ID: 1157158605

View in Genome Browser
Species Human (GRCh38)
Location 18:45291561-45291583
Sequence CAGTGTCCTCAGAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 531}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157158591_1157158605 21 Left 1157158591 18:45291517-45291539 CCGTTTTCTCCTAACCTCCCAGT 0: 1
1: 0
2: 2
3: 39
4: 377
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158600_1157158605 -10 Left 1157158600 18:45291548-45291570 CCAGGAACCATGCCAGTGTCCTC 0: 1
1: 0
2: 2
3: 9
4: 215
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158597_1157158605 4 Left 1157158597 18:45291534-45291556 CCCAGTGTGGGAACCCAGGAACC 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158596_1157158605 7 Left 1157158596 18:45291531-45291553 CCTCCCAGTGTGGGAACCCAGGA 0: 1
1: 0
2: 4
3: 49
4: 579
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158599_1157158605 -9 Left 1157158599 18:45291547-45291569 CCCAGGAACCATGCCAGTGTCCT 0: 1
1: 1
2: 0
3: 17
4: 183
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158598_1157158605 3 Left 1157158598 18:45291535-45291557 CCAGTGTGGGAACCCAGGAACCA 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531
1157158594_1157158605 12 Left 1157158594 18:45291526-45291548 CCTAACCTCCCAGTGTGGGAACC 0: 1
1: 0
2: 1
3: 5
4: 148
Right 1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG 0: 1
1: 0
2: 2
3: 50
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157158605 Original CRISPR CAGTGTCCTCAGAGGCAAGA GGG Intronic
900387333 1:2416619-2416641 CAGAGGCCCCAGAGCCAAGATGG + Intergenic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
901237743 1:7676498-7676520 CAGAGTCCTCGGAGGAAAGATGG + Intronic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
902330058 1:15726905-15726927 CTGTGCCCTCAGAGGCTACATGG + Intronic
902745776 1:18473395-18473417 CAGTGTCCTCATCTGTAAGATGG + Intergenic
902886684 1:19410168-19410190 CAGTCACCTAAGAGGCAAGCAGG - Intronic
903049125 1:20587920-20587942 CAGTGTCCTCATCTGCAAAATGG - Intergenic
903341204 1:22655619-22655641 CAGTTTCCTCATCTGCAAGATGG + Intronic
903406039 1:23097093-23097115 CTGTTTCCTCACAGGGAAGAAGG + Intronic
904484390 1:30815127-30815149 GTGTGTCCTCAGAGGCAGAAGGG - Intergenic
904507491 1:30970322-30970344 CACTGTCCACACTGGCAAGAAGG + Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
905882598 1:41474434-41474456 CAGTTTCCTCATCTGCAAGATGG + Intergenic
906043303 1:42806282-42806304 CAGTGACTTCAGAGGCAGCAGGG + Intergenic
906305791 1:44718326-44718348 AAGTGTCATCAGATGCATGAGGG + Intronic
906341460 1:44984553-44984575 CAGTGTCCTCAGCTTCTAGAAGG + Intronic
906461836 1:46040575-46040597 CAGTGGCCTCAGAAACCAGAGGG - Exonic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
907508022 1:54936018-54936040 CAGTGTTCTCAATGGCAAGGTGG + Intergenic
907831923 1:58072487-58072509 CAGTTTCCTCATATGCAAGATGG + Intronic
907847533 1:58222881-58222903 CAGTGTCCTCAGCTGTAAAATGG - Intronic
908629740 1:66089567-66089589 CTGTATCCTCAGAAACAAGATGG - Intronic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
912510301 1:110185182-110185204 CAGTTTCCGCAATGGCAAGATGG + Intronic
913205184 1:116532271-116532293 CGCAGTCCTCACAGGCAAGAAGG + Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913320289 1:117583175-117583197 CAGTTTCCTCACCTGCAAGATGG + Intergenic
913398133 1:118395572-118395594 AAAAGTCCTCTGAGGCAAGAGGG + Intergenic
914347197 1:146809962-146809984 CAGTGTCCTCATCTGCAAAATGG + Intergenic
914384949 1:147159535-147159557 CTGAATCCTTAGAGGCAAGAAGG + Exonic
914958374 1:152184815-152184837 CTGTCTCCTCAGTGGCAATACGG - Intergenic
915288271 1:154866707-154866729 AAGTGGCCGCTGAGGCAAGAAGG + Intronic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
916007668 1:160677073-160677095 CAATGTCCGCAGAGGCACGCTGG + Intergenic
916070887 1:161169123-161169145 CAGTGTTCTCAGAGGCCAGCCGG + Exonic
916731015 1:167566913-167566935 CAGTTTCCTCAGCTGTAAGATGG - Intergenic
916898968 1:169200452-169200474 CAGTCTCCTCAGGGTCAATAAGG - Intronic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
917598103 1:176550215-176550237 CAGTGTCCTCATCTGTAAGATGG + Intronic
917696289 1:177527638-177527660 CATTGTCCTCAGGCGCATGAAGG - Intergenic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918774172 1:188608091-188608113 CAGTGTCCTCAGATGCATCATGG - Intergenic
919530046 1:198705750-198705772 GAGTGGCCACAGAGGCAGGAAGG - Intronic
919809163 1:201398421-201398443 CAGTTTCCTTAGGGACAAGATGG + Intronic
920206715 1:204297595-204297617 CAGTTTCCTCATCGGCAACAGGG + Intronic
921257349 1:213354613-213354635 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
