ID: 1157166939

View in Genome Browser
Species Human (GRCh38)
Location 18:45366367-45366389
Sequence CCAGCCAGGTGCTACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157166934_1157166939 19 Left 1157166934 18:45366325-45366347 CCTCAAGAAAGGTTTGAGATAAA 0: 1
1: 0
2: 2
3: 36
4: 313
Right 1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 163
1157166933_1157166939 24 Left 1157166933 18:45366320-45366342 CCTCTCCTCAAGAAAGGTTTGAG 0: 1
1: 0
2: 2
3: 12
4: 113
Right 1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157166939 Original CRISPR CCAGCCAGGTGCTACCAGGT GGG Intronic
900136276 1:1118420-1118442 CCAGGCAGCTGCTGTCAGGTTGG - Intergenic
900213316 1:1467943-1467965 CCAGCCACGTGCCTCAAGGTGGG + Intronic
900220877 1:1508761-1508783 CCAGCCACGTGCCTCAAGGTGGG + Intergenic
900361184 1:2289837-2289859 CCAGCCAGGTGCTGCCCAGAGGG - Intronic
901104341 1:6743678-6743700 CCAGCCGAGCGCTACCAGGAGGG - Intergenic
901270262 1:7947414-7947436 CTAGCCAGGTGACACCAGGCAGG - Intergenic
901529385 1:9843749-9843771 CCTGCCAGGTGCTGGCAGCTCGG + Intergenic
902978950 1:20109482-20109504 ACACCCAGGGACTACCAGGTGGG - Intergenic
905145965 1:35887037-35887059 GCAGCCAGGTGCTAGTAGATAGG + Intronic
908889629 1:68829921-68829943 ACAGCTATCTGCTACCAGGTTGG - Intergenic
912633697 1:111271193-111271215 CCGGCGAGGTGCGACAAGGTGGG + Intergenic
913185400 1:116366101-116366123 CCAGCCAAGTGCACCCAGTTGGG - Intergenic
913711502 1:121488525-121488547 CCAGATAGGTTCTAGCAGGTTGG + Intergenic
915980637 1:160417751-160417773 ACAGCAAGGTGCAACCAGGAAGG - Intronic
916513076 1:165490461-165490483 CCATCCATGTGCTTCCAGGGTGG - Intergenic
924389910 1:243543153-243543175 ACAGCCAGGAGCTACCATGTGGG - Intronic
1063294987 10:4796396-4796418 CCAGCCATTTGCTACCAGAAAGG - Intronic
1065496354 10:26332728-26332750 CCAGCCAGGAGAGACCAGGACGG + Intergenic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1066464109 10:35639006-35639028 CCAGCCAAGTGCAGCCAGGGAGG + Exonic
1067407465 10:46036173-46036195 CCAGGCAGAGGCTCCCAGGTAGG - Intronic
1067768486 10:49107503-49107525 CCACCCAGGGGCTCCCGGGTTGG - Intronic
1070764532 10:79048717-79048739 CCAGCCAGGGGCTCTCAGGTTGG + Intergenic
1072802427 10:98402175-98402197 ACAGCCATGTGCCACCATGTTGG - Intronic
1073178964 10:101572613-101572635 CCAGTCAGTTACTACCATGTGGG + Intronic
1075779931 10:125010875-125010897 CCAGTGAGGTACAACCAGGTAGG + Intronic
1076175375 10:128364042-128364064 CCAGAGAGGTACTACCAGGAGGG + Intergenic
1077035604 11:493021-493043 TGAGCCAGGTGGTAGCAGGTGGG + Intergenic
1078508716 11:11969702-11969724 CCGGCCAGGCTCTTCCAGGTGGG - Intronic
1079062285 11:17259833-17259855 CCAGCCAGCTGTTGCCAGGTAGG + Intronic
1083470340 11:62880130-62880152 ACATCCAGGTGCTAGCAGCTGGG + Intronic
1083780546 11:64915240-64915262 CCCTCCAGGAGCTTCCAGGTTGG - Intronic
1085082522 11:73646505-73646527 TCAGGAAGGTGCTACCAAGTGGG - Exonic
1088976662 11:114822198-114822220 CCAGCCAGGTGCTGCCGAGCGGG - Intergenic
1089400967 11:118164503-118164525 TCACCCAGGTGTTACCAGGCTGG + Exonic
1092147966 12:6227876-6227898 CCAGCCAGCAGCTGACAGGTGGG + Intronic
1094051017 12:26220768-26220790 TCAGGAAGGTGCTGCCAGGTGGG - Intronic
1096262384 12:50100942-50100964 CTAGGCAGGTACTAACAGGTTGG + Intergenic
