ID: 1157162214

View in Genome Browser
Species Human (GRCh38)
Location 18:45324507-45324529
Sequence CCTATCCTGCAGAAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157162214_1157162221 14 Left 1157162214 18:45324507-45324529 CCTCCTAGCTTCTGCAGGATAGG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1157162221 18:45324544-45324566 CTCCCCCTCACCCCACCCCCTGG 0: 1
1: 2
2: 31
3: 303
4: 1796
1157162214_1157162222 15 Left 1157162214 18:45324507-45324529 CCTCCTAGCTTCTGCAGGATAGG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1157162222 18:45324545-45324567 TCCCCCTCACCCCACCCCCTGGG 0: 1
1: 1
2: 9
3: 106
4: 825
1157162214_1157162224 16 Left 1157162214 18:45324507-45324529 CCTCCTAGCTTCTGCAGGATAGG 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1157162224 18:45324546-45324568 CCCCCTCACCCCACCCCCTGGGG 0: 1
1: 1
2: 6
3: 106
4: 868

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157162214 Original CRISPR CCTATCCTGCAGAAGCTAGG AGG (reversed) Intronic
901536984 1:9888965-9888987 CCTTTCCTGCAGTAGGTAGGCGG - Intronic
902112677 1:14095864-14095886 CCCATCCTTCTGAATCTAGGTGG - Intergenic
905169161 1:36099313-36099335 CCCATCCGGGAGAAGCCAGGGGG + Exonic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905726643 1:40258051-40258073 CTTTTCCTGTAGAAACTAGGAGG + Intergenic
907039922 1:51249928-51249950 CGTTTACTGCAGAATCTAGGTGG - Intronic
908731160 1:67227855-67227877 CCTATTCTGCAGAAACTTGGTGG - Intronic
912257138 1:108071676-108071698 CCAATCTTGCAGAAGCCAGGAGG + Intergenic
916615778 1:166437911-166437933 CATACCTTGCAGAAGCAAGGAGG + Intergenic
916750753 1:167721352-167721374 CCCATCCTTCTGAAGCCAGGAGG + Intronic
919370318 1:196716368-196716390 TCTATCCTGCTGAGGCTAGATGG + Intronic
920019624 1:202945309-202945331 CCTTTCTTGCAGAAGTAAGGTGG - Intronic
921312032 1:213854112-213854134 CCTATCCTGCAGAGACTAACAGG - Intergenic
922130116 1:222769246-222769268 CCTGTGCTGCAGGAGCAAGGTGG + Intergenic
923081184 1:230657101-230657123 CCTATCCTTATGATGCTAGGTGG + Intronic
1065935286 10:30515565-30515587 TTTAACCTGCAGAAGCGAGGTGG + Intergenic
1068938340 10:62657546-62657568 CCTAGCCTGCAGGGGCAAGGGGG - Intronic
1069956238 10:72053726-72053748 CCTATCCTGCAGCAGTTAGAGGG - Intergenic
1069986449 10:72287432-72287454 CCCATCCTGTAGAAGGGAGGTGG - Intergenic
1074491290 10:113941763-113941785 CCTGGCCTGCAGAAGCCAGGGGG + Intergenic
1074960603 10:118441984-118442006 CCTACCCTCCAGAGGCTCGGGGG + Intergenic
1075143235 10:119860190-119860212 CATATGCTGCTGAATCTAGGTGG - Intronic
1075625201 10:123959130-123959152 GCTATCCTGCAGAAGACTGGAGG - Intergenic
1076617450 10:131765342-131765364 CCTATGCTGCAGTGGGTAGGAGG - Intergenic
1078520452 11:12058704-12058726 CCCTTCCTGCTGAAGCCAGGTGG - Intergenic
1081871419 11:46384292-46384314 TCCACCCTGCAGAAGCCAGGGGG + Intergenic
1082774311 11:57234176-57234198 CCAATCCAGCAGAAGCCAAGAGG + Exonic
1083346501 11:61997064-61997086 ACTATCCTGGAGAAGCTGGGAGG - Intergenic
1087624575 11:100582081-100582103 ACCATCGTGGAGAAGCTAGGTGG - Intergenic
1089127237 11:116185177-116185199 CCTATCAGGCAGAAGCAAGCTGG - Intergenic
1089671198 11:120058122-120058144 CTTCTCCCGCAGAAGCTAGAGGG + Intergenic
1090878710 11:130814638-130814660 TCTATCCTGCAGAATCAGGGTGG + Intergenic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1096185957 12:49580700-49580722 CCTTTCCTGCAGAAGCCACAAGG - Intronic