921286897 1:213616976-213616998 CAGTGTCCTCATTGGTAAGAAGG + Intergenic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923503035 1:234582217-234582239 CACTGGGCTCAGAGGCCAGATGG - Intergenic
1062879556 10:966931-966953 CAGTGTTCTGAGAGCCAAGTGGG - Intergenic
1063155031 10:3371573-3371595 CAGTCTCCTCAAAGGCTTGAAGG + Intergenic
1065123760 10:22553297-22553319 CAGAGTGCTCAGGGGCACGAAGG + Intronic
1065840761 10:29699002-29699024 CAGTGTGCTCAGAGACAAATTGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067939909 10:50646553-50646575 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068944001 10:62710175-62710197 CAGTTTCCTCTGAAACAAGATGG - Intergenic
1069606128 10:69739877-69739899 GAGTTTCCTCATAGGCAAAACGG + Intergenic
1069721043 10:70549555-70549577 CAGTGTCCTCAGAGACAGCCTGG + Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070261080 10:74856475-74856497 CAATGTCTTCAGAAGCAAAAAGG - Intronic
1070487105 10:76941900-76941922 CAGTGTCCTCACATGACAGAAGG + Intronic
1070761697 10:79028068-79028090 GAGGGTCCTCAGAGGCCACAAGG - Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071025629 10:81109463-81109485 CAATGACCTCGGAGGCAGGATGG + Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071438784 10:85671018-85671040 CAGTGTCCTCATAGGACATAGGG - Intronic
1071779330 10:88825627-88825649 CAGTGTCCTCATCGGTAAAATGG - Intronic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1075222541 10:120597700-120597722 CAGTGTCCTCATGTGTAAGATGG + Intergenic
1075456909 10:122590773-122590795 CAGTATCCACACAGGTAAGAAGG - Intronic
1075758726 10:124838679-124838701 CAGTGTTGTCCCAGGCAAGATGG + Intergenic
1076002562 10:126923860-126923882 CTGTGTCCTCACAGGGTAGAAGG - Intronic
1076274584 10:129185913-129185935 CAGTATCCTCAGTGCCAAAATGG + Intergenic
1076978043 11:190125-190147 CAGTGTCCTCAGCTGCCAGCAGG - Intronic
1077508858 11:2944953-2944975 CGCAGTCCTCACAGGCAAGAAGG + Exonic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1078744837 11:14102664-14102686 CAGTGTCATGAAAGTCAAGAAGG - Intronic
1078909978 11:15722052-15722074 CAGTGTCCTCACAGGATGGAAGG + Intergenic
1078950207 11:16123307-16123329 CAGTTTCATCACAAGCAAGAAGG + Intronic
1081654001 11:44845286-44845308 CAGTGTCCTCATCTGTAAGATGG + Intronic
1081773585 11:45664089-45664111 CAGGGACGTCAGAGGCAAGCAGG - Intronic
1082000265 11:47390320-47390342 CAGTGTCCTCATCTGCAAAATGG + Intergenic
1083272413 11:61579117-61579139 CAGTGGCCTAACAGGCCAGAGGG + Intronic
1083339315 11:61948644-61948666 CAGTCTCCTCATATGCAAAATGG - Intergenic
1083486591 11:62986743-62986765 CAGTGTCCTCATTTGCAAGATGG + Intergenic
1083553598 11:63608889-63608911 CAGTTTCCTCAGCTGCAAAATGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084428184 11:69096974-69096996 CAGTCTCCTCACCTGCAAGATGG - Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1085896389 11:80644565-80644587 GAGTGTCCCCACTGGCAAGAAGG + Intergenic
1086162363 11:83736293-83736315 CAGTGTCCTCATAGGGGAAAAGG + Intronic
1086745790 11:90425188-90425210 GGGAGTCCCCAGAGGCAAGATGG + Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087676986 11:101175023-101175045 CAGCTTCCTCAGAGGTAAAATGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1088630255 11:111767173-111767195 AAGAGTCCTCAGAGGCAGCAAGG + Intergenic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1089140607 11:116280885-116280907 CAGTTTCCTCATGGGCAAAATGG - Intergenic
1089289380 11:117428568-117428590 CAGAGTCCTCTGAGGTAAGGTGG + Exonic
1090988060 11:131790510-131790532 TCATGGCCTCAGAGGCAAGAAGG + Intronic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1091364012 11:135001805-135001827 CAGTGGCCTCAGAGGAAGGAGGG + Intergenic
1091582762 12:1799084-1799106 CAGAGCCCGCTGAGGCAAGATGG + Intronic
1091997288 12:5003514-5003536 CAGTGACGTCATTGGCAAGATGG + Intergenic
1092572851 12:9744258-9744280 AATTGTCCTCAGTGGAAAGAGGG - Intergenic
1092813371 12:12291833-12291855 AACTGTACTCAAAGGCAAGAAGG - Intergenic
1092826361 12:12403486-12403508 CAGTTTCCTCAGAAGCAGGAAGG - Intronic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093480848 12:19602390-19602412 CAGTGTCCTCATATGGCAGAGGG - Intronic
1093633203 12:21434811-21434833 TAGTTTCCTCATTGGCAAGACGG - Intergenic
1093655367 12:21688057-21688079 CAGTGTCCACACATGCCAGAGGG - Intronic
1093794668 12:23297292-23297314 CTGTGTCCTCACATGCCAGAAGG + Intergenic
1094044917 12:26156854-26156876 CAGTTTCCTCATATGCAAAAGGG - Intronic
1095748609 12:45686927-45686949 CAGAGTCCTCATCAGCAAGAAGG - Intergenic
1095989716 12:48026359-48026381 CAGTGTACTCAGGGCCAGGACGG + Intergenic