1098572763 12:72007490-72007512 CCAGCCAGGTGTTCGCAGTTTGG + Intronic
1099932833 12:89093085-89093107 CCTGGCAGGTGTTAGCAGGTGGG + Intergenic
1100444033 12:94644452-94644474 CAAGACAGCTGCTACCAAGTTGG - Intronic
1101545006 12:105704253-105704275 CCAGGTAGGTCCTTCCAGGTAGG + Intergenic
1103392364 12:120583897-120583919 CCGGCCAGGTGCTGTCAGGAGGG + Intergenic
1103524409 12:121558351-121558373 CCTACCAGGTGATTCCAGGTGGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103924417 12:124415665-124415687 CCAGGCAGGGGCTCCCAGGATGG - Intronic
1104174648 12:126318266-126318288 CCAGCCAGCTGCTGCCATGCGGG + Intergenic
1111965451 13:94857344-94857366 CCAGTCAGCTGCCACCAGGCAGG + Intergenic
1112157134 13:96830676-96830698 CAAGGCTGGTGCTGCCAGGTAGG - Intronic
1115094570 14:29619344-29619366 CCAGCCTTTTGCTACCTGGTTGG + Intronic
1119548733 14:75492841-75492863 CCAGCCAGGAGGTGCCAGGCTGG - Intergenic
1120637902 14:86974266-86974288 CCAGCCAGGTCCTCTCAGCTGGG + Intergenic
1121169680 14:91843110-91843132 CCAGCCAGCTGCTCCAAGGAGGG + Intronic
1121732300 14:96195110-96195132 CCAGCCAGGCCCTGCCAGGCAGG - Intergenic
1124252399 15:28115460-28115482 CCAGCCAGCTGCTTCCAGACAGG + Exonic
1124685383 15:31777673-31777695 CCAGGCAGGGGCTTCCATGTTGG + Intronic
1128886047 15:71289241-71289263 TCAGCCATGTGCAACCAGGAGGG + Intronic
1133647953 16:7781961-7781983 ACAGCCAGGTGCCACCATGCCGG + Intergenic
1135460959 16:22642562-22642584 CCAGCCAGGGCCTGCCATGTCGG + Intergenic
1136104456 16:28019651-28019673 GCATCCAGGTGCTACCAGAAAGG - Intronic
1141049403 16:80746953-80746975 CCAGCCAGTTGTTACCATATTGG - Intronic
1141217460 16:82038489-82038511 ACAGGCACGTGCTACCACGTTGG + Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1142479348 17:208605-208627 CCAGGCTGGTGTTCCCAGGTCGG + Intergenic
1142715596 17:1745388-1745410 GCAACCAGGTACAACCAGGTGGG + Exonic
1142903875 17:3029671-3029693 CCAGCCAGCAGCTTCCAGGAAGG + Intronic
1144583459 17:16473562-16473584 TCAGCCAGATGCTGCCAGGGAGG + Intronic
1144783449 17:17819243-17819265 CCAGGCACATGTTACCAGGTGGG + Intronic
1145710536 17:26969317-26969339 GCACCCAGGTCCTACCTGGTTGG + Intergenic
1149785876 17:59434471-59434493 CCTGCCAGGTGTTACAAGGAGGG + Intergenic
1152661824 17:81545909-81545931 TCAGCCTGATCCTACCAGGTGGG + Intronic
1156369158 18:36457045-36457067 CCAGTCAGGTTCCAGCAGGTGGG + Intronic
1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG + Intronic
1157475771 18:48022522-48022544 CCAGGCAGCTGCGATCAGGTGGG + Intergenic
1160186851 18:76682468-76682490 CCTGGCAGCTGCTCCCAGGTAGG - Intergenic
1160521420 18:79510456-79510478 CCACGCAGGTGCCATCAGGTAGG - Intronic
1161644613 19:5445391-5445413 ACAGCCAGATGCTTCCAGGCAGG - Intergenic
1162362117 19:10226801-10226823 CCAGCCAGGACCTCCCAGATGGG - Intronic
1164598998 19:29548674-29548696 CCCGCCAGATGCTCCCAGGGTGG + Intronic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1167393940 19:49214845-49214867 AGAGCCAGGGGCTACCAGGGTGG - Intergenic
1168009939 19:53521886-53521908 CCAGCCATGTGGTACCTGCTAGG + Exonic
927138789 2:20115755-20115777 CCTGCTAGGTGGGACCAGGTAGG + Intergenic
932339155 2:70948883-70948905 CCAGCAAGGTGTGACCAAGTAGG - Intronic
932501027 2:72182737-72182759 CCAGCCAGTTGGCACCAGGCTGG + Intronic
