ID: 1157182469

View in Genome Browser
Species Human (GRCh38)
Location 18:45509930-45509952
Sequence TCTGTTAGGCAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157182469_1157182478 4 Left 1157182469 18:45509930-45509952 CCATCCATCCTCTGCCTAACAGA 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1157182478 18:45509957-45509979 GAACCTGAAATCTGAGTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 229
1157182469_1157182477 3 Left 1157182469 18:45509930-45509952 CCATCCATCCTCTGCCTAACAGA 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1157182477 18:45509956-45509978 GGAACCTGAAATCTGAGTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 171
1157182469_1157182476 0 Left 1157182469 18:45509930-45509952 CCATCCATCCTCTGCCTAACAGA 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1157182476 18:45509953-45509975 AGGGGAACCTGAAATCTGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1157182469_1157182479 5 Left 1157182469 18:45509930-45509952 CCATCCATCCTCTGCCTAACAGA 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1157182479 18:45509958-45509980 AACCTGAAATCTGAGTGGAGGGG 0: 1
1: 0
2: 3
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157182469 Original CRISPR TCTGTTAGGCAGAGGATGGA TGG (reversed) Intronic
900365775 1:2311394-2311416 TCTGGGGGGCAGAGGATGGGCGG + Intergenic
900678096 1:3900944-3900966 GCTGTTAGCCAGGGGATGCAAGG - Intergenic
900705381 1:4077104-4077126 TTTTATAGGCAGAGCATGGATGG - Intergenic
901637881 1:10678755-10678777 TCTGTCAGGCGGGGGACGGATGG - Intronic
901901577 1:12368210-12368232 GCTGTAAAGAAGAGGATGGATGG - Intronic
901907627 1:12428042-12428064 TTTGTGAGGCGGAGGATGGTAGG + Intronic
902886348 1:19407614-19407636 TCTGGAAGGCTGAGGATTGAGGG + Intronic
903382186 1:22905076-22905098 TCTGGGAGGCGGAAGATGGATGG + Intronic
903897425 1:26617355-26617377 TCTGGGAGGCAGAGGTTGCAGGG - Intergenic
904682394 1:32238508-32238530 TCTGGGAGGCAGAGGTTGCAGGG + Intergenic
906200707 1:43958439-43958461 TCTGTGGGGCAGAACATGGATGG - Exonic
906281827 1:44559752-44559774 TCTGTGAGGCAGCAGATAGAGGG + Intronic
908756511 1:67473790-67473812 TCTTTTAGGCAGAGGCAGAAAGG - Intergenic
909475094 1:76073505-76073527 TCTGTAAGGCAGAGGAGGGAGGG + Intergenic
909883335 1:80908498-80908520 TCTGTTAGATAAAAGATGGATGG - Intergenic
910175946 1:84430319-84430341 TCTGTTAGGCAGAGAGGGTAAGG + Intergenic
913206152 1:116541049-116541071 TTTGTGAGGCTGAGGAGGGAGGG - Intronic
913364038 1:118015842-118015864 TCTGTTAAGTAGTGGATGGATGG - Intronic
913698023 1:121346766-121346788 ACTGGCAGGCAGATGATGGAAGG + Intronic
913708644 1:121455612-121455634 TGTGTTAGGCAGTGGAAGCAAGG + Intergenic
914139527 1:144933286-144933308 ACTGGCAGGCAGATGATGGAAGG - Intronic
914819844 1:151092494-151092516 TTTGGAAGGCTGAGGATGGAAGG - Intronic
915799160 1:158770285-158770307 TTGCTTAGGCAGAGTATGGAGGG - Intergenic
915946009 1:160152299-160152321 TCTGTTAGGCTTTGGAGGGAAGG + Intronic
