ID: 1157175051

View in Genome Browser
Species Human (GRCh38)
Location 18:45443977-45443999
Sequence CTGGAAACACACATGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157175047_1157175051 19 Left 1157175047 18:45443935-45443957 CCTTAGGGAGAGAAAACAGGTGC 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG 0: 1
1: 0
2: 3
3: 35
4: 340
1157175045_1157175051 24 Left 1157175045 18:45443930-45443952 CCAGGCCTTAGGGAGAGAAAACA 0: 1
1: 0
2: 0
3: 20
4: 216
Right 1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG 0: 1
1: 0
2: 3
3: 35
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157175051 Original CRISPR CTGGAAACACACATGGAGAG TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900905268 1:5552674-5552696 CTGGAAATAAAGGTGGAGAGGGG + Intergenic
900990058 1:6094495-6094517 CTGGACACACACATGCTGCGCGG - Intronic
902702891 1:18184681-18184703 CAGGAAACACACAGGTAAAGAGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903145412 1:21368886-21368908 CAGGAAACAGACGTGGAGACCGG - Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
905268061 1:36768683-36768705 CTGGACACATACATGCACAGTGG + Intergenic
905941079 1:41864001-41864023 CTGGAATCAGACGTGGAGAGAGG + Intronic
906645868 1:47474511-47474533 TGGGAAACACACAGGGAGATAGG + Intergenic
907398312 1:54207987-54208009 CTGGAAAAACACCTTGAGAATGG - Intronic
907583308 1:55591675-55591697 GTGAACACACACACGGAGAGAGG - Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912105198 1:106264794-106264816 CTGGAAACCGATGTGGAGAGGGG - Intergenic
912473413 1:109921239-109921261 CAAGAGACGCACATGGAGAGAGG - Intronic
912749992 1:112279504-112279526 ATGGAAGAACACATGGAGAGAGG - Intergenic
912875124 1:113349975-113349997 CTGGAAAAGGACATGGGGAGTGG + Intergenic
913254432 1:116941061-116941083 GTGGAAGCACAAAGGGAGAGAGG - Intronic
914767333 1:150650261-150650283 CTGGCAACACACAGGGAGTTAGG + Intronic
917211237 1:172633949-172633971 CAGGAAAGACAAATGCAGAGAGG + Intergenic
917734641 1:177909296-177909318 CTGGTGACACCCAGGGAGAGAGG + Intergenic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920775867 1:208936535-208936557 GTGGAAACAAAGATGTAGAGTGG - Intergenic
920955703 1:210618697-210618719 CTAGAAACATACATGGGGAAGGG - Intronic
920973036 1:210758668-210758690 CTGGAAATGGACCTGGAGAGGGG + Intronic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
923552721 1:234977036-234977058 CTAAAAACAAACTTGGAGAGTGG + Intergenic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1064470764 10:15633189-15633211 ATGGAAGCATACATGGAGAGAGG - Intronic
1064710795 10:18122378-18122400 CTGCAAAGCCACATGGAGTGGGG + Intergenic
1065499048 10:26360893-26360915 CTGGAAACATCCATGCAGAGAGG + Intergenic
1067158708 10:43804141-43804163 CTGGAAACTCACCTGGAAAACGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1069326980 10:67243173-67243195 CTGGAGAGAAACATGGGGAGTGG - Intronic
1069416811 10:68207860-68207882 GTGGAAACTCACAGGGAGGGTGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070548814 10:77474585-77474607 CAGGAAACTCACATGGGGCGCGG + Intronic
1070796138 10:79217697-79217719 CTGGAAACATACATGGAAAGAGG - Intronic
1071337545 10:84613221-84613243 GTGGGAACACACAAGCAGAGTGG - Intergenic
1071812600 10:89199825-89199847 CTGGAAACAAACACTGAGACAGG + Intergenic