936874801 2:117175442-117175464 ACAGGCATGTGCTACCACGTCGG - Intergenic
937058767 2:118965879-118965901 ACTGCCTGGTGCTATCAGGTAGG + Intronic
937446447 2:121962710-121962732 TCAGCCAGGTGGCACCAGGAGGG - Intergenic
937905891 2:127052613-127052635 CCAGCCTGGTGCGAGCTGGTAGG - Intronic
939617501 2:144377651-144377673 GCAGCCAGGTGCTTAAAGGTGGG - Intergenic
940696872 2:156990673-156990695 ACAGGCATGTGCCACCAGGTCGG - Intergenic
940812969 2:158266327-158266349 CCAGCCAGTTGCTGCCACATAGG + Intronic
941918170 2:170825541-170825563 CCAGCCAGTTGTTGCCAAGTGGG - Intronic
946048435 2:216840702-216840724 CCTGACAGGTGCTACCAATTTGG + Intergenic
946306124 2:218857974-218857996 CCAGCCATGTGGTACCAAATAGG - Intergenic
947206660 2:227667164-227667186 ACACCCAGGTGATACCAGATGGG - Intergenic
947607284 2:231495907-231495929 CCAGCCAACTGCTGCCATGTGGG + Intergenic
948182438 2:235992918-235992940 CCAGCCAGGTTCTCCCAGGTAGG - Intronic
1172390663 20:34562785-34562807 CCAGCCTGGAGCTGCCAGCTGGG - Intronic
1172961902 20:38805877-38805899 CCAGCTAGGTGATAGCAGGCTGG - Intronic
1174847282 20:53954862-53954884 CCAGCCAAGAGATACCACGTAGG + Intronic
1178533556 21:33394369-33394391 CCACCCATGTGCTCCCAGGCAGG + Intergenic
1179596373 21:42445556-42445578 CCAGCCAGGTGCCTGCAGGAGGG + Intronic
1180073979 21:45453479-45453501 CTTGCCAGGTGCTTCCTGGTGGG + Intronic
1180169598 21:46050966-46050988 CCAGCCTGGTGCTGGCAGGGTGG - Intergenic
1180787511 22:18555018-18555040 CCAGGCAGGTGCTAGCGGGCTGG + Intergenic
1181134623 22:20755983-20756005 CAAGGCAGGTGCTATCAGCTTGG + Intronic
1181234228 22:21440287-21440309 CCAGGCAGGTGCTAGCGGGCTGG - Intronic
1181244419 22:21494544-21494566 CCAGGCAGGTGCTAGCGGGCTGG + Intergenic
1181733698 22:24865917-24865939 CCAGCCAGGACCTAGCAGGCCGG - Intronic
1181876876 22:25946365-25946387 CCTCCAAGGTGCTACCTGGTAGG - Intronic
1181935809 22:26437566-26437588 CCAGGCAGATGTTACCAGGGAGG + Intronic
1183629912 22:39026624-39026646 CCAGCTAGGTGCTGTTAGGTGGG - Intronic
1184235102 22:43179130-43179152 CCAGCCAGGCACTACCGAGTGGG + Intronic
1185242487 22:49754188-49754210 CCAGGCACCTGCTGCCAGGTGGG - Intergenic
950890663 3:16401114-16401136 CCAACAAGGTTTTACCAGGTTGG - Intronic
954305496 3:49723322-49723344 CCAGTCAGGTTCTACCAGGATGG + Intronic
954579681 3:51696510-51696532 CCAGCCAGGTGCAACCTCGGAGG - Intronic
954691445 3:52397669-52397691 CAAGCCAGGGGCTTCCATGTTGG + Intronic
957766245 3:84628949-84628971 CCATTCAGCTGGTACCAGGTTGG - Intergenic
959550750 3:107653961-107653983 CCATCCAGGTGCTACCTGCATGG - Intronic
961086394 3:124071190-124071212 CCAGTCAGATGTTACCTGGTGGG + Intergenic
961445368 3:126978145-126978167 CCACCCAGGGTCTCCCAGGTGGG + Intergenic
972474134 4:39434703-39434725 TCAGCCAGGTGCTTCAAGGTTGG + Exonic
976513488 4:85937113-85937135 CCAGCCAAGTGCTGCCATGGTGG - Intronic
979967126 4:127088658-127088680 CCAGCCAGGTCCTCCCAGCTGGG + Intergenic
980460435 4:133104242-133104264 ACAGCCACGTGCTACTACGTTGG - Intergenic
986094886 5:4544796-4544818 CCAGCAAGGTGCCTCCAGATAGG - Intergenic
990877805 5:60506017-60506039 CCAGCCTGTTGGTACCAGGGTGG + Intronic
992069590 5:73136604-73136626 CCTGCCTGCTGGTACCAGGTAGG + Intergenic
992098278 5:73381951-73381973 CCAGCCAGGTGCCTCCCGGCTGG + Intergenic