916575034 1:166059592-166059614 ACTGTTAGGCTGAAGATGGCTGG + Intronic
916891144 1:169113674-169113696 TCTTTTAGGAAGGGGATGGAAGG - Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920485419 1:206365416-206365438 ACTGGCAGGCAGATGATGGAAGG + Intronic
920711998 1:208303969-208303991 TGTGATAGGCAGCGCATGGATGG - Intergenic
921323677 1:213969176-213969198 TGTATTAAGCAGAGAATGGAGGG + Intergenic
921676797 1:217985091-217985113 TATGTTAGGCAGAATATGGTAGG + Intergenic
922306189 1:224346659-224346681 TGTGTTTGGCACTGGATGGAAGG + Intergenic
924726588 1:246677018-246677040 TCTGAGGGGCAAAGGATGGAGGG + Intergenic
924781175 1:247149025-247149047 TCTCTGAGGCAGTGGTTGGAAGG - Intronic
1063029413 10:2217731-2217753 ACTGTCAGGCAGAGGAGAGAAGG + Intergenic
1063157784 10:3396186-3396208 TCAGTGAGACAGAGGACGGAAGG - Intergenic
1064366965 10:14717012-14717034 TCCGTGAGGCAGAGGTTGCAGGG + Intronic
1065868350 10:29933825-29933847 TCTGTGAGGAAGGGAATGGAGGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067787937 10:49264511-49264533 TGTGTGAGGCAGGAGATGGATGG - Intergenic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1068556048 10:58460159-58460181 TCTAAGAGGCAGAGGATGCAAGG + Intergenic
1068990032 10:63140640-63140662 TCTGTGAGGCCGAGGTGGGAGGG - Intronic
1068992575 10:63164832-63164854 TCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1069183498 10:65392958-65392980 GCTGTTAGCCAGTGGATAGAAGG + Intergenic
1069521550 10:69124963-69124985 CCTATGAGGCAGAGGAGGGAGGG + Intronic
1070530169 10:77330093-77330115 TTTCTCAGGCAGAGGATAGAAGG - Intronic
1071389305 10:85154839-85154861 ACTGTGAGGCAGAGGTTGCAGGG + Intergenic
1072088036 10:92099786-92099808 TCTGGGAGGCAGAGGTTGCAGGG + Intronic
1074352541 10:112751918-112751940 TGTGGTAGGCAGAGGTTGCACGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1080158810 11:29145688-29145710 TCAGGTAGGCTGAGGAGGGAGGG + Intergenic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1081940793 11:46939727-46939749 TTTGGGAGGCTGAGGATGGATGG - Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1087981838 11:104623850-104623872 TCTTTTAGACTGAGGCTGGATGG - Intergenic
1088178708 11:107083955-107083977 TCCCTTAAGCAGAGGATGGAGGG - Intergenic
1088781536 11:113138934-113138956 TATGCTAGGCAGAGACTGGAGGG - Intronic
1089421993 11:118338952-118338974 TGTGTGAGGCAGAGGAAGGAAGG + Exonic
1089676125 11:120090869-120090891 TCTGAAAGCCAGAGGATGAATGG - Intergenic
1089744399 11:120606911-120606933 TCTGTATGGCTGGGGATGGAGGG + Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090300896 11:125638403-125638425 ACTGTTAGGCTGTGAATGGAAGG + Intronic
1092868324 12:12783874-12783896 TTTGGGAGGCAGAGGAGGGAGGG - Intronic
1094742942 12:33310456-33310478 TCTGTTGGGCTGTGGATGGTGGG + Intergenic
1095715353 12:45339852-45339874 TTTGTTAGGCAAAGTATTGATGG - Intronic
1096222091 12:49836905-49836927 GCTGTAAGGCAGACAATGGATGG + Exonic
