ID: 1157166392

View in Genome Browser
Species Human (GRCh38)
Location 18:45361888-45361910
Sequence TGGTGCTCCCGGGGAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157166392_1157166401 29 Left 1157166392 18:45361888-45361910 CCATCTTTTCCCCGGGAGCACCA 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1157166401 18:45361940-45361962 ACTATGAATCACTGGTGATATGG 0: 1
1: 0
2: 0
3: 10
4: 116
1157166392_1157166400 21 Left 1157166392 18:45361888-45361910 CCATCTTTTCCCCGGGAGCACCA 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1157166400 18:45361932-45361954 CGCTTTAGACTATGAATCACTGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157166392 Original CRISPR TGGTGCTCCCGGGGAAAAGA TGG (reversed) Intronic
900097386 1:945483-945505 TGGTGCTCCCAGGGGAAGGGTGG - Intronic
901258254 1:7850633-7850655 AGGAGCTGCTGGGGAAAAGAAGG + Intronic
901507116 1:9691793-9691815 TGCTGCTGCCTGGGAAAAGAAGG + Intronic
902690405 1:18107418-18107440 TGGTAATCCCGGGGATAGGAGGG + Intergenic
904005885 1:27363014-27363036 TGTTCCTCCTAGGGAAAAGATGG + Exonic
905264030 1:36738969-36738991 TGGTGAGCCCGGGAAACAGAAGG + Intergenic
906311241 1:44756029-44756051 GGGTGCTCCCTGGAAACAGAAGG - Intronic
910508477 1:87977318-87977340 TGGTGCTGCCAGGGGAAAGGAGG - Intergenic
914373390 1:147050794-147050816 GCGGGCTCCCGGGGAAGAGACGG + Intergenic
915367956 1:155325846-155325868 TGGTGCTAGGGGAGAAAAGAGGG - Exonic
917475051 1:175362192-175362214 TTGTGCTCCAGGGAGAAAGAAGG - Intronic
919615903 1:199808381-199808403 GGGTGCCTCCAGGGAAAAGAGGG - Intergenic
920550882 1:206859751-206859773 TAGTGCTCCAGTGGAACAGATGG - Intergenic
922894261 1:229088337-229088359 TGGTTCTGCCAGGGAAAGGAGGG - Intergenic
1063577660 10:7276168-7276190 AGGTGCTCCCGTGAAAATGAAGG - Intronic
1064718783 10:18206530-18206552 TGGTCCCATCGGGGAAAAGAAGG - Intronic
1066188232 10:33031311-33031333 GTCTGCTCCCGGGGAACAGAGGG + Intergenic
1068534245 10:58222984-58223006 TGGGGATTCCGGGGAAAAGGCGG + Intronic
1068655783 10:59575248-59575270 TGGTACTCATGGAGAAAAGAGGG + Intergenic
1069838562 10:71325072-71325094 TGATGCTCCCCTGGAGAAGAAGG - Intronic
1073118719 10:101108337-101108359 TGGGGCTCCCAGGGAGAAGAGGG - Intronic
1076690201 10:132219827-132219849 TGTTGCTCCTGGGCAGAAGACGG - Intronic
1077445774 11:2590002-2590024 TGGAGCTCCCAGGGAGAAGTGGG - Intronic
1077650141 11:3963948-3963970 TGCTGCTCTGGGGGTAAAGAAGG + Intronic
1083784015 11:64933683-64933705 TGCTGCTCCCTGGGGAGAGAGGG - Exonic
1084459614 11:69289203-69289225 TGCTGCTCCTGGGGCAGAGAGGG - Intergenic
1084506149 11:69569751-69569773 TGGGGCTCCCAGGAAAAGGAAGG + Intergenic