997209742 5:132070282-132070304 CCTGCCAGGTGTTCGCAGGTAGG - Intergenic
998384217 5:141747186-141747208 CCAGCCAGGGCCTTCCAGCTTGG - Intergenic
1001431256 5:171664406-171664428 CCAGCCAAGTGCTGCCATGCAGG - Intergenic
1001724473 5:173885508-173885530 ACAGTCAGGTGCTGCCAAGTCGG - Intergenic
1002332505 5:178454446-178454468 CCAGTGAGGTGATGCCAGGTGGG + Intronic
1003643040 6:7891658-7891680 AGAGCCAGCTGCTCCCAGGTTGG + Exonic
1006192729 6:32219628-32219650 CCAGACAGGTGCTTCCTGGGTGG + Exonic
1006754188 6:36400414-36400436 CCAGCCAGGGCCTGTCAGGTAGG - Intronic
1007725422 6:43913105-43913127 CCCACCAGGTACTACCAGGCAGG - Intergenic
1014393568 6:120895005-120895027 CCAGCCAGGTCCTTCCAGTCAGG - Intergenic
1017428934 6:154351388-154351410 GCAGTCAGGTGGTACCACGTAGG - Intronic
1018334909 6:162776619-162776641 TCAGCCACCTGCTAGCAGGTTGG - Intronic
1018545659 6:164933383-164933405 CCAGCCAGCTGCTCCCAGTGCGG - Intergenic
1019070080 6:169338284-169338306 CCAGCCAGGAGAGACCAGGATGG - Intergenic
1019542200 7:1556440-1556462 CCAGGCAGCTGCCACCTGGTGGG + Intronic
1020100415 7:5391193-5391215 CCAGGCAGGAGCTGCCAGGAAGG + Intronic
1021318220 7:19177717-19177739 CCAGACATGTGCTACCAGAAAGG + Intergenic
1022391567 7:29948747-29948769 GGAGCCAGCTGCTACCAGCTTGG + Intronic
1022652518 7:32290188-32290210 CAAGCCGGGTGCTTCCAGCTGGG - Intronic
1023640636 7:42253465-42253487 CCAGCCTGAGGCTACCAGCTTGG + Intergenic
1023873924 7:44276751-44276773 CCAGCGTGGGGCTCCCAGGTGGG - Intronic
1029724143 7:102391020-102391042 CCAGGAAGGTGCCACCAGGAAGG + Intronic
1032519095 7:132529173-132529195 GCAGCCAGTGGCTGCCAGGTAGG - Intronic
1033307765 7:140237762-140237784 CCAGCCATGTGGTACCAGGAAGG + Intergenic
1034350691 7:150412978-150413000 TCAGCCAGGTCCTACTCGGTGGG - Intergenic
1035912354 8:3581616-3581638 CCAGCGAGGTGCATCCAGGAAGG - Intronic
1037947152 8:22996753-22996775 CCTGCCGGGTGCTAACAGCTGGG + Intronic
1039603938 8:38865692-38865714 CCAGCTAGCTGCTAGCAGTTGGG - Intergenic
1040541568 8:48361854-48361876 AGAGCAAGGTGCTAGCAGGTTGG + Intergenic
1040672845 8:49713188-49713210 TCAGCCTGCTGTTACCAGGTTGG + Intergenic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1048525643 8:135199900-135199922 CCAACCAGGTGTGACCAGTTAGG - Intergenic
1051404108 9:16715667-16715689 CCAGCCGATTGTTACCAGGTGGG - Intronic
1052176730 9:25472103-25472125 CCAGCCAGGTCCTCCCAGCCAGG - Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1058153984 9:101491311-101491333 CCAGCTAGCTGGTGCCAGGTTGG - Intronic
1058506282 9:105669500-105669522 CCAGCCTGGTGCTCCCAAATAGG - Intergenic
1060223432 9:121776186-121776208 ACCGCCAGGTCCTACCAGGAGGG - Exonic
1060224052 9:121780727-121780749 CCAGCCAGGTGGGGCCAGGAGGG + Intronic
1061077958 9:128353227-128353249 ACAGCCAGGTGCGGCCAGGTTGG + Exonic
1061454037 9:130684217-130684239 ACAGCCAGCTACCACCAGGTGGG - Intergenic
1061873752 9:133534044-133534066 CCTGCCAGGGGCTGCCAAGTTGG + Intronic
1062453762 9:136626447-136626469 CCAGCAAGGGCCAACCAGGTTGG - Intergenic
1190803415 X:53813467-53813489 CCAGCCGGGTCCTCCCAGCTGGG - Intergenic
1193018728 X:76766323-76766345 CCAGCCAATTGCTACCATGTAGG + Intergenic
1199526954 X:148803494-148803516 GCAGCAAGGTGCTTCCAGATAGG + Intronic