1097339265 12:58419029-58419051 TCTTTTAGGCACAGGATGGTTGG - Intergenic
1097805981 12:63965561-63965583 TTTGTTAGGCTGAGGCAGGAGGG + Intronic
1097890993 12:64777833-64777855 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1099157613 12:79198802-79198824 TCTTTTAGGAAGAGGAATGAAGG - Intronic
1099649060 12:85401090-85401112 ACTGGAAGGCTGAGGATGGAAGG + Intergenic
1101953060 12:109191287-109191309 TCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102161854 12:110775463-110775485 TCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1102834785 12:116045404-116045426 TCTGCTAGCAAGAGGATGGGAGG - Intronic
1103293734 12:119868397-119868419 TCTATTAGGCAGAGTAGGCACGG - Intronic
1103788828 12:123454760-123454782 CCTGTGAGGCAGAGGTTGCAGGG - Intergenic
1104052868 12:125208192-125208214 TCAGTTAGGCAATGAATGGAGGG + Intronic
1105211708 13:18260986-18261008 TTTGTTAGGCAGAGAGAGGAAGG - Intergenic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1108010572 13:46004290-46004312 TTTGGGAGGCAGAGGAGGGAGGG + Intronic
1108359478 13:49656218-49656240 TGTGATGGGCAGAGGATAGAAGG + Intergenic
1108714136 13:53062013-53062035 TTTGATAGGCAGAGCAAGGAAGG - Intergenic
1110155451 13:72311317-72311339 TCTGTTAGGCAGTTGCTGGAGGG + Intergenic
1111403701 13:87773745-87773767 TCTGTGAGGCGGAGGTTGCATGG + Intergenic
1112080242 13:95961333-95961355 TCTTTAAGGCAGTGTATGGATGG - Intronic
1112501285 13:99945255-99945277 TCTGTCACCCAGAGGTTGGAGGG - Intergenic
1112727695 13:102323890-102323912 TCTGTTAAGCAGTGGTTTGAAGG - Intronic
1113409548 13:110072733-110072755 GATGGTGGGCAGAGGATGGAAGG + Intergenic
1113475142 13:110575485-110575507 TGTGTCAGGGAGAGGCTGGAAGG - Intergenic
1114290816 14:21286916-21286938 TTTGGGAGGCAGAGGCTGGAAGG + Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1114944186 14:27657521-27657543 TCTGTCAGGCAGAGAAGGGGTGG - Intergenic
1115536234 14:34376046-34376068 TTTGTTGGGAAGAGGATGGTTGG - Intronic
1116652819 14:47615609-47615631 TCAGTTAGACAGAGGATAGAAGG + Intronic
1117225678 14:53656114-53656136 TCTGGAAGGCAAAGGAAGGATGG - Intergenic
1117678064 14:58175153-58175175 TGTGTGAGATAGAGGATGGAAGG + Intronic
1118014892 14:61650049-61650071 TCTGGGAGGCAGAGGTTGCAGGG + Intronic
1118249242 14:64142986-64143008 TCTGGTAGGCAGAAGATGAATGG + Intronic
1119148004 14:72333782-72333804 TCTGGCAGGGAGGGGATGGAGGG - Intronic
1119413718 14:74455770-74455792 TCTGGAAGGGAGAGGATGGGAGG - Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1125085456 15:35724478-35724500 TCTTTGTGGCAGGGGATGGAAGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125518060 15:40333954-40333976 TCTGCCAGGCAGAGGTGGGAGGG + Exonic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127784840 15:62346561-62346583 TCTGTTGGGAAGAGGGTGGTGGG + Intergenic
1128251848 15:66169325-66169347 TTTGTTGGGCAGACGGTGGAGGG - Intronic
1130702807 15:86202320-86202342 TGTGTTAGGCACAGGAGGAAGGG + Intronic