1084718005 11:70885703-70885725 TGGTGCTCCCGGGGCAATTGTGG - Intronic
1085386864 11:76162614-76162636 TGGTGCTCCCTGGAGAAGGAGGG - Intergenic
1087736395 11:101839212-101839234 TGGGGCTGCCTGGGAAGAGATGG + Intronic
1089971861 11:122700138-122700160 TGCTGCTCCCGGGGGAATGATGG - Intronic
1090946941 11:131439088-131439110 TGGTGATACCCAGGAAAAGAGGG - Intronic
1092270305 12:7018421-7018443 TGGGGCTCCCGGAGTTAAGATGG - Exonic
1094030898 12:26010331-26010353 TGGTCCCCCAGGGGACAAGAAGG - Intronic
1095808930 12:46351012-46351034 TGGTGTTCCTAGGGGAAAGATGG - Intergenic
1099059696 12:77891896-77891918 TGTTGGTCCTGGGGCAAAGAAGG - Intronic
1101916012 12:108896663-108896685 TGGGGCTCCTGGGGCCAAGAGGG + Intronic
1102644556 12:114395752-114395774 GGGTGTTCCCAGGGACAAGAGGG + Intronic
1104725923 12:131075696-131075718 TGCTGCTTCCTGGGAAAGGAGGG + Intronic
1105858217 13:24389560-24389582 TGGTGCTGCAGGGGAGAGGAGGG + Intergenic
1106359684 13:29019177-29019199 TGATGCTCTCGTGGACAAGATGG + Intronic
1112154064 13:96798190-96798212 TGGTGCACCTGGGGAAGGGATGG - Intronic
1113376324 13:109767662-109767684 TGATGCTCTCTGGGAAGAGAAGG - Intronic
1116660907 14:47709253-47709275 TGGTCTCCCAGGGGAAAAGAAGG + Intergenic
1120565242 14:86047636-86047658 TGGTGATACCTGGGCAAAGAGGG - Intergenic
1120917550 14:89723021-89723043 AAGTGCTCCAGGGGAAATGAGGG - Intergenic
1121111374 14:91315398-91315420 TCGTGACCCCGGGGAAGAGAGGG - Intronic
1124791844 15:32734989-32735011 GGGTGTTCCAGGGGAAAAGCAGG + Exonic
1127244260 15:57154328-57154350 TGAAGCTCACGGGGGAAAGAAGG - Intronic
1127405714 15:58643476-58643498 TGGTGTTCCAGGGGAGAAAAAGG - Intronic
1129716134 15:77852137-77852159 TGGAACTCCCGGGGAGTAGAGGG + Intergenic
1130625269 15:85507845-85507867 TGGTGCTCCCTGGGCACAGGTGG + Intronic
1133054443 16:3138508-3138530 TGCTGCTCCTGGGGAACAGACGG - Exonic
1133058925 16:3161690-3161712 TGGTGCGCCCGGGGGAAATGTGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134270802 16:12731436-12731458 TGGGTCCCCCGGGGAAAACAAGG + Intronic
1135856611 16:26017359-26017381 TGGAGCTCTAGGGGAAAAGTTGG + Intronic
1136134414 16:28246175-28246197 TGTTGCTACCTGGGAAAGGAGGG + Intergenic
1136592614 16:31226606-31226628 TGCTGCTCATGGGGAAGAGAAGG + Intergenic
1137787495 16:51150900-51150922 GGGTCCTCCCGGGGGAAGGAGGG - Intronic
1137867477 16:51915621-51915643 TGGTGCTCCAGAGGAAGTGATGG - Intergenic
1141720680 16:85753614-85753636 TGGTGCTCCCAGGGCACAGGTGG - Intergenic
1144813690 17:18018578-18018600 TGGTGCTCTCGGAGCAGAGATGG + Exonic
1145035573 17:19538218-19538240 TCCTGCTTCTGGGGAAAAGAAGG - Intronic
