ID: 1157182256

View in Genome Browser
Species Human (GRCh38)
Location 18:45508231-45508253
Sequence CTCTATTAGTATTTGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157182256 Original CRISPR CTCTATTAGTATTTGGAAGA GGG Intronic
902164055 1:14555144-14555166 CTCAATTGCTATTTGGAAGGGGG - Intergenic
905495310 1:38380369-38380391 CTCTATTAGTTCTTGCGAGATGG - Intergenic
908118960 1:60967825-60967847 CTCTAACAGTATCTGGAATAGGG - Intronic
908375119 1:63529241-63529263 CTTTATAGGTATATGGAAGATGG + Intronic
909489122 1:76207031-76207053 CTCTCTTAATATGTGGAAGGAGG - Intronic
910123408 1:83815003-83815025 CTCAGTAAGTATTTGGATGAAGG - Intergenic
912535873 1:110370019-110370041 GTCTATTAGGATGTGGAAGCTGG + Intronic
912623700 1:111190741-111190763 CTCTCCTTGTATTTGGAAGAAGG - Intronic
912953124 1:114134269-114134291 CTCAAGTAGTATTTAGAAAATGG - Intronic
915860439 1:159438309-159438331 CTTTATTGGTATTTGGAAGAAGG + Intergenic
916267724 1:162907693-162907715 CTCTATTAATATTTGTTGGATGG - Intergenic
917178582 1:172266778-172266800 CTCTATGAGTATCTGGTGGAGGG + Intronic
917712424 1:177699663-177699685 TTCTATAAATTTTTGGAAGATGG - Intergenic
920323787 1:205145438-205145460 CTCCATTAATATTTAAAAGATGG + Exonic
920776222 1:208940056-208940078 TTCTTTTTATATTTGGAAGATGG + Intergenic
1063495930 10:6508119-6508141 CTGTATTATTATGTAGAAGAGGG + Intronic
1063707607 10:8446248-8446270 ATCTATTGTTATTTTGAAGACGG + Intergenic
1063871938 10:10426808-10426830 CTCTGTTAGAATTTGGAGGCTGG + Intergenic
1064569497 10:16677616-16677638 CTCTATAAATTTTTGGAACATGG - Intronic
1066586078 10:36937413-36937435 TTCTATTACTATTTGTAAAATGG - Intergenic
1068037072 10:51773938-51773960 CTATATTAGTAAGTGGAATATGG + Intronic
1069141535 10:64833174-64833196 GTCAATTTGTGTTTGGAAGAAGG + Intergenic
1069786749 10:70993130-70993152 CTTTATTCTTCTTTGGAAGAAGG - Intergenic
1071703941 10:87976434-87976456 GTCTTTAAATATTTGGAAGAAGG + Intergenic
1071738475 10:88328683-88328705 CTCTAGTATTATTTAGGAGAAGG - Intronic
1073832574 10:107402807-107402829 CTCTATTTGTAAGGGGAAGAAGG - Intergenic
1077988761 11:7382506-7382528 CACTATTAATATTTTGAAAATGG - Intronic
1078316158 11:10294489-10294511 TTCTGTTTGGATTTGGAAGAAGG + Intergenic
1079807429 11:24951191-24951213 CTTTAATAGTATTTGGCAGTTGG - Intronic
1079809598 11:24980788-24980810 CTATATGGGTATTTGGAAGAAGG + Intronic
1082695997 11:56365370-56365392 CTCTATGAGTATTTGAAAAAGGG - Intergenic
1084356425 11:68641738-68641760 CTCTCTGTGTATTTAGAAGAGGG - Intergenic
1085237454 11:75025966-75025988 ACCTATGAGTAGTTGGAAGATGG - Intergenic
1087512665 11:99117636-99117658 ATGTATTGGTATTTGGAAGTGGG + Intronic
1088489344 11:110371639-110371661 TTCAATAAGTGTTTGGAAGATGG - Intergenic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1090511730 11:127382646-127382668 CTATATTAGTACTTGAAAAAGGG + Intergenic
1092116774 12:6014496-6014518 CTCTCGAAGTATTTTGAAGATGG + Intronic
1093315460 12:17644950-17644972 CTCTATTAATATTTGCAAAGAGG - Intergenic