1072350994 10:94556922-94556944 CAGGAAACACATCTGGAGACAGG - Intronic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073956919 10:108883162-108883184 CTAGAAGCTCAGATGGAGAGGGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075038701 10:119090499-119090521 CAGGAGACCAACATGGAGAGAGG - Intergenic
1075937132 10:126351879-126351901 TTGGACACACACAGGAAGAGTGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076360813 10:129887756-129887778 ATGGAGTCACACATGGCGAGTGG + Intronic
1076500251 10:130931035-130931057 CTGGAAAGCCTCAGGGAGAGTGG + Intergenic
1076734167 10:132451333-132451355 CTGGAAACAGGCAGGGCGAGGGG + Intergenic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1078375834 11:10792515-10792537 CTGGTCACGCTCATGGAGAGGGG - Intergenic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1079713531 11:23716815-23716837 ATGGACACAAACATGTAGAGAGG + Intergenic
1079801280 11:24872544-24872566 ATGAAAACACACAGGAAGAGAGG - Intronic
1081030657 11:38077608-38077630 CTTGAAAAATACAAGGAGAGTGG + Intergenic
1081574323 11:44309824-44309846 CTGGCGACACCCCTGGAGAGTGG - Exonic
1081745406 11:45469367-45469389 CTGGAAAAAGACAAGGTGAGGGG - Intergenic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085776541 11:79371637-79371659 CTGAAAGCACACCTGGGGAGGGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085963143 11:81487518-81487540 CTGGAAACAGAGAGAGAGAGAGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088922520 11:114271504-114271526 CTGGAGCCACACATGTAGTGGGG - Intronic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1090899125 11:131010489-131010511 CTTGAACCACACATGCAGGGAGG - Intergenic
1092547792 12:9466823-9466845 CTGGGAATAAAGATGGAGAGAGG + Intergenic
1092705165 12:11275282-11275304 CTGAAATCAGACATGAAGAGGGG - Intergenic
1092709562 12:11320910-11320932 CTGAAATCAGACATGAAGAGGGG - Intergenic
1092911166 12:13146070-13146092 GAGGAAAGACACAGGGAGAGAGG - Intergenic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1099506168 12:83478936-83478958 CTCAAAGCACACATGGAGACAGG - Intergenic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100797145 12:98194389-98194411 CTAGAAAGAGACATGGAGTGGGG + Intergenic
1101569636 12:105941246-105941268 CTGGGAACACACATGGTTATAGG + Intergenic
1103186922 12:118966226-118966248 CTGAGAACACACATGGACACAGG - Intergenic
1103568046 12:121826942-121826964 CTGAAAACACCCAGGCAGAGAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1106819655 13:33450768-33450790 TTGGGAAAACACAGGGAGAGGGG + Intergenic
1107051309 13:36053410-36053432 CTGGAAATAGCCATGGAGAAAGG + Intronic
1107435699 13:40378911-40378933 CTGGAGAGACACATCGGGAGTGG - Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1110709023 13:78629500-78629522 CTGAACAGAGACATGGAGAGAGG + Intronic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1112127021 13:96479347-96479369 CAGGAGATGCACATGGAGAGGGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113135726 13:107086824-107086846 AGGGCAACACACAAGGAGAGAGG - Intergenic
1113731027 13:112641661-112641683 CTGGAAGCAGACTTGGAGACTGG - Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1115002160 14:28435803-28435825 GTGGAAGAACAAATGGAGAGTGG + Intergenic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1118407943 14:65445293-65445315 CTGTAAACACTCATGGTGAAAGG - Intronic
1118964518 14:70567462-70567484 CAGGAAATGAACATGGAGAGAGG + Intergenic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119513995 14:75233713-75233735 CTGCCAACACTCAAGGAGAGGGG + Intergenic