1096504364 12:52083180-52083202 TCATGTCCTCAGAGGCCAGAAGG - Intergenic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099123787 12:78726815-78726837 CATTGTCCTTAGAGACAACATGG + Intergenic
1100614008 12:96216788-96216810 CAGTATCCTCATAGGTAAAATGG - Intronic
1101005905 12:100400463-100400485 CATTTTCCTCAGAGATAAGATGG - Intronic
1102081883 12:110104876-110104898 AAATGGACTCAGAGGCAAGAAGG + Intergenic
1102301316 12:111773552-111773574 CAGTTTCCTCACCCGCAAGACGG - Intronic
1102621233 12:114196448-114196470 AAGTGCCTTCAGAGGCAAGAGGG - Intergenic
1102730212 12:115102574-115102596 GACTGTCCCCAGAGGCAAGGTGG + Intergenic
1102953425 12:117045019-117045041 AAGTGTCCTCAGAGGCTGGGAGG + Intronic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103213064 12:119180495-119180517 CAGCCTCCTCAGCTGCAAGATGG - Intronic
1103740300 12:123086615-123086637 CAGTTTCCTCATATGCAACATGG - Intronic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1104648955 12:130517293-130517315 CAGAGTCCTCATCAGCAAGAAGG + Intronic
1112266799 13:97931874-97931896 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1112766002 13:102744491-102744513 CAAAGTCCTCATATGCAAGAAGG - Exonic
1112953710 13:105034093-105034115 CTGTGTCCTCACAGGACAGAAGG + Intergenic
1113295239 13:108952355-108952377 CACTGGGCTCAGGGGCAAGACGG + Intronic
1113754247 13:112798530-112798552 CAGTGCCCTGGGGGGCAAGAAGG + Intronic
1114612267 14:24050954-24050976 CCGGGTCCTCAGAGGCGGGACGG - Intergenic
1115684662 14:35783590-35783612 TAGTGTCCTCTGAAGCAAAAAGG - Intronic
1116145979 14:41069557-41069579 CTGTGTCCTCACAGGACAGAAGG - Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1118505155 14:66403103-66403125 CTGTTTCCTCAGAGGTAAAATGG + Intergenic
1118589116 14:67387835-67387857 CAGTTTCCACAGACACAAGATGG + Intronic
1118794972 14:69134100-69134122 CAGTTTCCTCACTGGCAAAATGG - Intronic
1118823640 14:69361534-69361556 CAGTGTCCTCAAGTGCAACATGG - Intergenic
1120826795 14:88963353-88963375 CAGTGCTTTCAGAGGCCAGAGGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121520330 14:94581697-94581719 CCGTTTCCTCATAGGTAAGATGG + Exonic
1121636366 14:95456526-95456548 CAATGTCCTAAGAGGGTAGAGGG - Intronic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122071665 14:99209168-99209190 CAGTTTCCTCATTTGCAAGACGG + Intronic
1122274105 14:100582463-100582485 CAGTGTCCTCAACTGCAAAAGGG - Intronic
1122738586 14:103857735-103857757 CAGTGTCCACACATGCCAGAAGG - Intergenic
1124013898 15:25860775-25860797 CAGTTTCCTCATCGGCAAGATGG + Intronic
1124355059 15:28989322-28989344 CAGTGTCCTCATCTGCAAAATGG + Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1125554178 15:40570399-40570421 TAGTTTCCTCAGAGGTAAAATGG - Intronic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1127533063 15:59864072-59864094 CAGTGTCCTGAGAAACAAGATGG - Intergenic
1127691269 15:61399706-61399728 CAGTGTCCTCATCTGTAAGATGG + Intergenic
1128301402 15:66568275-66568297 CTGTGTCCTCAGGGGTAAGCAGG + Intergenic
1128801454 15:70499689-70499711 CAGTGTCCTCATTTGCAAAATGG - Intergenic
1129503969 15:76065632-76065654 CAGTGTCCTCATCGGTAAAATGG + Intronic
1129847200 15:78773386-78773408 CAGTTTCCTCAGATGTGAGACGG + Intronic
1132024255 15:98391592-98391614 CAGTGTCCTCATCTGCCAGATGG + Intergenic
1132908927 16:2298630-2298652 CAGGGTCCTCAGAGGAAATTAGG - Intronic
1132945686 16:2530449-2530471 GGCTGTCCTCAGAGCCAAGAGGG - Exonic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133720476 16:8489946-8489968 CAGTTTCCTCAAAAGCAAAATGG - Intergenic
1133826980 16:9286875-9286897 CAGTGTCCTCAGCTGTAAAATGG - Intergenic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1134395608 16:13860132-13860154 CTGAGTCCTGAGAGACAAGAAGG - Intergenic
1135122165 16:19775661-19775683 CAGTGACCTCAGAGGTAAGAGGG - Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135651291 16:24208981-24209003 CATTGTTCTCTGAGGCAGGAGGG + Intronic
1135831700 16:25780015-25780037 GAGTGTCCTAGGAGGCAAGCGGG + Intronic
1136236938 16:28920119-28920141 CAGTGTCCTTAGGTGCAAAATGG + Intronic
1136408153 16:30061201-30061223 GCGTGTCCTTAGAGACAAGAAGG - Intronic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1136517158 16:30775067-30775089 CAGTGCCCGGAGAGGCCAGAGGG + Exonic
1137467880 16:48727565-48727587 CTGTGTCCTCACATGCAAGGAGG + Intergenic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1138334695 16:56243926-56243948 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139986793 16:70905306-70905328 CAGTGTCCTCATCTGCAAAATGG - Intronic
1140642873 16:76997502-76997524 TAGTGTCCTCTGAAGCAAGAAGG - Intergenic
1140697716 16:77551501-77551523 CAGAGTCCTCAGAGACCAGAAGG + Intergenic
1140947342 16:79781825-79781847 CACTTTTCTCAGAGGCAATATGG - Intergenic