1145867917 17:28252733-28252755 TGGAGTTCCCGGTTAAAAGAGGG - Intergenic
1147377742 17:40032961-40032983 TGGTTCTCCCTGGGAGAAGTGGG - Intronic
1148485949 17:47991168-47991190 GGGGGCTACCGGGGCAAAGAAGG - Intergenic
1149789914 17:59467870-59467892 TGGTGCTAGCGGGGAAAGGGAGG - Intergenic
1150809039 17:68342196-68342218 TTTTGCTCCCAGGGAAAATATGG + Intronic
1156765841 18:40654001-40654023 TGTTTCTCCCAGGGAGAAGAAGG + Intergenic
1157166392 18:45361888-45361910 TGGTGCTCCCGGGGAAAAGATGG - Intronic
1159233284 18:65636705-65636727 TGATGCTGCCGGGAAATAGAAGG + Intergenic
1161109757 19:2462544-2462566 TCTAGCTCCCGGGGGAAAGAGGG - Intergenic
1161140000 19:2641565-2641587 TGGGGCTCCAGGGGAAAATCTGG - Intronic
1161777749 19:6273028-6273050 TGGAGTTCCCTGGGAAAAGAGGG + Intronic
1164466036 19:28488452-28488474 TGGTTTTCACTGGGAAAAGATGG + Intergenic
1164799915 19:31067883-31067905 TGGTGCTCCCGGAACACAGATGG + Intergenic
1165477553 19:36039950-36039972 AGGTGGTCCCCGGGAGAAGATGG + Exonic
1165803738 19:38567944-38567966 TGGGGCTCCCGGGGAGAAGAAGG - Intronic
1166117789 19:40666668-40666690 TGGTGCCCCTCGGGAAACGAGGG - Exonic
1166163623 19:40970778-40970800 TGGTGATCCCCAGGCAAAGAGGG - Intergenic
1167661427 19:50798127-50798149 TGGTGCTCCAGGGGTGAAGCAGG - Exonic
1167816010 19:51881807-51881829 TGCTGCTTCTGGGGCAAAGATGG - Intronic
925732207 2:6927418-6927440 TGGTCCTCCCGAGGAAAGGCTGG - Intronic
932425831 2:71634477-71634499 TGGACTTCCCGGGGAAGAGAAGG + Intronic
940270117 2:151881395-151881417 TGGTCCTGCCGGGGAAAAGAAGG + Intronic
944351983 2:198739318-198739340 TGGTGCACCAAGGTAAAAGAGGG + Intergenic
948763246 2:240205442-240205464 TGTTGCTCACAGGGAAGAGAAGG - Intergenic
948763284 2:240205636-240205658 TGGTGCGCCCTGGGCACAGAGGG + Intergenic
1171277616 20:23871448-23871470 GTGAGCTCCTGGGGAAAAGAGGG - Intergenic
1174688072 20:52474670-52474692 TTGTTCTCCAGGGGAAAAGAAGG + Intergenic
1175415853 20:58800545-58800567 TGGTGCTTCCTGGAAAAAGAGGG + Intergenic
1175662466 20:60825789-60825811 TGGTGCCCCCCGCAAAAAGATGG - Intergenic
1178348909 21:31857285-31857307 TGGTGCTGTAAGGGAAAAGAAGG - Intergenic
1179641234 21:42748453-42748475 TGGTTATCACGGGGAAGAGACGG + Intronic
1180042871 21:45288747-45288769 TGGTGCCCTCGGGGAACAGCGGG - Intergenic
1181778222 22:25175145-25175167 TGGGGCTCCCAGGGGAAAGGAGG - Intronic
1182005705 22:26957707-26957729 AGGTGCTACGGGGGAGAAGATGG + Intergenic
1182470453 22:30544971-30544993 TGGGGTTCCCGGGGCAAAGAAGG - Intronic
1184639831 22:45864694-45864716 TGGTGCTTCCGACGGAAAGATGG - Intergenic
1184738260 22:46411708-46411730 TGGGCCGTCCGGGGAAAAGATGG - Exonic