1119859822 14:77928060-77928082 GTGGCAACAGAGATGGAGAGAGG + Intronic
1119925658 14:78491022-78491044 GTCGAAACACCCTTGGAGAGTGG - Intronic
1119926974 14:78503808-78503830 CTGGAACAACACATGTAAAGTGG - Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1120079418 14:80198662-80198684 CTGGAAGCATATATGAAGAGTGG + Intronic
1121049972 14:90814060-90814082 CTAGAGACTCACATGGTGAGTGG - Intronic
1122439419 14:101719790-101719812 CTGGATAAACACCTGAAGAGGGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123947403 15:25245442-25245464 CTGGATGCATGCATGGAGAGGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125770087 15:42159440-42159462 CTGATGACACACAGGGAGAGTGG - Exonic
1127345729 15:58095897-58095919 CTTGAAACTCACAGAGAGAGGGG + Intronic
1128145859 15:65332188-65332210 CTGGAGATACACAGGGTGAGAGG + Intronic
1128219467 15:65958028-65958050 ATGGAAACCAAAATGGAGAGTGG + Intronic
1130542284 15:84829103-84829125 CTGGGAAGACAAATTGAGAGGGG - Intronic
1132703071 16:1230199-1230221 CTGGAAGCATAAATGGGGAGGGG - Intergenic
1132708380 16:1256032-1256054 CTGGAAGCATAAATGGGGAGGGG + Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1135856852 16:26019597-26019619 TTGGAAACACACAGGGAGGGCGG + Intronic
1135871548 16:26155998-26156020 ATGGAAACACAAAAGTAGAGAGG - Intergenic
1136011069 16:27363641-27363663 GTGGAACCCCACCTGGAGAGGGG - Exonic
1137455006 16:48611204-48611226 CAGAAAACAGACCTGGAGAGGGG - Intronic
1137767665 16:50990665-50990687 TTGGAAACCCCCATGGAGACAGG + Intergenic
1140476877 16:75243408-75243430 CTGGACCAACACAAGGAGAGCGG + Intronic
1140507319 16:75482032-75482054 CTGCAAACACCTATGAAGAGGGG + Intronic
1140923727 16:79563264-79563286 CTGTAACCACACATGGGCAGCGG - Intergenic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1143891711 17:10107383-10107405 CTGGAAACTTACATACAGAGTGG + Intronic
1144178046 17:12727549-12727571 CTGGAAAGGCACGTGGACAGGGG - Intronic
1144795560 17:17889010-17889032 GAGGAAAGACACATTGAGAGTGG - Intronic
1146420203 17:32677937-32677959 CTGGAAGGACACCTGGAGGGCGG - Intronic
1148966506 17:51440433-51440455 CTGAAGAAACCCATGGAGAGAGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1151108244 17:71644315-71644337 CCTGAAAGACACATGGAGAACGG + Intergenic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152890654 17:82879941-82879963 CTGGAGACACCCAAGGAGACAGG - Intronic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153103123 18:1497249-1497271 CTGGGAAGAAACATGTAGAGGGG - Intergenic
1153622109 18:6989218-6989240 CTGGGATCCCACATGGGGAGAGG + Intronic
1154251167 18:12746416-12746438 CTGGACAGACACAGGGTGAGGGG + Intergenic
1154983405 18:21523533-21523555 CTGGAAACACATTTAAAGAGTGG - Exonic
1155048919 18:22129806-22129828 CTGGAAAGCCCCATGGAAAGGGG - Intergenic
1155904589 18:31434323-31434345 CTGGACATCCACATGCAGAGAGG + Intergenic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1155947946 18:31877173-31877195 CTGGAAATGAACATGAAGAGGGG + Intronic
1156095866 18:33531078-33531100 CTGGGAACAGACATGGAGTGGGG + Intergenic
1156380556 18:36556368-36556390 TATGAAACCCACATGGAGAGAGG + Intronic
1156563608 18:38158424-38158446 TTGGAAACAGACATAGAGATAGG + Intergenic
1157014375 18:43693060-43693082 CTGAAAAGACACATAGAGACTGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157779166 18:50421887-50421909 CAGGAAAGACACATGTATAGTGG + Intergenic