1141320402 16:83003194-83003216 CATTGGCCTCAGAGGCCAGCTGG - Intronic
1141366145 16:83445199-83445221 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1141637601 16:85322917-85322939 CAGTTTCCTCAAAAGCAAAACGG - Intergenic
1141743597 16:85910981-85911003 CAGTGTCCACAGGGGCACGCTGG - Intronic
1141766351 16:86062357-86062379 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
1142280445 16:89145147-89145169 CGGTGTCCTCTGAGGAAAGGGGG - Intronic
1142285596 16:89170294-89170316 CACTGACCACAGAGGCAGGATGG + Intergenic
1142465468 17:134590-134612 CAGTGTCCTCAGCTGCCAGCAGG - Intergenic
1142599518 17:1046809-1046831 CAGTGTCCTCATCTGTAAGATGG + Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1143724424 17:8835680-8835702 CACTGTCCACAGAGGAAAGCAGG + Intronic
1144136329 17:12298506-12298528 CAGTTTCCTCATTGGCAAAATGG + Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144366607 17:14550639-14550661 GACTGTCTTCAGATGCAAGATGG - Intergenic
1146508556 17:33426278-33426300 CAGCATCCTCAAAGGCCAGATGG + Intronic
1146847990 17:36196704-36196726 GAGTGTCAGCAGAGCCAAGAAGG + Exonic
1147836134 17:43333216-43333238 CAGCCTCCTCAGAGGAAAGAGGG + Intergenic
1148761401 17:50003587-50003609 CTGTGTCCGGTGAGGCAAGAGGG + Intergenic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149423786 17:56535349-56535371 CAGTGTCCTCATCTGCAAAATGG - Intergenic
1149481892 17:57010175-57010197 CAGTGCCCAAAGAGGCCAGATGG - Intergenic
1149623901 17:58066133-58066155 CTGTTTCCTGAGAGGCAATATGG - Intergenic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1151719128 17:75845625-75845647 CAGGGCCCTCAGCGGCCAGACGG + Intergenic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1152547524 17:81009282-81009304 CAGAGTCCTCAGTGGCAGGGCGG - Intronic
1153063558 18:1019397-1019419 CTGTGGCCTCAGAGGAAATATGG + Intergenic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154136431 18:11783985-11784007 CATTGTCCTGTGAGGCAGGAGGG + Intronic
1155046020 18:22103840-22103862 CAGTTTCCTCATCTGCAAGATGG - Intergenic
1155205344 18:23553573-23553595 CAGTGTCCTTAAAGGCAAAAAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156019369 18:32582008-32582030 CAGTTTCCCCAGAGGTAAAATGG - Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157473866 18:48009188-48009210 CAGTGTCTTCAAGGGCAAAAGGG - Intergenic
1158094227 18:53752787-53752809 CATGGACCTCAGAGGCAACATGG - Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158292720 18:55959598-55959620 CACCCTCTTCAGAGGCAAGAAGG + Intergenic
1158638182 18:59179607-59179629 CTGTGTCCTCACAGGGTAGAAGG + Intergenic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
1161129912 19:2581639-2581661 CAGTGTCCTCACCCTCAAGAAGG - Intronic
1161265824 19:3363882-3363904 CAGTGTCCACAGTGCCAAGGGGG + Intronic
1161389151 19:4012133-4012155 CAGTGTCCACAGGGCCAAGGAGG + Intronic
1161838241 19:6662395-6662417 CAGTTTCCCCATCGGCAAGATGG - Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1163409251 19:17143393-17143415 GAGTGTCCTCAAAGCCGAGAAGG + Intronic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
1164436289 19:28232721-28232743 CAGGGTCCTCAGATCCAGGAAGG + Intergenic
1164627270 19:29737842-29737864 CACTGACCACACAGGCAAGAGGG - Intergenic
1166090653 19:40506552-40506574 CAGTGCCCTGAGTGGCAGGATGG + Intronic
1166320630 19:42016489-42016511 CTGTGTCCTCAGGGGCCAGAGGG - Intronic
1166534273 19:43562409-43562431 CAGTTTCCTCACATGCAAAAAGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166888525 19:45975481-45975503 CATTGTCCCCAGAGCCAAGGGGG + Intergenic
1168404479 19:56103555-56103577 CAGCTTCCTCACTGGCAAGATGG + Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
1168593110 19:57652918-57652940 CCCTGTCCTCAGGGGTAAGAGGG - Intergenic
925033127 2:666700-666722 CAGAGTTCTCGGAGGCAGGAAGG - Intergenic
925584495 2:5450741-5450763 CTGTGTCCTCATAGGGTAGAAGG + Intergenic
926147244 2:10404303-10404325 CAGTGTGCTGGGAGGCAAAAGGG - Intronic
927792352 2:26020245-26020267 CAGAGTCCTCAGATGCTGGAAGG - Intergenic
928817240 2:35312805-35312827 CAGTATCCTCAAAAGCAAAATGG + Intergenic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929601801 2:43209189-43209211 CAGTTTCCTCACCTGCAAGATGG - Intergenic
931794280 2:65694398-65694420 CAGTGTCCTCATCTGCAAAATGG - Intergenic
932071530 2:68625611-68625633 AAGTGTCCTCAGGGGCTACATGG + Intronic
932490469 2:72116668-72116690 CAGTTTCCTCACATGCAAAAAGG + Intergenic
933781389 2:85804384-85804406 CAGTTTCCTCAGAGTTAAAAGGG - Intergenic
933943311 2:87263349-87263371 CAGTTTCCTCAGATGTAAAAAGG - Intergenic
934915744 2:98299720-98299742 CAGTGTCCTCATCTGCCAGAAGG - Intronic