1132028970 15:98425278-98425300 TCTGATATGCAGGGGAGGGAAGG + Intergenic
1132319142 15:100912660-100912682 TGTGTTAGGCAGAAAATGAATGG - Intronic
1133111776 16:3552105-3552127 TTTGTGAGCCTGAGGATGGATGG - Intronic
1133276889 16:4644051-4644073 TCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135509873 16:23073202-23073224 TCTGTTAGGAGAAGGATTGATGG - Intronic
1136003956 16:27315585-27315607 TCTGGCAGGTAGAGGATGGGAGG + Intronic
1136551275 16:30983836-30983858 GCAGTTAGGCTGCGGATGGAAGG - Exonic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137468101 16:48729591-48729613 TCTTTTAGGAAGAAGAAGGAGGG + Intergenic
1137885215 16:52095661-52095683 TTTGCCAGGCAGAGGAAGGAAGG + Intergenic
1138418673 16:56885731-56885753 TCTGGTGGGAAGAGGATGGCAGG - Intronic
1139244055 16:65423602-65423624 ACTGTTAGGAAGAGAAAGGAGGG - Intergenic
1142340140 16:89516473-89516495 CCTGGTAGGCAGAGGTTGCAGGG + Intronic
1143442406 17:6985571-6985593 TATGTTAGGAAGATGATAGATGG + Intronic
1144301648 17:13926910-13926932 TTTGGTAGCCAGAGGATGGCTGG + Intergenic
1145793809 17:27644221-27644243 GCACTTAGGCAGAGCATGGAAGG - Intronic
1145808623 17:27751797-27751819 ACATTTAGGCAGAGCATGGAAGG - Intergenic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1147905814 17:43822407-43822429 ACTGTTGAGCAGAGAATGGAAGG - Intronic
1147920989 17:43917046-43917068 TCTGTTAGGCATGGGGGGGAAGG + Intergenic
1148336683 17:46846773-46846795 TCTGTGAGGAAGAAGAGGGAGGG + Intronic
1148497332 17:48060634-48060656 GCTGTGAGGCAGAGGAATGATGG + Exonic
1148926384 17:51089749-51089771 TCTGGTAGGCAGAGGTTGCAGGG - Intronic
1149631945 17:58133291-58133313 TGTGTTAGGCAGACAAAGGAGGG - Intergenic
1150538059 17:66065403-66065425 TCTGTTAGGCAGAGGCAGAATGG - Intronic
1150795254 17:68231587-68231609 TGTGTTAGGCAGTGCATGGTGGG + Intergenic
1151151756 17:72094187-72094209 ACAGTTAGCCAGAGAATGGATGG - Intergenic
1153956850 18:10103786-10103808 TTTGTTAGGAAGAGGAAGGGTGG - Intergenic
1154266159 18:12881011-12881033 TCTGTTAGGCAGTGGCAGGAGGG - Intronic
1155527156 18:26729067-26729089 TCTGTAGTGCTGAGGATGGAAGG - Intergenic
1155787157 18:29915213-29915235 TTTTTCAGGCAAAGGATGGAGGG - Intergenic
1156835931 18:41554548-41554570 TCTGTGAGGAGGAGGATGGCAGG + Intergenic
1157182469 18:45509930-45509952 TCTGTTAGGCAGAGGATGGATGG - Intronic
1164036154 19:21457489-21457511 TCTGGGAGGCAGAGGTTGCAGGG + Intronic
1164432959 19:28204069-28204091 TCTCTTAGGAAGGGGAAGGAAGG + Intergenic
1164478777 19:28595540-28595562 TCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1165790455 19:38488575-38488597 TCTGGGAGGCAGAGGTTGCAGGG - Intronic
1168138287 19:54366562-54366584 TCTGGGAGGCAGAGGTTGCAGGG - Intronic
924960145 2:27381-27403 TCTGTTAGGCAGAAGAAAGGTGG - Intergenic
925096005 2:1203413-1203435 TTTGGGAGGCAGAGGAGGGAGGG + Intronic
928962155 2:36938348-36938370 TCTGGGAGGCAGAGGTTGCAGGG + Intronic
929233505 2:39583957-39583979 TCTGTGAGGCAGAGGAATGTGGG + Intergenic