1095835025 12:46628504-46628526 TTATTTTAGCATTTGGAAGATGG + Intergenic
1097860473 12:64513835-64513857 CTATTCTAGGATTTGGAAGAAGG + Intergenic
1099418938 12:82428285-82428307 CTCTGTTAGTACTAGGAATAAGG + Intronic
1100653611 12:96617434-96617456 CTTGTCTAGTATTTGGAAGAAGG - Intronic
1100794144 12:98162801-98162823 CTCTATTTGTATTTGTAATAAGG + Intergenic
1100801032 12:98230621-98230643 CTACATTAATATTTGTAAGAAGG - Intergenic
1103660819 12:122514673-122514695 CAATATTATTATTTTGAAGATGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110454360 13:75673466-75673488 CTCTTTTCCTATTTGGATGAGGG + Intronic
1110458279 13:75714793-75714815 CTCTAGTAATGTTTAGAAGATGG + Intronic
1112520795 13:100093343-100093365 CTAAATTAGGATTTGGAAGAAGG + Intronic
1116760513 14:49007088-49007110 CTCTATTATTCTGAGGAAGAAGG - Intergenic
1118401419 14:65383169-65383191 CTCTACTAGCATGTGAAAGATGG - Intergenic
1120075958 14:80158684-80158706 CTCTATTGGAGTTTGGAAGGAGG - Intergenic
1124132336 15:27002099-27002121 GTCTATTTGTTGTTGGAAGAAGG - Intronic
1124208960 15:27746542-27746564 CTCCATCAGTTTTTGGAACAAGG - Intergenic
1124896950 15:33786046-33786068 CTCTATTATTAATTCCAAGATGG + Intronic
1126434767 15:48625159-48625181 CTATATTAGTATTTAGAACTTGG + Intronic
1126682561 15:51217004-51217026 GTCAATTAGAATTTGGAAGATGG - Intronic
1127224569 15:56916759-56916781 CTAGACTTGTATTTGGAAGATGG + Intronic
1128669435 15:69563430-69563452 CTCTAGTTGTATTTGGCATAAGG + Intergenic
1130114262 15:80992681-80992703 TTCTAGTACTATTTGGAAGCAGG + Intergenic
1130800327 15:87255906-87255928 ATCATTTAGAATTTGGAAGAGGG + Intergenic
1130875928 15:88014343-88014365 CTGCATAAGGATTTGGAAGAAGG - Intronic
1131503250 15:92990976-92990998 CTCAAATAGTTTTTGGAATAAGG - Intronic
1133825132 16:9271484-9271506 TGCTATTAGAGTTTGGAAGAGGG + Intergenic
1134731644 16:16467312-16467334 CACTACTAGTATTGGAAAGATGG - Intergenic
1134935808 16:18244691-18244713 CACTACTAGTATTGGAAAGATGG + Intergenic
1137470947 16:48758115-48758137 CCCTAGTATCATTTGGAAGAAGG + Intergenic
1138390440 16:56666844-56666866 CTCTATTTGTACTTGGGAGCAGG + Exonic
1138985205 16:62320023-62320045 CTGTATTTTTATTTGGAAAATGG + Intergenic
1140290669 16:73652379-73652401 CTCTATTACTGTTTGTAATAAGG - Intergenic
1141233760 16:82196500-82196522 CTTTTTTATTACTTGGAAGATGG + Intergenic
1143716621 17:8776156-8776178 CTCTGTTAGCATTTTAAAGAAGG + Intergenic
1151692360 17:75694381-75694403 TTCTATTTGTCTTTTGAAGAAGG + Intronic
1155023815 18:21922503-21922525 CTCTCTGAGTATTAGGGAGAGGG + Intergenic
1156760445 18:40582935-40582957 GTTTATTATTATTTTGAAGAGGG - Intergenic
1156920814 18:42520653-42520675 CTCAATGAGTGTTTGGAAGGTGG - Intergenic
1157047403 18:44119069-44119091 TTTCATTAGTACTTGGAAGATGG - Intergenic
1157182256 18:45508231-45508253 CTCTATTAGTATTTGGAAGAGGG + Intronic
1158217219 18:55112630-55112652 CTCTATTAGAATTTTCAAAAAGG - Intergenic
1159148393 18:64485008-64485030 CAATAGTAGAATTTGGAAGAAGG - Intergenic