949572833 3:5310176-5310198 TGGTGCTATGGGGGAAAAAAAGG + Intergenic
950861731 3:16153466-16153488 TAGTGCTCCTGAGCAAAAGAAGG - Intergenic
952691928 3:36218704-36218726 TGGTGCTGCAGTGGAAAAGTAGG - Intergenic
953683211 3:45055781-45055803 TTGTGCTCCCTGGGAGAAGGGGG + Intergenic
954849529 3:53588620-53588642 TGCTGCTCTCAGGGAAAACAAGG - Intronic
955729278 3:61967029-61967051 TGGTGCTCCCAGAGAAAACCTGG + Intronic
956205129 3:66747657-66747679 TGGTGCTCACGGGGAAAAGGGGG + Intergenic
964379515 3:156083895-156083917 TTTTTCTCCCTGGGAAAAGATGG - Intronic
978561011 4:110033207-110033229 GGGTGCTCCAGGAGTAAAGATGG + Intergenic
981572091 4:146162743-146162765 TGGCTTTCCTGGGGAAAAGATGG + Intergenic
984616148 4:181900775-181900797 TTGTGCTCCGGGGGAAAGGAAGG - Intergenic
984869798 4:184316039-184316061 AGGTGCTCACAGGGAGAAGAAGG - Intergenic
990128819 5:52553538-52553560 TAGTGTTCCTGGGGAAAAAAAGG - Intergenic
990492206 5:56313648-56313670 TGGAGCTCCCAGGGAAAATAAGG + Intergenic
997364971 5:133319803-133319825 AGTTGCTCCTGGGGTAAAGAAGG - Intronic
997656584 5:135559609-135559631 TGGGCCTCACGGGGAAGAGAGGG + Intergenic
998167440 5:139852199-139852221 TGGTGCTCCCGAGGGAAGAAGGG + Intronic
998367515 5:141640600-141640622 TGGAGCCCCAGGGGAAAAGCTGG + Exonic
1001908339 5:175492538-175492560 TGGTGCTATCGGAGAACAGAAGG - Intronic
1002193103 5:177489106-177489128 TGCTGCTCTCTGGGCAAAGAGGG - Intronic
1002996207 6:2287365-2287387 TGGTGATACCCAGGAAAAGAGGG + Intergenic
1004061069 6:12198611-12198633 AGGTGCTACAGGGGAAAACAAGG + Intergenic
1004169557 6:13285296-13285318 TGGCCCTCCCCAGGAAAAGAAGG - Intronic
1006175056 6:32116557-32116579 AGGTGGTCCTGGGGAACAGATGG + Exonic
1007487212 6:42189322-42189344 ATATGCTCCTGGGGAAAAGAGGG + Intronic
1007895572 6:45353829-45353851 AGGTGCTGGCGGGGAAAATAGGG + Intronic
1010276439 6:73972939-73972961 TGGTGATACCGAGGAAAACAGGG + Intergenic
1010972512 6:82277848-82277870 TAGTGCTACCAGGAAAAAGAAGG - Intergenic
1011174195 6:84541654-84541676 TGGTGATACCTGGGAAAACAGGG + Intergenic
1011236901 6:85228212-85228234 GGGTGCTCCCTGTGAAAAGAGGG - Intergenic
1011249898 6:85360110-85360132 TGGTGCTACTGTGGAAAGGAGGG - Intergenic
1021717580 7:23473863-23473885 TGGTGCCCCGGGAGAGAAGATGG + Intergenic
1024153510 7:46597105-46597127 TGCTGCTCCTAGGGAAAAGAAGG + Intergenic
1025993807 7:66515376-66515398 TGTTCCTCCAGGGGAATAGATGG + Intergenic
1026488240 7:70839014-70839036 TGGTGATACCTGGGAAAACAGGG + Intergenic
1026602840 7:71790844-71790866 TGGAGCTGCCGGGGACAGGAGGG + Intronic
1027637974 7:80699970-80699992 TGGTGCTCATGGGAGAAAGATGG + Intergenic