931228890 2:60357239-60357261 TCTGCTAGGCACAGGATGAGGGG - Intergenic
931782680 2:65592301-65592323 TCTGGGAGGCAGAGGTTGCAGGG - Intergenic
932481051 2:72039571-72039593 TGTGTTAGACAGAGGAAGGATGG + Intergenic
932728104 2:74197441-74197463 TCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934061298 2:88296621-88296643 TCTGTTAGGCAAATGAGGGCTGG + Intergenic
935301119 2:101694877-101694899 TCTGGTATGCAGAGGAGGAAAGG + Intergenic
935633321 2:105230419-105230441 TATGTGGGGCAGTGGATGGATGG + Intergenic
939999195 2:148950044-148950066 TCTGTTTGGAAGAGGACAGAGGG + Intronic
940335867 2:152526555-152526577 TCAGTTAGCCAGAGGATAGAAGG - Intronic
941010847 2:160297831-160297853 GCAGGAAGGCAGAGGATGGAGGG + Intronic
942135485 2:172920870-172920892 TCTGTCAGAAAGAGGAAGGATGG - Intronic
942160531 2:173181272-173181294 CTTGTGAGGCAGAGGATGGCAGG + Intronic
943032365 2:182700839-182700861 TCTGGAAGGCAGAGGTTGCAAGG + Intergenic
945197838 2:207253846-207253868 TCTGTAAGGCAGGGACTGGAGGG + Intergenic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
946359137 2:219208488-219208510 TGAGTTGGGCAGAGGTTGGATGG + Intronic
946626658 2:221619301-221619323 TCTGTTTGAATGAGGATGGAAGG + Intergenic
947220312 2:227785484-227785506 TCAGTCAGGCAGAGAATGAAAGG + Intergenic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947609272 2:231513364-231513386 TCTGGGAGGCAGAGGAGGGTGGG - Intergenic
947922924 2:233893883-233893905 TCTGGTAGGGAATGGATGGATGG + Intergenic
948631471 2:239305520-239305542 TCTGTCAGGCCTGGGATGGAGGG + Intronic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1169598983 20:7235417-7235439 TCTTTTATGCAGAGGATGAGTGG - Intergenic
1171339342 20:24414902-24414924 TCTGCTTGGCTGAGGATGCAGGG + Intergenic
1171457537 20:25280519-25280541 TCTGTTCAGCAGAGGATGCTTGG + Intronic
1174295167 20:49540464-49540486 GGTGTGAGGCAGAGGATGGGAGG + Intronic
1174302750 20:49594139-49594161 TCTGTTTTACAGATGATGGAAGG - Intergenic
1174450160 20:50614979-50615001 TCTGGGAGGCAGAGGTTGCAGGG + Intronic
1174597182 20:51693378-51693400 GCTGGTAGGCAGAGGAGAGAGGG + Intronic
1175028509 20:55929120-55929142 TCTTTGACGCACAGGATGGAGGG - Intergenic
1177131661 21:17264491-17264513 TTTATTGGACAGAGGATGGAGGG - Intergenic
1177894971 21:26846427-26846449 CCTGGTAGGAAGAGGAAGGAGGG - Intergenic
1178584293 21:33859721-33859743 TGTGTTTGGGAGTGGATGGAGGG + Intronic
1178885223 21:36479620-36479642 TCTGGTTGGCAGAAGAGGGAAGG - Exonic
1181053267 22:20247533-20247555 TCTGTGGGCCTGAGGATGGATGG - Intronic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181482155 22:23206981-23207003 GATGTTAGACAGATGATGGATGG - Intronic
1181510195 22:23385599-23385621 TCAGTGAGGCCGTGGATGGAGGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1181701040 22:24621387-24621409 TTTGTTAGGCAGAGAGAGGAAGG + Intronic
1181861455 22:25822383-25822405 TCTGTTTGGCAGAGGGCAGAGGG + Intronic
1183799581 22:40150763-40150785 TCTGTCAGGTTGAGGATTGAAGG + Intronic