1158406662 18:57165858-57165880 CTGGACACAAACATGAATAGGGG + Intergenic
1158798765 18:60880698-60880720 CTGGGAACACCCATGGTTAGAGG + Intergenic
1158875727 18:61733006-61733028 CCTGAAACACACAGGGAGTGGGG - Intergenic
1159438335 18:68446434-68446456 CTGGACACAGACATGCACAGAGG + Intergenic
1159653289 18:71002925-71002947 CTGAAAGAAAACATGGAGAGTGG + Intergenic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1163054601 19:14708881-14708903 TTGGACACAGACATGGACAGAGG - Intronic
1164608233 19:29615099-29615121 CGGGAAACCCACAAGGGGAGGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167157969 19:47750735-47750757 CTGGAGACAGACGTGGGGAGAGG + Intronic
1167174052 19:47853220-47853242 CAGGAACCACACTTTGAGAGTGG - Intergenic
1167794203 19:51698655-51698677 CTGGATATACACTTGGAGAGAGG - Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
924980569 2:216210-216232 CTGGAAACTCCCATGCAGTGTGG - Intergenic
925278064 2:2664404-2664426 CGGGACACACACACGCAGAGAGG + Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927867956 2:26604423-26604445 CAGGAAACACACAGGTAGAGAGG + Intronic
928234485 2:29527885-29527907 CAGGAAACCAACATGGAAAGGGG + Intronic
929043365 2:37768269-37768291 CAGGAAACAAACATACAGAGTGG + Intergenic
929813645 2:45213342-45213364 GTGGAAACAGACAGGGAGAGAGG + Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931403236 2:61951092-61951114 CAGGAAACTCCCACGGAGAGAGG + Intronic
933639056 2:84740486-84740508 CTGGGAATGGACATGGAGAGGGG - Intronic
933651150 2:84851254-84851276 CTGCAAACACTCAAGGAGATGGG + Intronic
935296739 2:101656386-101656408 CTGGAAACAGACCTGGAGGTGGG - Intergenic
935762722 2:106336299-106336321 CAGGAAACACTCAGGGAGACAGG - Intergenic
937213947 2:120298574-120298596 TTGGAAAAACACAGGGAGGGAGG - Intergenic
937933527 2:127223751-127223773 ATTTAAACACACATGGAGACAGG + Intergenic
938692205 2:133801999-133802021 CTGCAAAGACACAAGGAGAGGGG - Intergenic
938920523 2:135990389-135990411 CTGGAAACGGAGATGGGGAGTGG - Intergenic
939096354 2:137837413-137837435 CTGGAAAAATACATGGGGACAGG + Intergenic
940707830 2:157126419-157126441 CTGAACACACACATGGGTAGTGG + Intergenic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
943926148 2:193782937-193782959 ATGGGAACACACATGGACACAGG - Intergenic
945339196 2:208631438-208631460 CTGGAATTTCACATGGTGAGAGG - Intronic
1169813383 20:9631222-9631244 CTGCCTACACTCATGGAGAGGGG - Intronic
1169836025 20:9880087-9880109 CTGGAACCACACAGGGAGACAGG - Intergenic
1169924325 20:10766925-10766947 CTGGAAAGAAGCAGGGAGAGAGG + Intergenic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171023462 20:21607961-21607983 CTGGAAACCCACCTGCACAGAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174925159 20:54751049-54751071 CTGGAAACAGACTTTGAGGGAGG - Intergenic
1175072712 20:56347757-56347779 CTGGAAACACACACCGCAAGCGG + Intergenic
1175214593 20:57385116-57385138 CTGGACACAGACAAGGACAGAGG + Intergenic
1175266895 20:57708847-57708869 CGGGAAAGACACACAGAGAGAGG + Intronic
1176912304 21:14580879-14580901 CTGAAAACACACATGACCAGAGG + Intronic
1177540604 21:22488957-22488979 CTGCAAACACTACTGGAGAGGGG + Intergenic
1177928081 21:27244028-27244050 CAGTAAGAACACATGGAGAGTGG + Intergenic
1179071339 21:38073845-38073867 CTAGAAACAGAAGTGGAGAGTGG + Intronic
