGAGATTATACAAGAGG + Intronic
1179091726 21:38272061-38272083 CCCTTTAGAGAGAATTCAAGAGG + Intronic
1181022987 22:20113220-20113242 CTCTTCAGAGTTGAGTAATGTGG - Exonic
1184761810 22:46549159-46549181 CACTTCAGAGATGCTTCCTGAGG + Intergenic
949296522 3:2530997-2531019 ATCTTCATAGATGACTCATGTGG + Intronic
952305694 3:32144225-32144247 CCCTCCACAGAAGATTCAAGTGG - Intronic
957582740 3:82095964-82095986 CTTTTCATAGATGTTTCAGGTGG + Intergenic
960244550 3:115385905-115385927 CTCTGGAGAGGTGATTGAAGCGG - Intergenic
961189136 3:124942817-124942839 CTCTTCAGAGAGGAAGCGAGTGG + Intronic
965430357 3:168579334-168579356 ATCTTCAGAGATGAATAAACTGG + Intergenic
966133584 3:176672668-176672690 CTCTCCATAGACGTTTCAAGAGG - Intergenic
967425610 3:189323862-189323884 CTTATCAGAGATTTTTCAAGTGG - Exonic
970286525 4:14522918-14522940 CACTCCAGAGATTATTCTAGTGG - Intergenic
971386919 4:26149295-26149317 CTCTTCAGTGATTTGTCAAGTGG + Intergenic
976531359 4:86156612-86156634 CTCTCTAAAGATGATTCAAATGG - Intronic
976784886 4:88807196-88807218 CTTTTGAGAGATGATTTAAATGG + Intronic
976862482 4:89682134-89682156 CTCTTCAGAGATGCAACAAATGG - Intergenic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
978002381 4:103572336-103572358 TTCTTCAGAGATCATGGAAGTGG + Intergenic
978931888 4:114324371-114324393 CTGTTCAGATATGAATCAAAAGG + Intergenic
979401720 4:120256775-120256797 CTCTTCAAAGAATATTCAAGGGG - Intergenic
982777124 4:159453361-159453383 TTCTTCAGAAATAATACAAGTGG - Intergenic
983037030 4:162879184-162879206 CTCTTCTGAGATGTTTTGAGAGG - Intergenic
986964251 5:13251618-13251640 CTCTTCAGAGATGACCTAAAAGG - Intergenic
990727542 5:58773531-58773553 CTCCTCACAAATTATTCAAGGGG - Intronic
991194792 5:63920242-63920264 CTCTGCAGGGCTGATGCAAGAGG + Intergenic
992511738 5:77443381-77443403 CTCTTAAGAGATTGTTCATGTGG - Intronic
993766676 5:91867921-91867943 ATCTTCAGAGAAGACTAAAGTGG - Intergenic
994074072 5:95631503-95631525 CTCTTCTGAAAGGGTTCAAGGGG - Intergenic
995395812 5:111685832-111685854 CTCATCAAACATTATTCAAGTGG - Intronic
995941540 5:117591853-117591875 CTCTTTAGAAATAACTCAAGGGG - Intergenic
999798495 5:155010436-155010458 GAGTTCAGAGATAATTCAAGAGG - Intergenic
1000887275 5:166761211-166761233 CTCTTAAGAGATGACTCGGGTGG + Intergenic
1001225031 5:169936747-169936769 CTGATCAGAGATTATTCATGAGG - Intronic
1001964417 5:175900424-175900446 CTCTTCAGATCTGATGCCAGCGG + Intergenic
1002911419 6:1493925-1493947 GTCTTTCAAGATGATTCAAGTGG - Intergenic
1004499872 6:16199817-16199839 CTTTTCAGTGATGATTTGAGGGG - Intergenic
1006045990 6:31298825-31298847 CTCTGCAGAGAAGATGCTAGAGG + Intronic
1010749825 6:79605298-79605320 CTCTTCTGACATCATTCATGTGG - Intergenic
1011008731 6:82678903-82678925 TTCTTCAGTGATGTTTCCAGTGG + Intergenic
1012843353 6:104358242-104358264 CGCTTGAGAGATTATACAAGTGG - Intergenic
1013699961 6:112754482-112754504 CTGTTCAGTGATAATTTAAGTGG + Intergenic
1015454329 6:133408386-133408408 CTCTACATAAATCATTCAAGAGG - Intronic
1016476749 6:144435653-144435675 CTGTTCAGAAGTGATTCATGTGG + Intronic
1017371529 6:153715152-153715174 CTGTTCACAGATGTTTGAAGTGG + Intergenic
1017506660 6:155074775-155074797 GTCTTCAGAGCTGATCCCAGCGG + Intronic
1018406962 6:163495944-163495966 CTCCTCAGATATGATTTAAAAGG - Intronic
1021634354 7:22676904-22676926 CTATTCAGAGCTGAGTCATGGGG + Intergenic
1023298869 7:38746598-38746620 CTCTTGTGAGAAGCTTCAAGGGG + Intronic
1024897359 7:54275436-54275458 CTCTTCAGATGAGACTCAAGTGG + Intergenic
1028887453 7:95949679-95949701 CTCATCAGTGAGGATTTAAGAGG + Intronic
1029145715 7:98444391-98444413 GTTTTCAGACATGATTTAAGGGG - Intergenic
1031922429 7:127611945-127611967 CTGTGCAGAGATGATTCCTGGGG + Exonic
1033436302 7:141336384-141336406 CTTTTCAGAGATCAGTCAGGAGG + Intronic
1036389275 8:8310565-8310587 CTTTTCAGAGATGAAACAAAGGG + Intergenic
1036597550 8:10227557-10227579 CTCTTCAGAGAATATTCCCGGGG + Intronic
1038282540 8:26179057-26179079 CTTCTCAGAGAATATTCAAGTGG + Intergenic
1038957503 8:32483332-32483354 CTCTTCAGAGACAAGGCAAGTGG - Intronic
1040275157 8:46009234-46009256 CTCTTCAGACATGCTACAAAAGG - Intergenic
1040937683 8:52797981-52798003 CTCTTGAAAGAAGATTCAAGAGG - Intergenic
1044363809 8:91319811-91319833 GTATGCAGATATGATTCAAGAGG - Intronic
1044894098 8:96870324-96870346 CTCTTCAGAAATGATTATATTGG + Intronic
1047138565 8:122108698-122108720 CTGTTCAGAGATAGTTTAAGTGG + Intergenic
1047533819 8:125701099-125701121 ATGTTCAGTGATGATTAAAGGGG - Intergenic
1047652611 8:126939596-126939618 CTTTTCAGAAAGAATTCAAGTGG - Intergenic
1056943987 9:90978213-90978235 ATCCTCAGAGAAGATTCAAGAGG + Intergenic
1186663242 X:11691184-11691206 CTTATCAGGGTTGATTCAAGTGG + Intergenic
1189086577 X:38031536-38031558 ATATTCAGAAATTATTCAAGGGG - Intronic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1192605014 X:72507232-72507254 CTCTCAACAGATGGTTCAAGTGG + Intronic
1192693556 X:73390975-73390997 CTCTTCAGACCTGATTGCAGTGG + Intergenic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1193241094 X:79170520-79170542 CTCTTCAGGGATGATTAACTTGG - Intergenic
1196125413 X:112093487-112093509 CTCTTGAAAGATGATTAAAGAGG - Intergenic
1196248200 X:113426180-113426202 CTCTTCCAAGCTCATTCAAGTGG - Intergenic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic
1201480884 Y:14438307-14438329 CTCTTCAAGGATGTTACAAGTGG + Intergenic