1184668806 22:46002213-46002235 TCTGCTAGGCTGGGGATGTAGGG - Intergenic
1184928612 22:47662876-47662898 TCAGTTATGCTGAGGCTGGAGGG - Intergenic
1185235980 22:49713316-49713338 TCTCTTAGGGAGAGGAGGGGCGG - Intergenic
952620625 3:35336235-35336257 TCTGTTAGGCAGAGAATGTGAGG - Intergenic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
953979249 3:47405533-47405555 TGCATTTGGCAGAGGATGGAAGG - Intronic
954117011 3:48472642-48472664 TCTGTTGGGCAGAGGCTGCTGGG - Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
956139113 3:66127870-66127892 TCTGTGAGAGAGAGGAGGGAGGG - Intergenic
956643313 3:71434661-71434683 TGTGTAAGGAAGGGGATGGAGGG + Intronic
958040663 3:88222139-88222161 TCTGTGAAGAAGAGGAAGGAAGG - Intergenic
958844450 3:99249487-99249509 TCTGTAAGGGTGAGGATGGAAGG - Intergenic
960935538 3:122899116-122899138 TCTGTTGGGAGGAGGATGGGTGG + Intergenic
961456980 3:127029199-127029221 TCTGTCAGGGAGAGGAGGGGAGG + Intronic
961835640 3:129656294-129656316 TCTGTCAGGCAGAGGGCAGATGG + Intronic
965630774 3:170730470-170730492 TCTGTTTGGCAGAAAATGAAGGG - Intronic
968017115 3:195346951-195346973 ACTGATAGGAGGAGGATGGAAGG + Intronic
969079940 4:4610547-4610569 TGTGCCAGGCAGAGGAAGGAAGG + Intergenic
969146813 4:5131066-5131088 TCTGCTAGGCAGAGGATCCTTGG + Intronic
970004124 4:11394644-11394666 TCTATTAGGCAGAGCCTGTAAGG - Exonic
970139560 4:12967048-12967070 TGTGTTGGTAAGAGGATGGAAGG - Intergenic
970733966 4:19143724-19143746 ACAGTTAGGCAGAGAATGGGAGG - Intergenic
970799303 4:19952623-19952645 GCTGTAAGGAAGAGGATGCATGG + Intergenic
970831700 4:20347236-20347258 TCTGTTAGGTAAAGGAGGCAGGG + Intronic
970931484 4:21517307-21517329 TATGTGAGGCAGAGTAAGGAGGG - Intronic
972206511 4:36779535-36779557 TCTGGTTGCCAGAGGATGGAGGG - Intergenic
973289178 4:48453434-48453456 TGTGTGGGGCAGAGGATGTATGG + Intergenic
973864836 4:55102014-55102036 TCTGTTAGGCATTGTATTGAAGG - Exonic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
974239280 4:59224932-59224954 TCTGTTAGGCAGGGCATTGGAGG - Intergenic
974640717 4:64626270-64626292 TCTTCAAGACAGAGGATGGAGGG + Intergenic
975358264 4:73433800-73433822 TCCGTAAGGCAGAATATGGAAGG + Intronic
978152023 4:105448171-105448193 TCAGTTAGGTGGAGGATGCAAGG - Intronic
978327367 4:107574868-107574890 TTTTATAGGCACAGGATGGAGGG - Intergenic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
980626667 4:135381885-135381907 TCTTATAGGCATAGGATGGGAGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981773614 4:148338766-148338788 TCTGTTATTGGGAGGATGGAAGG - Intronic
983329979 4:166313670-166313692 TGTGTTTGGCAGAGGCTGGTGGG - Intergenic
984842466 4:184080921-184080943 TCTGTTTGGCGGAGGTGGGACGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986958820 5:13189326-13189348 TGTGTTAGGCCCAGGATGGGTGG + Intergenic
990943572 5:61228147-61228169 TCTGTTAGGAAGAGGAAGGAGGG + Intergenic