935123426 2:100201773-100201795 CAGTCTCTTCAGAGTCAAGCAGG - Intergenic
935865749 2:107385847-107385869 CAGTGTCTTCATAAGCAACATGG - Intergenic
935978892 2:108607148-108607170 CTGTGTCCTCACATGCAGGAAGG - Intronic
936336904 2:111598212-111598234 CAGTTTCCTCAGATGTAAAAAGG + Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
936532125 2:113283704-113283726 CAGTTTCCTCATCTGCAAGATGG - Intergenic
936841196 2:116771690-116771712 TAGAGTCCTCATTGGCAAGAAGG - Intergenic
937450291 2:121996652-121996674 CAGTTTCCTCAAAAGCAAAATGG + Intergenic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
938967761 2:136403812-136403834 CTATGTCCTAAGAGTCAAGAAGG + Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
939588319 2:144032248-144032270 CAGTTTCCTCATAGGCAAAATGG + Intronic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
940020434 2:149151052-149151074 CATTGACCTCAGAGACAATAAGG - Intronic
940418432 2:153449785-153449807 CAGTGTCCTCACATGACAGAAGG + Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
941660104 2:168187472-168187494 CAGTTTCCTCATTGGTAAGACGG + Intronic
941706511 2:168664241-168664263 TAGTCTCCTCAGAGGCAAGCAGG + Intronic
942701048 2:178710872-178710894 CAGCATCCACAGGGGCAAGACGG + Exonic
943650676 2:190454561-190454583 CAGTGTCCTCATATGGTAGAGGG - Intronic
944137441 2:196414662-196414684 CAGGGGCCTCAGAGGCCAGATGG - Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
946730211 2:222702207-222702229 CAGTGTCATAAGAGACAAGAGGG + Intronic
947304897 2:228734637-228734659 AAGTGTCCTCTGAAGCAACATGG - Intergenic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
1168984610 20:2037493-2037515 CAGTGTCCTCAGCTGCAAAATGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169566223 20:6856389-6856411 CAAGGTCCTCAGAGGGAAGGTGG - Intergenic
1170706647 20:18749748-18749770 CAGTGTCCTCTGTGGCAGGGTGG - Intronic
1171324227 20:24276653-24276675 AGGTGTGCTTAGAGGCAAGAGGG + Intergenic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1171815979 20:29786542-29786564 AAGTGGCCTCAGTGGCCAGAAGG - Intergenic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172768335 20:37362899-37362921 CAGTTTCCTCAGCGGCAAAATGG - Intronic
1173454815 20:43193299-43193321 CAGTGTCCTCATGTGTAAGATGG - Intergenic
1173511185 20:43629860-43629882 CAGCGTCCTCAGATGTAAAATGG - Intronic
1174034249 20:47657796-47657818 CAGTTTCTTCAGAGGCAACCAGG + Exonic
1174483568 20:50847562-50847584 CAGTTTCCTCAGCTGTAAGATGG - Intronic
1174604426 20:51750657-51750679 CAGTGTCCTCATCTACAAGAGGG - Intronic
1175030732 20:55951189-55951211 AAGGGTCCTGAGAGGGAAGATGG + Intergenic
1175411691 20:58774364-58774386 CAGAGTCCTGAGGGCCAAGATGG + Intergenic
1176147244 20:63571053-63571075 CCGGGTCCTCAGAGGCCACATGG + Intronic
1176237506 20:64060544-64060566 CAGCCTCATCAGAGGCACGAGGG - Intronic
1176253309 20:64137581-64137603 CTGTGTCCTCCGAGGCCTGAGGG - Intergenic
1178269540 21:31177231-31177253 CAGTGTCCTCACCTGCAAAATGG - Intronic
1178917282 21:36713287-36713309 CCGTTTCCTTAGAGGAAAGAGGG + Intronic
1178990056 21:37345674-37345696 CAGTGTCATGAGAAGCAAAAAGG + Intergenic
1179717935 21:43299598-43299620 CAGTGTCCTCAGAGCCCGGCAGG + Intergenic
1179815131 21:43900736-43900758 CTGTGTGCTCAGTGGCCAGAGGG + Intronic
1179830566 21:43993669-43993691 CAGTGTCCTCGGAGCAAGGAAGG + Intergenic
1179916276 21:44480293-44480315 AAGTACCCTCAGAGGCAAGGTGG - Intergenic
1179952264 21:44715167-44715189 CTGTGTCCTTAGAGGATAGATGG - Intergenic
1180655706 22:17418972-17418994 CAGTGTCCCCTGAGGCGAGGCGG - Intronic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1180892803 22:19302825-19302847 CAGTGTCCTCAATGGTGAGATGG - Intergenic
1181118333 22:20648277-20648299 CTGAGTTCTCAAAGGCAAGATGG + Intergenic
1181142892 22:20820375-20820397 TAGTATCCTCAGAGGCCACATGG - Intronic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181370852 22:22415646-22415668 CTGTGTCCTCACAGGAAAGCTGG + Intergenic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1181477595 22:23178515-23178537 CAGTTTCCTCACATGCAAAATGG + Intergenic
1181759894 22:25051077-25051099 CAGGGGCCTCAGAGGCCAGAAGG - Intronic
1181885643 22:26020133-26020155 CAGTTTCCTCATTTGCAAGATGG + Intronic
1181905484 22:26191841-26191863 AAGTGTCCTGTGAGGCCAGATGG - Intronic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1182908145 22:33956478-33956500 CAGTGCTCTCAGAGGCATTAGGG - Intergenic
1183214303 22:36469163-36469185 CAGTGTTCTCAGATGCAGGATGG + Intronic
1183316661 22:37140907-37140929 CAGTGTCTTCATTGGTAAGAAGG + Intronic
1184420748 22:44381595-44381617 CAGTGTCCTCAGTGGTAAAATGG + Intergenic
1184654968 22:45936493-45936515 CAGAGTCCTCAGAGACATGTGGG + Intronic