1159195252 18:65105170-65105192 CTTTATCAGAATTTGGAGGAAGG - Intergenic
1159641680 18:70870569-70870591 CTTTTTTAGTATTAGGAAGTTGG - Intergenic
1159999852 18:75006768-75006790 CTCTCTCAGTATTTGGTAAATGG - Intronic
1161874251 19:6895357-6895379 TTCTATTATTATAAGGAAGAGGG + Intronic
1168342246 19:55631658-55631680 CACGACTAGAATTTGGAAGAAGG - Intergenic
925962565 2:9031882-9031904 CACAATTTGGATTTGGAAGAAGG - Intergenic
926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG + Intergenic
926571912 2:14538215-14538237 CTCTATTATAATTTTTAAGATGG + Intergenic
929039653 2:37731577-37731599 CTCTTTTAGGATTTGGAATTTGG - Intronic
930280657 2:49365350-49365372 CTTTATAAGTATTAGCAAGAAGG - Intergenic
931935994 2:67196901-67196923 CTCACTTAGTAACTGGAAGATGG + Intergenic
932107984 2:68965870-68965892 ATTTATTAGTGCTTGGAAGAGGG - Intergenic
935756240 2:106278091-106278113 CTGTATTTGTATTTGCTAGATGG - Intergenic
935898452 2:107763620-107763642 CTTTATTATTATTTTAAAGATGG - Intergenic
937051382 2:118894001-118894023 TTCTAATGGAATTTGGAAGAGGG + Intergenic
937635257 2:124148349-124148371 CTCAATTAGTTTTTGGAATGTGG - Intronic
939209780 2:139159197-139159219 CTCTATTAGTTTTTCTAATAAGG + Intergenic
939243272 2:139590559-139590581 AGCAATTAGTATTTGAAAGAAGG + Intergenic
942497001 2:176550348-176550370 CCCTAGGAGTATTTGGTAGATGG - Intergenic
944013001 2:194997042-194997064 CTCTCTTTGTGTTTGGATGATGG + Intergenic
944036201 2:195297397-195297419 CTCTATTGGTAAATGGAATAGGG + Intergenic
945021005 2:205571592-205571614 CTCTGTTGGTATTATGAAGAAGG + Intronic
946108603 2:217393905-217393927 CTCTATCCATATTTGGAAGTTGG - Intronic
1169468127 20:5859298-5859320 CATTATTGGTATTTGGGAGATGG + Intronic
1169626200 20:7572492-7572514 CTCAATTAATATTTGAATGATGG - Intergenic
1173315112 20:41936214-41936236 CTCTTTTAGTATTTGGGGGTAGG - Intergenic
1173428363 20:42962752-42962774 TTCTTTTAGTATTTGGCAGAGGG - Intronic
1174887709 20:54353828-54353850 ATCTATGAGGGTTTGGAAGAGGG + Intergenic
1175008244 20:55708856-55708878 CACTAATAGTATTTAGAGGATGG + Intergenic
1179454523 21:41489582-41489604 CTTTCTTAGTCTCTGGAAGAAGG + Exonic
1180568194 22:16692985-16693007 CTCTCAAAGTATTTTGAAGATGG + Intergenic
1182618880 22:31607299-31607321 CTCTATTACTATTTAGTAAATGG - Intronic
1203291936 22_KI270736v1_random:3155-3177 CTCTTTTAGGATTTGGAATTTGG - Intergenic
949659391 3:6260467-6260489 CTCTTTTATTATTAGGAAGCAGG + Intergenic
952208152 3:31201140-31201162 CTCTGATGGTATTTTGAAGAAGG - Intergenic
955592264 3:60550777-60550799 CTAGAATAGTATTTGGAATATGG - Intronic
955866223 3:63387582-63387604 CTCTTTCAGAATTTGGAAAATGG + Intronic
956061487 3:65352563-65352585 CTCTATTAAAATGGGGAAGAAGG - Intergenic
956686588 3:71834547-71834569 CTCAATTGGTATTTGGCAAATGG + Intergenic
956919051 3:73906941-73906963 TGCTATTAGTATATGGAAGAGGG + Intergenic
957715629 3:83926955-83926977 CTCTGTAACTATTTGGAAAATGG - Intergenic