992530638 5:77648605-77648627 TGTGTTTGCCAGAGGAGGGATGG + Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
993529066 5:89003229-89003251 TCCATTTTGCAGAGGATGGATGG + Intergenic
994070190 5:95592622-95592644 ACTGTTAGGCAGAGGTTGCAGGG - Intronic
997414011 5:133711287-133711309 TGTGTGAGGCAGAGGCTAGATGG + Intergenic
999936707 5:156494430-156494452 TTTGCTAGGCAAAGGAAGGAGGG + Intronic
1002436282 5:179233923-179233945 TCTGTGAGGGAGAGGATGTTTGG - Intronic
1004037603 6:11938861-11938883 TCTGTAAGGCAGGGGGTAGATGG + Intergenic
1004468050 6:15904029-15904051 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1005361602 6:25036351-25036373 TCTGTTAGGTAGAGCTTTGATGG - Intronic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1006797515 6:36741188-36741210 TCTGTTAGGAGTAGGATGGGGGG + Exonic
1007442944 6:41879589-41879611 GCTGCTGGGCAGAGGATGGGAGG + Intronic
1008251358 6:49243943-49243965 CCTCTTAGTCAGAGAATGGAGGG + Intergenic
1010864353 6:80955246-80955268 TCTGTGAGGCATAGAATGCATGG + Intergenic
1011096668 6:83673760-83673782 TCTGATGGGCAGAGAAGGGATGG - Intronic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1011765501 6:90615403-90615425 CCTGTTAGGCAGAGGAAACAAGG + Intergenic
1012930216 6:105308963-105308985 TCTGTATAGTAGAGGATGGAGGG + Intronic
1013169899 6:107627364-107627386 TCTGTAAGGCAGAGCAGAGATGG - Intronic
1013485896 6:110595658-110595680 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1016810242 6:148253794-148253816 TCTGGAAGGCAGAGGATGCAGGG + Intergenic
1017056107 6:150436608-150436630 CCTGTTAGGCGGTGGAAGGAGGG - Intergenic
1018292760 6:162309858-162309880 TCTGGAAGGCAGAGGATGAGAGG - Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1019802909 7:3101446-3101468 TGTTTTAAGCAGAGGATAGAAGG + Intergenic
1020197730 7:6055044-6055066 GAAGTTAGGCAGAGGATGGCCGG + Intronic
1021748384 7:23767850-23767872 AATCTTAGGCAGAGGATGGTTGG - Intronic
1021909357 7:25368772-25368794 TCTGCTACACAGAGGATGTAAGG - Intergenic
1022992235 7:35720007-35720029 ACTGATAGGCTGAGGATGGCAGG - Intergenic
1023024472 7:36038352-36038374 TCTGTTAGGCAGTGGGTGCCAGG + Intergenic
1023166677 7:37349860-37349882 TCTGTTTGGCATAAGAAGGATGG - Intronic
1023594252 7:41812293-41812315 TCTGTAAGGCTGACCATGGAAGG - Intergenic
1024478902 7:49843843-49843865 TCAGTTGTGCAGAGGATGAATGG + Intronic
1025117409 7:56269937-56269959 TCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1026390438 7:69896237-69896259 TGTGTTAGGCATAGCATGCAAGG + Intronic
1026534695 7:71230014-71230036 TGTGTTAGGCAGAGGCTGCAAGG + Intronic
1026772563 7:73211678-73211700 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027013427 7:74765078-74765100 CCTGGTAGGCAGAGGTTGCAGGG - Intergenic
1027074611 7:75180955-75180977 CCTGGTAGGCAGAGGTTGCAGGG + Intergenic
1029307055 7:99628007-99628029 TCAGTGAGGCAGAGGCAGGAGGG + Intronic
1030133717 7:106225371-106225393 TTTATTTGGCAGAGGATGGATGG - Intergenic