1179252945 21:39688513-39688535 CTGGAAGCACACACTGGGAGTGG + Intergenic
1179333243 21:40426052-40426074 CTGTGAACACACATGGATTGGGG + Intronic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1180063590 21:45401512-45401534 TTGGAATCACAGATGGTGAGGGG - Intergenic
1180222368 21:46367181-46367203 GTGGAAACACACAGGCAGCGAGG - Intronic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180864120 22:19106040-19106062 CTGGAACCACGCAGGGAGACTGG + Intronic
1181425852 22:22838193-22838215 CTGGATACAGACCTGGAGATAGG + Intronic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1181525679 22:23484380-23484402 CAGGCAACCCACAGGGAGAGAGG + Intergenic
1181546440 22:23605261-23605283 CTGGGGTCACACAAGGAGAGGGG + Intergenic
1182079270 22:27517786-27517808 CTGTAAACACCCATGGGGAAAGG - Intergenic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1182980669 22:34667745-34667767 ATGAGAACACACATGGAGACAGG - Intergenic
1183249794 22:36722351-36722373 CTGGAAAGACCCATGGACAGAGG - Intergenic
1183620719 22:38970691-38970713 CAGGAAATAGACATGGAGATGGG - Intronic
1183815426 22:40296173-40296195 TTGGAAGCAAACCTGGAGAGAGG - Intronic
1184149511 22:42630162-42630184 CCTGAAACACACATGCCGAGTGG - Intronic
1184356465 22:43983670-43983692 CAAGAAACACACTAGGAGAGAGG - Intronic
1203295518 22_KI270736v1_random:39711-39733 CAGGAAACAAACATACAGAGTGG + Intergenic
949563023 3:5220420-5220442 GTGGCAACACACAGGGAGGGAGG - Intergenic
955052285 3:55424354-55424376 CTGGAAACACCCATGGGGTGGGG + Intergenic
955569667 3:60291102-60291124 CTGCAGACACACAAGGAGTGAGG + Intronic
956260594 3:67336156-67336178 CTGGGAACAGACGGGGAGAGGGG + Intergenic
957176206 3:76813162-76813184 ATGTAAATACACTTGGAGAGAGG - Intronic
959236775 3:103733531-103733553 TTGGACACAGACATAGAGAGAGG - Intergenic
959328281 3:104967385-104967407 CTGGAAAGAGTAATGGAGAGAGG - Intergenic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
964026126 3:152077222-152077244 ATAGAAACAGACATGGAGAAGGG - Intergenic
965501598 3:169462671-169462693 CTGGAAACAGTCTTGGATAGGGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965858765 3:173121327-173121349 CTGAAAACACACATTGAGCGAGG - Intronic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
967099394 3:186203788-186203810 ATGGAAACACGCATGGGGAAGGG - Intronic
967240227 3:187431286-187431308 CCGGGAACAGGCATGGAGAGGGG - Intergenic
967997950 3:195180690-195180712 CTGGACACACACAAGCAGACGGG + Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969075102 4:4572048-4572070 CTGGAAAGACCCTTGTAGAGGGG - Intergenic
969441341 4:7218666-7218688 CTGAAAACACACATGTAGTCTGG - Intronic
971941573 4:33222707-33222729 TTGGAAACTCACAGGGACAGAGG - Intergenic
972721960 4:41708774-41708796 CTGTGAACACACATGGCCAGTGG - Intergenic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
974314857 4:60266299-60266321 CTGGAACCCCACCTGGAGATGGG + Intergenic
976127321 4:81847789-81847811 CTGGAAACACACACTGACATGGG - Intronic
976160911 4:82197956-82197978 CTGGGGCTACACATGGAGAGTGG - Intergenic
976508277 4:85876203-85876225 TTTGAAACATACATGGATAGGGG - Intronic
976954953 4:90884347-90884369 CAGGAAGCACCCATGGAGAAGGG + Intronic
978383896 4:108160900-108160922 CTGGAAAAACACCTGGGGTGGGG - Intronic
981172908 4:141645557-141645579 GTGGGAAGACACCTGGAGAGAGG - Intronic
981237695 4:142437318-142437340 CTTGAAAGAGACAAGGAGAGTGG + Intronic