1098014315 12:66088342-66088364 TCTGCCCTGCAGAAGCCAGGAGG + Intergenic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1102885224 12:116516806-116516828 CCTCTCCTGCAGATGCCAGGCGG + Intergenic
1105624177 13:22097097-22097119 ACTAACCTACAGAAACTAGGAGG + Intergenic
1109308908 13:60669809-60669831 CCTATCGTGCAGTTGCTAGGTGG + Intergenic
1120489906 14:85164415-85164437 CCTTTCTTGCAGGAGTTAGGTGG - Intergenic
1122372414 14:101235918-101235940 TCAATCCTGCAGAAGCTTTGAGG - Intergenic
1124621600 15:31277137-31277159 CTTAACCTTCAGAAGCGAGGTGG - Intergenic
1127693591 15:61421867-61421889 CATATCCTACAGAAGCCAGTGGG + Intergenic
1133629422 16:7605484-7605506 TCCAACCTGAAGAAGCTAGGTGG - Intronic
1135160954 16:20095934-20095956 GCTCTCCTGCAAAGGCTAGGGGG + Intergenic
1141354037 16:83326622-83326644 CCTTTGCTGCACAATCTAGGTGG + Intronic
1141571725 16:84938199-84938221 CCTGTCCTCCTGAATCTAGGAGG + Intergenic
1143787093 17:9264000-9264022 ACTATCCTGAAGGAGCAAGGTGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1154064826 18:11096921-11096943 CCTATCCTGGAGAAGGAAGCTGG + Intronic
1156282873 18:35658150-35658172 CCTTTCCTCCAGAGGCAAGGAGG - Intronic
1156314221 18:35952173-35952195 CCTATCCTGGATAATCTAGGTGG - Intergenic
1156538744 18:37888979-37889001 CATCTCCTGGAGAAGCAAGGGGG + Intergenic
1157162214 18:45324507-45324529 CCTATCCTGCAGAAGCTAGGAGG - Intronic
1159825535 18:73204621-73204643 CCTATGCTGCAGAAGTTTTGAGG - Intronic
1162273705 19:9636726-9636748 CCTATCCTCAAGAAGCTACAGGG - Intronic
1163321188 19:16575978-16576000 CCCATCTTGCAGAAGCCGGGTGG - Exonic
1166918500 19:46212453-46212475 GAAATCCTGCAGAAGCTGGGAGG + Intergenic
1167264813 19:48478258-48478280 CTTGTCCTGAAGAAGCAAGGTGG - Exonic
927899353 2:26808135-26808157 TCCATCCTGCAGAAGGTAAGGGG + Intergenic
928369044 2:30726084-30726106 CCTACCCTGGAGAAACTAGTTGG - Intronic
931876309 2:66517142-66517164 CCTATCCTGAAAGATCTAGGGGG + Intronic
932119158 2:69082343-69082365 CATATTCTGCAGAAGCGAGTGGG - Intronic
933984705 2:87580962-87580984 ACTGTCCTGCAGAGGCTAGCAGG - Intergenic
935956163 2:108378492-108378514 CCTATCCTAAAGCAGGTAGGTGG + Exonic
936309146 2:111369838-111369860 ACTCTCCTGCAGAGGCTAGCAGG + Intergenic
936532034 2:113283188-113283210 CCAATCCTGCCGAAGCCACGTGG + Intergenic
937650123 2:124310429-124310451 CCTTTCCTTCAGAAGGGAGGTGG - Intronic
940003443 2:148989674-148989696 CCATTCTTGCAGAAGCAAGGTGG + Intronic
940907109 2:159179474-159179496 ATGATCCTGCAGAAGCTGGGTGG - Intronic
942140434 2:172972141-172972163 GCTGTCCTGCAGAGGCTGGGTGG + Intronic
947328671 2:229005069-229005091 GCAAACCAGCAGAAGCTAGGAGG + Intronic
1169327766 20:4689240-4689262 CATATCCTGCAGAACCTCTGTGG + Intronic
1172240068 20:33407257-33407279 CCTTTCCTGCAGAAGGGAGGTGG - Intergenic
1174206931 20:48846990-48847012 CCTACCCTCCAGGGGCTAGGAGG + Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178781512 21:35607403-35607425 CCTCTGCTGCAGAACCTAAGAGG - Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1183046185 22:35222318-35222340 CCTATGCTGCAAGAGCTATGGGG - Intergenic
1184551347 22:45205785-45205807 CTCATCCTGCAGAAGGTATGGGG - Exonic
1203273652 22_KI270734v1_random:73737-73759 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
953134010 3:40167225-40167247 ACAATCCTGCAGAAGGTAGGTGG + Exonic
960993849 3:123328556-123328578 ACCATCCTGCAGAGGCGAGGCGG - Intronic