1032690301 7:134279414-134279436 TCAGAAAGCCAGAGGATGGAGGG + Intergenic
1036654948 8:10671904-10671926 GCAGTGAGGCAGAGGAAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1039002099 8:32992999-32993021 TCTGGTAGGCAAAGGATTAATGG + Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1041050308 8:53927671-53927693 TCTGTTTGGCAGAGAATGCTGGG - Intronic
1042172005 8:66000578-66000600 TCTGTTCTTCTGAGGATGGAGGG + Intergenic
1042972713 8:74428540-74428562 TCTGGGAGGCAGAGGTTGCAGGG - Intronic
1043228312 8:77763781-77763803 TGTGTTAGGCAGTGCATGGTGGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1047397943 8:124520134-124520156 TCTGTAAAGCAGAAGATGTAAGG + Intronic
1048620638 8:136128921-136128943 TCTGTAAGGCAGATGAAGGAGGG + Intergenic
1049203585 8:141353178-141353200 TCTGATGGGCAGGGGATGGAGGG - Intergenic
1050284196 9:4084239-4084261 TGTGTTAGAGAGAGGAAGGAAGG - Intronic
1050932627 9:11349330-11349352 TCTGTCAGGCTGTGGATGGCAGG - Intergenic
1052860474 9:33435015-33435037 TCTGTTTGGGAGAGGCTGGGGGG - Intergenic
1053265655 9:36711281-36711303 TCTGGTTGGCAGATGAGGGAAGG + Intergenic
1055019878 9:71658455-71658477 TTTGGGAGGCAGAGGAAGGAGGG - Intergenic
1055028958 9:71752670-71752692 ACTGTTTGGCAGAAGATGAAGGG - Intronic
1055877262 9:80958427-80958449 TCTGATAGGCAGGAAATGGATGG + Intergenic
1055967977 9:81883837-81883859 TGTGTTGGGCAGAGGGTGGGAGG - Intergenic
1056863205 9:90206394-90206416 TCTGTGAGGCAGAGGTTGCAGGG - Intergenic
1057005605 9:91555761-91555783 TCTGGTAGGAAAAGGAGGGAGGG + Intergenic
1057386932 9:94612971-94612993 TCAGATAGGCAGAGAAAGGAAGG - Intronic
1057448386 9:95135266-95135288 TCTTTTAGTCAGAGAATGAAAGG - Intronic
1060683006 9:125582503-125582525 TCTGTTTGGATGAGGGTGGAGGG - Intronic
1061088885 9:128415421-128415443 TGTGTCAAGCAGAGAATGGAAGG + Intronic
1061152738 9:128838023-128838045 GATGCTAGGTAGAGGATGGATGG - Intronic
1062545499 9:137061684-137061706 TTTGTGAGGCAGAGGCGGGAGGG - Intergenic
1187471081 X:19570283-19570305 TCTGTGAGGCAGAGGGTAGTGGG + Intronic
1188614621 X:32142351-32142373 TCTTTTTCTCAGAGGATGGAAGG - Intronic
1189328036 X:40124989-40125011 TGGGTCAGACAGAGGATGGAGGG + Intronic
1190190049 X:48269448-48269470 CCTGGTAGGCAGAGGTTGCAGGG - Intronic
1195555098 X:106212629-106212651 TCTGCTAGGCTGAGGGTTGAGGG - Intergenic
1197985527 X:132262709-132262731 TCTGTTAGGCAGATCAAGTAGGG - Intergenic
1198456453 X:136822407-136822429 TCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1199893350 X:152109861-152109883 TCTGTCAGGAAGAGTATGGCTGG - Intergenic
1199896365 X:152131134-152131156 TCTGTCAGGAAGAGTATGGCTGG - Intergenic
1200709363 Y:6469724-6469746 CCTGTGAGGCACAGGATGAAGGG - Intergenic
1200754361 Y:6976515-6976537 TAGGTTAGGCAGACGATGGAAGG - Intronic
1200985043 Y:9295126-9295148 CCTGTGAGGCCGAGGATGAAGGG - Intergenic
1201024749 Y:9694984-9695006 CCTGTGAGGCACAGGATGAAGGG + Intergenic
1202019662 Y:20451451-20451473 TATTATAGGCACAGGATGGAGGG - Intergenic