981543922 4:145874835-145874857 CTGGGAACAAACAGCGAGAGAGG - Intronic
981584378 4:146285343-146285365 GTGGAAAGAGACATGGAGATAGG + Intronic
983176215 4:164590835-164590857 TTGGACACAGACATGGACAGAGG + Intergenic
983343931 4:166502514-166502536 CTGGGAACAGACGTGGAGAGGGG - Intergenic
984599138 4:181706184-181706206 TTGGACACAGACATGGACAGAGG - Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
986300260 5:6472922-6472944 CTGGCAGCTCACATGGAGAAGGG - Intronic
988365327 5:30290821-30290843 CATGGGACACACATGGAGAGGGG - Intergenic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
989114259 5:37937090-37937112 GGGGAAGCCCACATGGAGAGAGG - Intergenic
989956053 5:50361495-50361517 CTGGAAAGAGACAGAGAGAGAGG + Intergenic
990085697 5:51973548-51973570 CTGCCAACACTCAAGGAGAGAGG + Intergenic
990780011 5:59349937-59349959 CTAGAAACAGAGATAGAGAGGGG - Intronic
990782822 5:59385591-59385613 CTGGAGAAACACATGCTGAGGGG - Intronic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
993004612 5:82416955-82416977 CTGGAAACAAACAGGTACAGAGG - Intergenic
994495860 5:100512533-100512555 ATAAAAAAACACATGGAGAGAGG + Intergenic
994707603 5:103224497-103224519 CTGGGAACAGACTTGGAGATGGG + Intergenic
995405114 5:111785951-111785973 CTGGAAAGAAAAATGAAGAGAGG + Intronic
996613653 5:125413889-125413911 CTACAAACATACATGGAAAGTGG + Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997522577 5:134532693-134532715 CTGCAAACACACTTGGGGGGTGG - Intronic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
998531806 5:142892039-142892061 CTGGACACACACCTGCACAGAGG + Intronic
999816699 5:155184107-155184129 CTCCATACCCACATGGAGAGAGG - Intergenic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1000810847 5:165858918-165858940 CAGGAAACAGTCATGGAGAAAGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1007290276 6:40780524-40780546 CTGTCAACACTCAAGGAGAGGGG - Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1009287496 6:61839302-61839324 ATAGAAACAGTCATGGAGAGGGG - Intronic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1012465520 6:99513064-99513086 CTTCAAGCAGACATGGAGAGGGG + Intronic
1012512860 6:100024735-100024757 CTGGAAACTCTCCTGGAGAGGGG - Intergenic
1012665309 6:101961519-101961541 CTGGGAACAAAGATGGATAGGGG - Intronic
1013470661 6:110460953-110460975 CTGGGAAGGGACATGGAGAGGGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1018109529 6:160521653-160521675 CTGTAAACACACAAGAAAAGTGG + Intergenic
1019328894 7:453064-453086 CCAGAAGCACACCTGGAGAGGGG - Intergenic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1021814462 7:24433711-24433733 CTGGAAACTTACATACAGAGCGG + Intergenic
1022113683 7:27245875-27245897 CTGGAACCACACCTGGGGAGAGG - Exonic
1022525188 7:31032633-31032655 ATGGACTAACACATGGAGAGAGG + Intergenic
1023117722 7:36878638-36878660 CTGGTAATACACATGGTGGGTGG + Intronic
1024524544 7:50336984-50337006 CTAGAAAGAAACATGGCGAGAGG + Intronic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1028267326 7:88742330-88742352 CTAGAAACAGAGAAGGAGAGCGG - Intergenic
1029479227 7:100802780-100802802 CTGGAAACAGACATGATGATGGG + Exonic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030980415 7:116179539-116179561 TTGGACACAGACATGGACAGAGG - Intergenic
1033754250 7:144384909-144384931 ATGGAAACCCAGAAGGAGAGAGG + Intergenic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035619521 8:1027332-1027354 CTGGTACCACACCTGGAGAATGG - Intergenic