961260025 3:125595039-125595061 CCTTTCCGGCAAAAGCAAGGAGG + Exonic
962256428 3:133872981-133873003 CTTCTCCTGCACCAGCTAGGAGG + Intronic
965601476 3:170458748-170458770 GCTATTCTGCAGGAGCTAAGGGG + Intronic
966037657 3:175439530-175439552 CCATTCTTGCAGAAGCCAGGTGG + Intronic
970693930 4:18653654-18653676 CATTTCCTACAGAAGCTTGGAGG - Intergenic
978346819 4:107779302-107779324 CCTATCCTGCAAATGCTATTTGG - Intergenic
981168921 4:141598450-141598472 CCATTCCTGCAGAAGTGAGGTGG - Intergenic
981461841 4:145021970-145021992 CCATTCCTGCAGAAGTAAGGTGG - Intronic
984642106 4:182178064-182178086 CCAATCCTGCAGGGGCTAGGGGG - Intronic
987708175 5:21481590-21481612 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
987708354 5:21482406-21482428 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
987708527 5:21483213-21483235 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
988751083 5:34190932-34190954 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
988751603 5:34193365-34193387 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991107774 5:62862692-62862714 CCAAGCCTGCAGAAGGCAGGGGG + Intergenic
991736224 5:69632856-69632878 CCTCTGCTGCAGATGCTAGGGGG - Intergenic
991736395 5:69633663-69633685 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991736570 5:69634476-69634498 CCTCTTCAGCAGATGCTAGGGGG - Intergenic
991736920 5:69636111-69636133 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991739355 5:69654144-69654166 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991758145 5:69899035-69899057 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991758319 5:69899851-69899873 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991758495 5:69900667-69900689 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991758665 5:69901480-69901502 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991758842 5:69902287-69902309 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991788493 5:70215835-70215857 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991790930 5:70233885-70233907 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991812721 5:70488495-70488517 CCTCTGCTGCAGATGCTAGGGGG - Intergenic
991812893 5:70489302-70489324 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991813071 5:70490121-70490143 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991813245 5:70490940-70490962 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991815679 5:70508972-70508994 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991815852 5:70509779-70509801 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991816024 5:70510592-70510614 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991816199 5:70511402-70511424 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991816377 5:70512221-70512243 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991818817 5:70530261-70530283 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991837548 5:70774917-70774939 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991837724 5:70775733-70775755 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991837894 5:70776546-70776568 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991838071 5:70777353-70777375 CCTCTGCAGCAGATGCTAGGGGG + Intergenic