1028327110 7:89540800-89540822 TGGTGATACCCAGGAAAAGACGG + Intergenic
1030274786 7:107709126-107709148 TGGTGCTCCCTGTGAAATCAGGG - Intronic
1031454951 7:121967936-121967958 CAGTGCTCCTAGGGAAAAGAAGG - Exonic
1039431605 8:37529347-37529369 GGGTGCTGCAGGGGAAAGGAAGG - Intergenic
1039688322 8:39833730-39833752 TGGTGCTACTGGGAACAAGAAGG + Intronic
1039881891 8:41630404-41630426 TGGTGCTCCCAGGAAGAAGCGGG - Intergenic
1040618383 8:49062746-49062768 TGGTGTTCCCAGGGCCAAGACGG + Intronic
1041044534 8:53878501-53878523 CGGTGTTCCCGGGAATAAGAAGG + Intronic
1041896844 8:62934822-62934844 TTGTGCTACTGGGGAAAAAACGG + Intronic
1042206196 8:66332173-66332195 TGGAGCTCCCGGGAGGAAGATGG - Intergenic
1046713037 8:117534741-117534763 TGGTGGGCACAGGGAAAAGATGG + Intronic
1047055094 8:121155172-121155194 TGATAATACCGGGGAAAAGAGGG - Intergenic
1049375776 8:142288394-142288416 TGGTGCCCCCAGGGCACAGATGG + Intronic
1051353345 9:16218539-16218561 GGGTGAACCCGGGGGAAAGATGG + Intronic
1052395950 9:27938297-27938319 TGGGGCTCCCAGGGAAAGCAGGG + Intergenic
1052419382 9:28222898-28222920 TGGTACTCTCGGGGAACAGCTGG + Intronic
1053618585 9:39793970-39793992 TGATGCTACGGGGGAAATGAGGG + Intergenic
1053876757 9:42553331-42553353 TGATGCTACGGGGGAAATGAGGG + Intergenic
1053895917 9:42741374-42741396 TGATGCTACGGGGGAAATGAGGG - Intergenic
1054234940 9:62548391-62548413 TGATGCTACGGGGGAAATGAGGG - Intergenic
1054265570 9:62913459-62913481 TGATGCTACGGGGGAAATGAGGG - Intergenic
1056814805 9:89793282-89793304 CGCTGCTCCTGGGGAAAGGAAGG - Intergenic
1057344733 9:94239340-94239362 GGGTGCTCAGGGGGAAAGGATGG - Intergenic
1057940373 9:99276783-99276805 TGGTGGTGAAGGGGAAAAGAAGG + Intergenic
1060151291 9:121289969-121289991 TTATGATCCCAGGGAAAAGATGG + Intronic
1060254619 9:122016202-122016224 GGGTGCTCCAGGCAAAAAGAAGG + Intronic
1061639561 9:131941622-131941644 ATTTGCTCCCGGAGAAAAGAAGG + Intronic
1062534463 9:137015358-137015380 TGGGGGTCCCGGGGAGAAGGTGG + Intronic
1186659146 X:11650540-11650562 TGGTGCTCCCTGGGGAGAGCCGG - Intronic
1187921571 X:24207788-24207810 TCGTGTTCCCAGGGAAAAGATGG + Exonic
1188743795 X:33817254-33817276 TGGTGGTCCTGGGGGACAGAGGG + Intergenic
1189008010 X:37015022-37015044 TTGTGCTGGCGGGGAAGAGAAGG - Intergenic
1191197986 X:57744959-57744981 TGGTGATACCCAGGAAAAGAGGG + Intergenic
1195774728 X:108391017-108391039 TGGTGATACCCGGGAAAACAGGG - Intronic
1196458128 X:115904029-115904051 TGGAGTTCCCAGGGAATAGATGG + Intergenic
1196812741 X:119641628-119641650 TGGTGCTCACAGGGAAAATGAGG + Intronic
1200421590 Y:2975587-2975609 TCGTGTTCCCAGGGAAAAGATGG + Exonic