1037340046 8:17834898-17834920 ATGGTGACACACATGAAGAGAGG - Intergenic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038817859 8:30924082-30924104 CTAGAAACCCTCGTGGAGAGTGG + Intergenic
1039764962 8:40618893-40618915 CAGGAAACACTAATGGGGAGTGG + Intronic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041944182 8:63423411-63423433 CTAGAAACAGACATGCAGACAGG - Intergenic
1042189943 8:66176753-66176775 CTTGAAACATAGAGGGAGAGAGG - Exonic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1044656863 8:94557594-94557616 GTGGACACACACATGAAGTGAGG + Intergenic
1045816545 8:106283345-106283367 CTGGAACCCTAGATGGAGAGAGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047155129 8:122308309-122308331 GTAGAAACAGACATAGAGAGAGG - Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047909388 8:129510743-129510765 CTGGAGACAGACATGCACAGAGG - Intergenic
1048207229 8:132424832-132424854 TTGGTGAGACACATGGAGAGAGG - Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1049302692 8:141879972-141879994 CTGGGAGCACAGGTGGAGAGGGG - Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050746265 9:8879775-8879797 ATAGAAACACAAACGGAGAGAGG + Intronic
1052067314 9:24038101-24038123 ATGAAAAGACACATGAAGAGTGG - Intergenic
1052161852 9:25272199-25272221 TTGGATACACACATGTATAGAGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1055717025 9:79128923-79128945 TTGTGAACACACATGGAGATGGG - Intergenic
1056388811 9:86121498-86121520 CTGGACACAGACATGCACAGAGG - Intergenic
1057551817 9:96056688-96056710 CTGGAAAGACACCTGAAAAGGGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061806889 9:133141758-133141780 CGGTAAACACACAGGCAGAGGGG + Intronic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1062328283 9:136023171-136023193 CTGGAAACCCGGATGGAAAGGGG + Intronic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185760529 X:2687215-2687237 CAGGAAGCTCACAGGGAGAGGGG + Intergenic
1186174144 X:6907430-6907452 GTGGGGACAGACATGGAGAGCGG - Intergenic
1186215312 X:7293742-7293764 CTGGAAACTCAAATAGAAAGTGG - Intronic
1186580518 X:10812870-10812892 GGGAAAACACACAGGGAGAGTGG - Intronic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1186914835 X:14208143-14208165 CTAGAAATGGACATGGAGAGGGG - Intergenic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1187748202 X:22432463-22432485 CTGGAAGCAGATATGGCGAGAGG - Intergenic
1188590117 X:31823270-31823292 CTGGAAAGACACATGCTGACAGG - Intronic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1193442413 X:81558921-81558943 CTGTAAAGACACATGCAGACTGG + Intergenic
1194067316 X:89277290-89277312 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1194401790 X:93446523-93446545 CTGCAATCACACTTGGAGTGAGG - Intergenic
1195091615 X:101464876-101464898 TTGGAATCACAGATGGAGTGCGG + Intronic
1195916417 X:109940674-109940696 CAGCACACACTCATGGAGAGGGG + Intergenic
1198168160 X:134077799-134077821 CCGGGAACAAACATGGAAAGGGG + Intergenic
1200282451 X:154789025-154789047 GAGGAAACACGCATGGTGAGGGG + Intronic
1200721475 Y:6611504-6611526 CTGGGAACAGACGTGGAGAAGGG + Intergenic
1200884134 Y:8252241-8252263 CTGGACACAGACATGGGGAGTGG - Intergenic
1200909413 Y:8517005-8517027 CTGGACACAGACATGGGTAGTGG + Intergenic
1201483751 Y:14470157-14470179 CTGGAAACTCACATAGGGACTGG + Intergenic