991880941 5:71216199-71216221 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
991883378 5:71234220-71234242 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
992434212 5:76739842-76739864 CCCATCCTCCAGAAGCTAACTGG + Intergenic
994420254 5:99522601-99522623 CCTGTGCAGCAGATGCTAGGGGG + Intergenic
994420424 5:99523420-99523442 CCTGTGCAGCAGATGCTAGGGGG + Intergenic
994420590 5:99524239-99524261 CCTGTGCAGCAGATGCTAGGGGG + Intergenic
994486450 5:100390075-100390097 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
994486619 5:100390894-100390916 CCTGTGCAGCAGATGCTAGGGGG - Intergenic
994486786 5:100391713-100391735 CCTGTGCAGCAGATGCTAGGGGG - Intergenic
994486951 5:100392532-100392554 CCTGTGCAGCAGATGCTAGGGGG - Intergenic
995054448 5:107743893-107743915 CAAATCCTGCAGAAGTTAGCTGG + Intergenic
995852565 5:116561160-116561182 CCTATCCTGCCTAACCTAGAGGG + Intronic
998251895 5:140558872-140558894 CCTGTCCTGCAGAAGCTTTCAGG - Intronic
999608823 5:153347301-153347323 CCTCTCCTGGATAAGCTAGGTGG + Intergenic
1001570549 5:172727748-172727770 CCTTTGCTGCAGAGGCTCGGGGG - Intergenic
1001873920 5:175182818-175182840 CTTATCCTTCAGTATCTAGGCGG + Intergenic
1005549585 6:26899198-26899220 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
1005549759 6:26900015-26900037 CCTCTGCAGCAGATGCTAGGGGG - Intergenic
1014112195 6:117631045-117631067 CCTTTCCTGGAGAAGCTAGCAGG + Intergenic
1015377797 6:132530410-132530432 CCTTCCCTGCAGAACCCAGGAGG - Intergenic
1021921942 7:25494518-25494540 TCTATTCAGCAGAAGCTTGGAGG + Intergenic
1027619957 7:80472040-80472062 CCTAGCCTCCAGGAGCTCGGGGG + Intronic
1028502303 7:91532927-91532949 CCATTCTTGCAGAAGCAAGGTGG - Intergenic
1030035142 7:105402501-105402523 CCTATCCATCAGAATCTAGGGGG - Intergenic
1030527438 7:110671631-110671653 CCTTTCCTTCAGATGCCAGGGGG + Intronic
1032537498 7:132677218-132677240 TCTTTCCTGCAGAAGGCAGGAGG + Intronic
1035170477 7:157014735-157014757 CCTGTCCTGCTGAAGCCATGTGG + Intergenic
1035396977 7:158540962-158540984 CCTATCCTGCAGGTGGTAGTAGG - Intronic
1036607062 8:10316886-10316908 ACTTTCCAGCAGAAGGTAGGAGG + Intronic
1036984714 8:13515700-13515722 CCCAACCTGGAGCAGCTAGGAGG - Intergenic
1037567653 8:20130905-20130927 CCCATCCTCCAGAGGCTGGGAGG - Intergenic
1037844150 8:22267876-22267898 CCTATCCTACAGGAGCAAGGAGG - Intergenic
1039345805 8:36704077-36704099 CCAATCCTGAGGAAGCTAAGTGG + Intergenic
1039976916 8:42374691-42374713 CCTATCCTTAAGAGGCTGGGAGG + Intronic
1040060909 8:43102159-43102181 CCTATCCTGCTGGAGCTTAGGGG - Intronic
1042103248 8:65297054-65297076 CCTCACCTCCAGAAGCTATGTGG - Intergenic
1044451627 8:92342503-92342525 CCAATCCTGCAGAATCAAGCTGG + Intergenic
1047191634 8:122683624-122683646 CCAATCCTGGAGAAGCCAAGGGG + Intergenic
1047334128 8:123919916-123919938 CCTTTCCTGGAGAGGCAAGGAGG + Intronic
1054868556 9:70027616-70027638 CCTACACTGCAGAAACTAAGAGG - Intergenic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1061950962 9:133935608-133935630 CCTGTCCCGGAGAAGCCAGGAGG + Intronic
1062147590 9:134998495-134998517 GCCATGCTGCTGAAGCTAGGTGG - Intergenic
1188691999 X:33140773-33140795 GCTATCCTGCAGATGCTAATGGG + Intronic
1192230315 X:69260132-69260154 GGTTTCCTGCAGAAGCTATGGGG - Intergenic
1192329969 X:70167414-70167436 GCTAGACTGCAGAAGCTGGGAGG - Intergenic
1194125973 X:90017268-90017290 CCTTTCCTGCAGGAGTAAGGTGG - Intergenic