959367916 3:105487239-105487261 CTCTATAAGGATCTGGGAGATGG - Intronic
960128494 3:114027001-114027023 CTCTTATACTATTTGGAAAATGG - Intronic
963766304 3:149339674-149339696 ATCAATTGTTATTTGGAAGATGG + Intergenic
966145973 3:176812594-176812616 CTCTATTGGTATTAGGCAGCAGG + Intergenic
967375615 3:188797152-188797174 CTGTGTTTGTATTTGCAAGAAGG - Intronic
967527901 3:190514920-190514942 CCCTCTCAGTATTTAGAAGAGGG - Intronic
968389400 4:176746-176768 GTCTAGTAGTATCTGGGAGAAGG - Intergenic
970478270 4:16447131-16447153 ATCTTTTAGTATGTGGAATAAGG + Intergenic
971486595 4:27166768-27166790 CTTTATTATTATTTTAAAGACGG - Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
972297170 4:37750970-37750992 CCGTATTTGTCTTTGGAAGAAGG - Intergenic
973949698 4:55999082-55999104 CTATATTATTTTTAGGAAGATGG + Intronic
973965546 4:56158546-56158568 CTTTATGAGTATTTTGTAGACGG + Intergenic
974116478 4:57585549-57585571 TTCTATTAGTATTTTGATAATGG + Intergenic
975191840 4:71472998-71473020 CTCGCTTTGTATTTGGAGGAAGG + Intronic
976959117 4:90944743-90944765 GACTAATAGTATTTGGTAGAAGG - Intronic
978527834 4:109683375-109683397 CTCTAAGGGTATTTGGAGGATGG + Intronic
979626967 4:122855852-122855874 CACTTTTAGTAATTAGAAGAGGG - Intronic
980517706 4:133886155-133886177 CACTTTTAGTTGTTGGAAGATGG - Intergenic
981768882 4:148283663-148283685 CTCTATTGGTTTTTAGAATATGG + Intronic
982062880 4:151622403-151622425 CTCTGTTTGAATTTGAAAGAAGG + Intronic
982280415 4:153678604-153678626 TTCTAAAAGTATTTGGAAGCGGG + Intergenic
984006396 4:174314924-174314946 CTCTCTTAGCATTTGGAATTAGG + Intronic
984847706 4:184121867-184121889 CTTTATTATTCTTTGTAAGAAGG + Intronic
985959381 5:3288361-3288383 CTCTTTTAGTATATAAAAGAAGG - Intergenic
986508421 5:8476872-8476894 CTCAAATAATTTTTGGAAGAAGG - Intergenic
986647415 5:9930900-9930922 CTCTTTCAGTATTTAGAAAAAGG - Intergenic
987629060 5:20443857-20443879 CTATATGACTAATTGGAAGAAGG + Intronic
987743824 5:21944988-21945010 CTCTCTTATTATTTCGTAGATGG - Intronic
987977591 5:25034359-25034381 ATCTCATCGTATTTGGAAGAAGG - Intergenic
989400649 5:41004565-41004587 TTCTATGCGTATCTGGAAGAGGG + Intronic
989697752 5:44223788-44223810 CTCTATTAATTTTTTGAAGAAGG + Intergenic
989985326 5:50690275-50690297 CTCCATTTCTTTTTGGAAGAAGG + Intronic
991764024 5:69955129-69955151 CTCTCTTATTATTTCGTAGATGG - Intergenic
991783301 5:70163006-70163028 CTCTCTTATTATTTCGTAGATGG + Intergenic
991843256 5:70830199-70830221 CTCTCTTATTATTTCGTAGATGG - Intergenic
993118466 5:83745859-83745881 CTCTTCTATTTTTTGGAAGAGGG + Intergenic
993400429 5:87443129-87443151 CCGGATTAGGATTTGGAAGAGGG + Intergenic
1004445921 6:15698330-15698352 CTCTATAATTATTAGGCAGAAGG + Intergenic
1004576697 6:16903101-16903123 CTCTATTGGGATTTGGCTGAAGG + Intergenic
1005217351 6:23546839-23546861 CTCTTTTATTGTTTGGAAGGTGG - Intergenic
1006465094 6:34188800-34188822 ATTTATTAGTAGTTGGAAGGCGG - Intergenic
1007279622 6:40701231-40701253 CACTATTACTAGTTGGAATAGGG + Intergenic