1185120369 22:48962660-48962682 CTGTCACCTTAGAGGCAAGAAGG - Intergenic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
949119207 3:365414-365436 CAGTGTCTCCAGAGCCTAGAAGG - Intronic
950168204 3:10817007-10817029 CAGTGTCCTCACCTGCAAAATGG - Intronic
950180631 3:10910759-10910781 CAGTCTCCTCAGCTGTAAGAGGG + Intronic
950194844 3:11001806-11001828 CAGTGTCCTCATCTGCAAAATGG + Intronic
950810303 3:15644621-15644643 CAGAGTCCTCAGAGACTACAAGG + Exonic
951204836 3:19915278-19915300 AAGTGTCCTCCGATGCAAAATGG - Intronic
951234344 3:20217253-20217275 CAGTCACCTCACAGGCAACAAGG + Intergenic
951359941 3:21713358-21713380 CAGTGCCCTCAGCACCAAGATGG - Intronic
951998584 3:28758671-28758693 CAGTGTCCTCATATACAAAATGG + Intergenic
952742574 3:36748606-36748628 CAGTGTCCTCAGAGTCCCCAGGG - Intergenic
952928912 3:38344651-38344673 CAGTCTAGTCACAGGCAAGAAGG + Intergenic
953022632 3:39125445-39125467 CAAAGTACTCAGAGCCAAGAGGG - Exonic
953296271 3:41720743-41720765 CAGTATCCTCAGAGTCTTGATGG - Intronic
953439973 3:42908699-42908721 CAGTGTCTTCAGGGGTAGGAGGG - Intronic
954596180 3:51826938-51826960 GAGAGTCCTCACAGGGAAGAAGG + Exonic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955330203 3:58041069-58041091 CAGTTTCCTCAGCTGCAAAACGG - Intronic
955963018 3:64360361-64360383 CAGAGTCCACAGAGGCCAGCAGG + Intronic
956180809 3:66516830-66516852 CAGTTGCCTCAGAGGAAATAAGG - Intergenic
956525577 3:70155983-70156005 CAGTGTCCTCATCTGCAAAATGG - Intergenic
956929596 3:74028061-74028083 CAGTGCCCTCATAGGTAAAATGG - Intergenic
956964784 3:74446178-74446200 CAGTTTCCTCATATGTAAGATGG + Intronic
957225199 3:77434187-77434209 CAATGTATTCAAAGGCAAGAAGG - Intronic
959263669 3:104112370-104112392 CAGAGTCCTCACTGGCAAGAAGG - Intergenic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
960450162 3:117796993-117797015 CAGTTTTCTCAGCGGCAAAATGG - Intergenic
961246353 3:125457232-125457254 CAGTATCATCAGAGGCCAAAAGG + Intronic
961362654 3:126377795-126377817 CTGTGACCTCAATGGCAAGAAGG + Intergenic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
962986347 3:140539750-140539772 CAGTTTCCTCATTGGCAAAATGG - Intronic
963377819 3:144492468-144492490 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
964202813 3:154137346-154137368 GAGTGTCCCCACCGGCAAGAAGG + Intronic
967225536 3:187287574-187287596 CAGTTTCCTCAGAAGTAAAATGG + Intronic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967787534 3:193513726-193513748 CAATGGCCTCAAGGGCAAGATGG + Intronic
968191093 3:196667894-196667916 CAGTTTCCTCCCTGGCAAGATGG - Intronic
968275812 3:197439560-197439582 CAGTGTCCACTGGAGCAAGAAGG - Intergenic
968335444 3:197909000-197909022 CGGTGTCCTCAGACACAGGAGGG + Intronic
968448963 4:666250-666272 AAGGGTCCCCAGAGCCAAGAGGG + Intronic
968491686 4:893598-893620 CAGTGACGTCAGAAGCAAGAAGG + Intronic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
969082902 4:4633547-4633569 TACTGTCCTCAGATGCCAGATGG + Intergenic
969365900 4:6694167-6694189 CAAGGGGCTCAGAGGCAAGAGGG + Intronic
969435406 4:7186375-7186397 CAGCGTCCTCTGAGGCATCAGGG - Intergenic
969646288 4:8431410-8431432 CAGTGTCCTCAGGCCCAGGAGGG - Intronic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
970647782 4:18142476-18142498 CAGTTTCCTCAGACGTAAAATGG + Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
971335295 4:25717802-25717824 CATTTTCCTCAGCTGCAAGATGG + Intergenic
971493375 4:27237871-27237893 GAGTGTCCTCACCAGCAAGAAGG - Intergenic
974472519 4:62337109-62337131 GAGTGTCCTCACCAGCAAGAAGG + Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
977678352 4:99772067-99772089 TATTATCCTAAGAGGCAAGATGG - Intergenic
979018647 4:115467036-115467058 CAGAGTCCTCATCAGCAAGAAGG + Intergenic
980900055 4:138896430-138896452 CAGTGTCCTCACACGGCAGAAGG + Intergenic
981602527 4:146506641-146506663 GAGTGGCCTGAGAGGTAAGAAGG - Intronic
982839860 4:160170524-160170546 CAGTCTGCTCAGAGGAATGAGGG - Intergenic
983289736 4:165786703-165786725 CAGAGACCACAGAGACAAGAAGG - Intergenic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
985241172 4:187932297-187932319 CAGGATCCTCAGAGGGAACATGG + Intergenic
985396470 4:189549864-189549886 CAATTTCCTCAGTGGCAAAATGG - Intergenic
986646557 5:9921775-9921797 CAGTGGCCTCTGAGGCTAAATGG - Intergenic
986763829 5:10904756-10904778 CAGTTTCCTCATAGGAAAAATGG + Intergenic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
987742901 5:21933367-21933389 CAGTGTTCTAAGAGGGAACAGGG + Intronic
988131875 5:27116921-27116943 AAGTGTCCTGATAAGCAAGAAGG - Intronic
988673410 5:33406528-33406550 CAGTGTGCTCAGAGGCAGTCAGG + Intergenic
988802553 5:34710205-34710227 CAGAGACTTCAGAGGCAGGATGG - Intronic
989178301 5:38551620-38551642 CAGTATCCTTAGAGGCCACAAGG - Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990633028 5:57691600-57691622 CACCATCCTCACAGGCAAGATGG - Intergenic
991525896 5:67557409-67557431 CAGTTTTCTCAGTGGCAATAGGG + Intergenic
992217738 5:74542541-74542563 CATTCTCCTCAGAGACTAGAAGG + Intergenic
993133208 5:83925135-83925157 CAGTTTCCTCATATGCAACATGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994344181 5:98664963-98664985 CAGATTCCTCAGAGTCAAGAAGG - Intergenic
995381355 5:111537823-111537845 CAGTGTCCTCATCTGTAAGAAGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997646784 5:135487301-135487323 CAGTGCCCTGAGAGGCAAATGGG + Intergenic
998133921 5:139664866-139664888 CAGTGTCCTCATCTGCAAAATGG + Intronic
998569299 5:143243185-143243207 CAGTGTCCTCTGGGGCTGGAAGG - Intergenic
999496587 5:152104944-152104966 CAGTTTCCTCATTGGCAAAAGGG - Intergenic
999799016 5:155015950-155015972 CAGTGTGCTCAGACGTAAAACGG + Exonic
1001454088 5:171847612-171847634 CAGGGTCCTCATCTGCAAGATGG - Intergenic
1001891124 5:175339674-175339696 CTGTGACCTCAAAGCCAAGATGG + Intergenic
1002053135 5:176583212-176583234 CAGTGTCCTCATCTGCAAAATGG - Intronic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1003529217 6:6924119-6924141 TAGTGTCCTCATAGGTAAAATGG + Intergenic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692074 6:8364814-8364836 CTGTGTCCTCATACGGAAGAAGG - Intergenic
1003778777 6:9399031-9399053 CAGCGTCCTCGGAGGGAAGGAGG - Intergenic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1004602016 6:17159289-17159311 CTGTGTCCTCAGAGCCAAGGAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1004943258 6:20584302-20584324 CAGTGTGCTTAAAGGCAAGGGGG + Intronic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006420468 6:33930827-33930849 CAGTCTCCTCAGATGTAAAATGG + Intergenic
1006424443 6:33955552-33955574 CAGTTTCCTCATCTGCAAGATGG + Intergenic
1006465287 6:34190268-34190290 CTGTCTCATCAGCGGCAAGATGG - Intergenic
1006674403 6:35751875-35751897 CAGTGTATTCAGCAGCAAGAAGG - Intergenic
1006987131 6:38183389-38183411 AAGTGTCCTGAGAGGCAGGGAGG + Intronic
1007181962 6:39935159-39935181 CAATGTCCTCAGTTGCAAAAAGG - Intergenic
1007396323 6:41579931-41579953 CAGTTTCCTCATCTGCAAGATGG - Intronic
1007526872 6:42503708-42503730 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009538892 6:64925789-64925811 CTCTGTCCTCAGAGGCAAAGTGG - Intronic
1010751568 6:79621401-79621423 CTGTGTCCTCACAGGGTAGAAGG - Intergenic
1010833335 6:80556961-80556983 TGGTGGCCTGAGAGGCAAGAAGG - Intergenic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1011801069 6:91016938-91016960 CAGTGGCCTCAGAGTCAATCTGG - Intergenic
1011873809 6:91930741-91930763 CACTGCCCTCAGAGACCAGAAGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013069516 6:106715984-106716006 CAGTCTCCTCATATGCAAGAAGG - Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013483270 6:110570256-110570278 CAGAGTCCTCAGTGACAAGCAGG - Intergenic
1013991331 6:116257689-116257711 CTGTGTCCTCACATGCAAAAAGG + Intronic
1014019189 6:116568039-116568061 CAGAGTCCCCACATGCAAGAAGG + Intergenic
1014376872 6:120687034-120687056 CAGTGTCCTTTGTGGCAACATGG + Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1015371326 6:132456898-132456920 CAGTGGCCTCTGAGGAAAGATGG - Exonic
1015825739 6:137309576-137309598 GAGTGTGCTCAGAGTCAGGAGGG + Intergenic
1015842008 6:137487293-137487315 CTGTGCCCTCAGAGCCTAGAGGG - Intergenic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016603703 6:145892859-145892881 CATTCTCCTCAAAGGCATGATGG + Intronic
1016863633 6:148746387-148746409 CAGTGCCCAGAGAGGCAAGTGGG - Intergenic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017719034 6:157232307-157232329 CAGTGGCCTGAGTGGAAAGACGG + Intergenic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1020031777 7:4938378-4938400 CAGCATCCTCAGCAGCAAGAAGG - Intronic
1021485216 7:21160464-21160486 CAGTCTCCTCTGAGGCACAACGG - Intergenic
1021640257 7:22729498-22729520 AAGTCTCCTAAGAGGAAAGATGG - Exonic
1023639722 7:42245369-42245391 CAGTTTCCTCACAGGTAAAATGG + Intergenic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023827402 7:44018867-44018889 CAGTGTCCTCATCTGCAAAATGG + Intergenic
1023932445 7:44714057-44714079 CAGTCTCGTCCCAGGCAAGAAGG - Intergenic
1024239034 7:47419801-47419823 AAGTGGACTCAGAGGCAAAAGGG + Intronic
1024829732 7:53436540-53436562 CTATGGCCTCAGAGTCAAGAAGG - Intergenic
1025215434 7:57052048-57052070 CAGTGTTCTCACATGCAAAATGG - Intergenic
1025655941 7:63518654-63518676 CAGTGTTCTCACATGCAAAATGG + Intergenic