1007376733 6:41462081-41462103 CTCTATGAGTCTTTGGGAGAGGG - Intergenic
1007449640 6:41933085-41933107 TCCTGTTAGTATTTGGAGGACGG + Intergenic
1009995210 6:70889077-70889099 CTCTATTAACATTTGGCGGACGG + Intronic
1012789836 6:103678788-103678810 CACTAATAGGAATTGGAAGAAGG + Intergenic
1014486917 6:122010427-122010449 CTCTATGAGTATTCTGAACAAGG - Intergenic
1014520531 6:122437319-122437341 GTATATTATTATTTGAAAGAGGG + Intergenic
1017280204 6:152615321-152615343 ATTTATAAATATTTGGAAGACGG - Intronic
1021141846 7:17035398-17035420 CTCTAATAATATTTGGTAGGAGG - Intergenic
1023707005 7:42951594-42951616 CAATATTAGTATTTGCAAGGGGG - Intergenic
1023846312 7:44122738-44122760 CTCTATAAGTATACGGGAGAGGG - Intronic
1030051606 7:105542843-105542865 CTTAATTAGCATTTGAAAGAAGG + Intronic
1030219736 7:107085169-107085191 CTCTGTGATGATTTGGAAGAAGG + Intronic
1032718835 7:134533862-134533884 CTCTACTAGCATTTGCAAAAGGG - Intronic
1033022642 7:137742127-137742149 CTCTTTTCCTGTTTGGAAGAAGG - Intronic
1033557977 7:142505600-142505622 CTTTGTAAGTATTTGGAAGGTGG + Intergenic
1036143975 8:6235750-6235772 TCCTATTAGTATTTGGAACTTGG - Intergenic
1037240013 8:16766476-16766498 CTCTAGTAGCATTTTGAAGGTGG - Intergenic
1040744456 8:50624023-50624045 TTGAATTAGTATTTGTAAGAGGG - Intronic
1041159253 8:55021040-55021062 CTCTGTCAGTAATTGAAAGAAGG - Intergenic
1042063627 8:64848784-64848806 CCTTATTAACATTTGGAAGACGG - Intergenic
1042678317 8:71348487-71348509 CACTATTAGCAATTGGAAGTAGG + Intronic
1042868600 8:73377634-73377656 CTCGATTAATATTTGTCAGATGG - Intergenic
1043603167 8:81965927-81965949 CTGTGTAACTATTTGGAAGAAGG - Intergenic
1044099748 8:88120112-88120134 CTCTATTAGTATTTTTAATCAGG - Intronic
1044605920 8:94047361-94047383 CTCTAGTTGAAATTGGAAGAGGG - Intergenic
1046785093 8:118257408-118257430 CTCTATTGGTATTTTCAAAAAGG - Intronic
1048040973 8:130728462-130728484 CTGATTTAGTATTTGGAAGGTGG + Intergenic
1050846176 9:10222913-10222935 CTCTATTTGTGTTTGGTGGAGGG + Intronic
1052933226 9:34072724-34072746 CTCTATCTGTATTTGAAGGAAGG - Intergenic
1053211391 9:36231599-36231621 CTGTTTTAGCCTTTGGAAGAAGG - Intronic
1056960932 9:91122338-91122360 CTGTAATAGTATTAAGAAGAGGG - Intergenic
1058367647 9:104229322-104229344 CTCTATTAAGATTGGGAATAAGG + Intergenic
1061923077 9:133792920-133792942 CTCTATTAGGATGTTTAAGAGGG - Intronic
1190104914 X:47552942-47552964 CTCTATCAGCTTTTGAAAGAGGG - Intergenic
1191041557 X:56086759-56086781 TTCCACTAGTATTTGCAAGAAGG - Intergenic
1193032670 X:76916224-76916246 TGCTATTAGCATTTGGCAGAAGG + Intergenic
1195811412 X:108835444-108835466 CTGTATTAGACTTTGGAAGCAGG - Intergenic
1197033123 X:121842785-121842807 TTATAATTGTATTTGGAAGATGG - Intergenic
1197749569 X:129955258-129955280 CTATATTTTGATTTGGAAGAAGG + Intergenic
1198325090 X:135562567-135562589 CTCTATCAGTTTTTGAGAGAGGG + Intronic
1200912622 Y:8544517-8544539 CTGGATCAGTATTTGGAAAATGG + Intergenic
1200925662 Y:8652215-8652237 CTGGATTAGTATTTGGAAAATGG + Intergenic