1027262968 7:76478172-76478194 CAGTTTCCTCATTGGCAAAATGG - Intronic
1027314352 7:76976273-76976295 CAGTTTCCTCATTGGCAAAATGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029738558 7:102478614-102478636 CAGTGTCCTCATCTGCAACATGG + Intronic
1029773637 7:102671358-102671380 CAGTGTCCTCATCTGCAACATGG + Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1033561541 7:142536698-142536720 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1033589112 7:142796038-142796060 CAGTTTCCTCATTGGAAAGATGG - Intergenic
1035362712 7:158324158-158324180 CAGTCTCCGCATAGACAAGACGG + Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036695456 8:10971700-10971722 TAGTGTCCCCATTGGCAAGAGGG - Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1037287527 8:17317400-17317422 CAGTGTCCTAAGAGGACAGCTGG + Intronic
1037763666 8:21758457-21758479 CAGTTTCCTGGGAGGCAGGAAGG - Intronic
1038085790 8:24194852-24194874 CAGTCTCCTCAGAAATAAGAAGG - Intergenic
1038187771 8:25291259-25291281 CAGTTTCCACAGTTGCAAGAGGG + Intronic
1038455732 8:27671013-27671035 CAGGGTCCTCAGGGGCAACCTGG + Exonic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1039953528 8:42190538-42190560 CAGTGACCTCAGAAGCAGCAAGG - Intronic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1041145026 8:54866262-54866284 CAATGTCCTCATATGGAAGATGG + Intergenic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042260186 8:66850577-66850599 CAGTTTCCTCAGTGGTAAAATGG - Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1044290609 8:90464672-90464694 CAGTGTCCTCATATGTAAAATGG - Intergenic
1045031219 8:98138288-98138310 ATGAGGCCTCAGAGGCAAGAAGG - Intronic
1048009909 8:130447180-130447202 CAGTTTCCTCAACTGCAAGATGG - Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048922213 8:139241590-139241612 CATTTTCCTCCGTGGCAAGATGG + Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052347610 9:27426129-27426151 CTGTGTCCTCATAGGTAAAATGG - Intronic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053287708 9:36860655-36860677 TAGCGTCCTCAGAGGCATGCTGG + Intronic
1053340515 9:37323061-37323083 CAGTTTCCTCATAGGTAAAACGG - Intronic
1054711632 9:68516614-68516636 CAGGGACCTCAGTGGCCAGATGG - Intronic
1055020629 9:71665609-71665631 CAGAGTCCTCACCAGCAAGAAGG + Intergenic
1055404757 9:75962869-75962891 CAGTGTCTTATGAAGCAAGAGGG - Intronic
1055802716 9:80057929-80057951 CAGTGTCCTCACTAGGAAGAAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057164700 9:92916468-92916490 ACCTGTCCTCAGGGGCAAGACGG + Intergenic
1057233765 9:93342508-93342530 CAGTGTCCAGAGAGGCAGGGTGG + Intronic
1057252080 9:93511515-93511537 CAGTGTCCAGAGAGGCAGGGTGG - Intronic
1057624793 9:96667584-96667606 TACTCTCCTCAGAGGCCAGAGGG - Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1057906085 9:98984507-98984529 CAGTTTTCTCAGAAGTAAGATGG + Intronic
1058541263 9:106014874-106014896 CAGTGTCCTCACATGGTAGAAGG + Intergenic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1059535225 9:115074375-115074397 CTGTGTCCTCACAGGACAGAAGG - Intronic
1059678030 9:116558801-116558823 CAGTTTCCTCAGATGTAAAAAGG + Intronic
1059756315 9:117296939-117296961 CAGTGGCCACCGAGGCAGGATGG - Intronic
1060315389 9:122505273-122505295 CAGAGTCCTCACCAGCAAGAAGG - Intergenic
1060976785 9:127769841-127769863 CAGTCTCCTCACTGGCAAAATGG + Intronic
1061060366 9:128247203-128247225 CAGTTTCCTCACTGGGAAGATGG - Intronic
1061160955 9:128893453-128893475 CTGTGTCCTCAACTGCAAGATGG - Intronic
1061324839 9:129857537-129857559 CAGTGTCATCAGGGGCATGTGGG + Intronic
1061418911 9:130462758-130462780 CAGTGTCCTCATCCGTAAGATGG + Intronic
1061667083 9:132166867-132166889 CATAGTCCCCAGAGGCCAGAGGG - Exonic
1203367666 Un_KI270442v1:272856-272878 AAGTGGCCTCAGTGGCCAGATGG - Intergenic
1185794058 X:2949721-2949743 CATTTTCCTGAGAGGCAAAAAGG + Exonic
1186387825 X:9127772-9127794 CAGAGTCCTCACCAGCAAGAAGG + Intronic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1188616178 X:32161884-32161906 CAGTGTCCTCATCTGCAAAATGG - Intronic
1189120560 X:38389810-38389832 CAGTTTCCTCAGTTGCAAAATGG + Intronic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195064509 X:101228459-101228481 CAGTGTCCTCATCTGCAAAATGG - Intronic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196718144 X:118828973-118828995 CAGTCTCTCCAGAGCCAAGAGGG + Intergenic
1197873853 X:131084046-131084068 CTGTGCCCTCAGAGGCAGGGGGG + Intronic
1199696525 X:150346445-150346467 CAGTTTCCTCAAAAGCAAAATGG + Intergenic
1199808904 X:151329552-151329574 CAGTGTTCTGGGAGCCAAGAGGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201071027 Y:10147419-10147441 AAGTGGCCTCAGTGGCCAGATGG + Intergenic