ID: 1157186143

View in Genome Browser
Species Human (GRCh38)
Location 18:45541424-45541446
Sequence TTCATCTGTCTCCAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157186138_1157186143 6 Left 1157186138 18:45541395-45541417 CCTTTGAATCTGGTGCCCATCCT 0: 1
1: 0
2: 3
3: 16
4: 153
Right 1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243
1157186136_1157186143 21 Left 1157186136 18:45541380-45541402 CCTAGAGACAGGTTGCCTTTGAA 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243
1157186135_1157186143 25 Left 1157186135 18:45541376-45541398 CCAGCCTAGAGACAGGTTGCCTT 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243
1157186139_1157186143 -9 Left 1157186139 18:45541410-45541432 CCCATCCTAGTCCATTCATCTGT 0: 1
1: 0
2: 1
3: 31
4: 217
Right 1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243
1157186140_1157186143 -10 Left 1157186140 18:45541411-45541433 CCATCCTAGTCCATTCATCTGTC 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157186143 Original CRISPR TTCATCTGTCTCCAAAGAAC AGG Intronic
902711427 1:18242705-18242727 CTTCTCTGTCTCCAAAGAACAGG - Intronic
905047047 1:35013301-35013323 TTCATCAGGCTCCAAAGTTCAGG + Intronic
905824799 1:41019697-41019719 TTAATCTGTCCCCAGAGAGCAGG + Intronic
906725912 1:48044080-48044102 TTCCTCTGCCTCCACAGATCAGG - Intergenic
906823492 1:48953919-48953941 TTCATCTATCACCAAAGATTGGG + Intronic
906904198 1:49870938-49870960 TTCTTCTGTGTCCAAAGATGAGG - Intronic
907774649 1:57501985-57502007 TTCTTCTGTCTCCGCAGTACCGG + Intronic
908096999 1:60749631-60749653 TTCTTCTGTCTCCAAACTCCAGG + Intergenic
910825807 1:91405785-91405807 TTTATCAGTATCCAAATAACTGG - Intergenic
911248360 1:95546068-95546090 TATATCTGTCTCTAATGAACTGG + Intergenic
913413654 1:118580682-118580704 TGCATCTTCCTACAAAGAACTGG + Intergenic
913565282 1:120068008-120068030 TACATCTGTTTTCAAAGAAAAGG - Intronic
913632848 1:120725554-120725576 TACATCTGTTTTCAAAGAAAAGG + Intergenic
914285870 1:146227363-146227385 TACATCTGTTTTCAAAGAAAAGG - Intronic
914546902 1:148678116-148678138 TACATCTGTTTTCAAAGAAAAGG - Intronic
914619606 1:149392246-149392268 TACATCTGTTTTCAAAGAAAAGG + Intergenic
916584053 1:166134325-166134347 TTCATTTTTCTGCAAAGAAAGGG - Intronic
916844130 1:168631064-168631086 TTTATATTGCTCCAAAGAACAGG + Intergenic
918072086 1:181140574-181140596 TCCGTCTGTCTCCAAGGAGCTGG - Intergenic
919256506 1:195131600-195131622 TTTATCTGCCTCCAAAAAAAGGG + Intergenic
919518189 1:198553692-198553714 TTCTTCTGTCTCCAATTACCAGG + Intergenic
919843114 1:201623441-201623463 CTCATCAGGCTCCAAAGACCTGG - Intronic
919969289 1:202562944-202562966 TTTACATGTCACCAAAGAACCGG - Intronic
923319063 1:232811837-232811859 TTTGTCTGTCTCCAATGACCAGG - Intergenic
923501718 1:234570819-234570841 CTCAGATCTCTCCAAAGAACTGG + Intergenic
923558661 1:235021780-235021802 CCCATCTGGCCCCAAAGAACAGG - Intergenic
1063401256 10:5748280-5748302 TTCATCTGTTTTCAAATCACCGG - Exonic
1063887535 10:10594918-10594940 TTCATCTCTCTCCTTAGAAGAGG + Intergenic
1064965658 10:21012892-21012914 TTCATCTGTTTCCCAAGGCCTGG - Intronic
1065811012 10:29443811-29443833 TTCCTCTGTTTTCAAAGAAAAGG - Intergenic
1066681568 10:37940436-37940458 TACATCTGTCTCCATAGTAACGG - Intergenic
1067182614 10:44000364-44000386 TTCATATGTCTCTATTGAACTGG - Intergenic
1067429484 10:46233746-46233768 TTCATCTGTCACCAAAGGGTGGG - Intergenic
1068380003 10:56240370-56240392 TTCAGCTTTCTCCTAAAAACTGG + Intergenic
1069133246 10:64732031-64732053 GTCCCCTGTCTCCAAAGAAAAGG - Intergenic
1069892194 10:71658860-71658882 GTCAGCTGTCTCCAAAGTCCAGG + Intronic
1071789491 10:88939225-88939247 TTCCGCTGTCTCCAAAGCACAGG + Intronic
1071837984 10:89438845-89438867 TTCATCTTTGACCAAAGAATGGG - Exonic
1073151103 10:101312085-101312107 ATCATCTGTCTCCAAACCCCAGG - Intergenic
1076635871 10:131881524-131881546 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1077618006 11:3692669-3692691 TTCATCTGTCTTCAATGGACTGG + Intronic
1078893083 11:15574915-15574937 GTCTTCTGTCTCCAAACCACAGG - Intergenic
1080007239 11:27422899-27422921 TTCAACTGTTTCTATAGAACTGG + Intronic
1080359058 11:31491934-31491956 TTGTTCTGTCTATAAAGAACAGG + Intronic
1081165478 11:39803715-39803737 TTCATATGGCTATAAAGAACTGG + Intergenic
1081183206 11:40010302-40010324 TGCATATGTCACCAAACAACTGG - Intergenic
1085784555 11:79438848-79438870 TGCTGCTGTCCCCAAAGAACCGG - Intronic
1086918597 11:92559623-92559645 TTCCTCTGCCTCCCAAGCACTGG + Intronic
1090130996 11:124142018-124142040 TTCATCTGTTTGAAAAGCACTGG + Intronic
1096281678 12:50260576-50260598 ATCATTTTTCTCCAAAGAATTGG + Intronic
1096317966 12:50585365-50585387 TTCATCTGTCTACAAGGCACAGG - Intronic
1096681945 12:53261685-53261707 TGCCTCAGTCTCCAAAGAGCTGG + Intergenic
1097665468 12:62472912-62472934 TTTTTCTGTCACCAAAGCACAGG - Intronic
1098793203 12:74854065-74854087 AGCATGTGTCTCCAAAGAACAGG + Intergenic
1100414012 12:94352954-94352976 TTCATCTCTCTCCTAAGACTTGG - Intronic
1100762961 12:97830097-97830119 TTCAGCTGTGTCCAAGGAAAAGG - Intergenic
1103541342 12:121668686-121668708 TTGCTCTGTCTCAAAAAAACAGG - Intronic
1105513779 13:21073450-21073472 TTCATGTGTTTCCAAAGAAGAGG + Intergenic
1105932306 13:25063983-25064005 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1107715585 13:43196279-43196301 TTCCTCTGTCTTCACAAAACTGG + Intergenic
1110300155 13:73916905-73916927 TTCATCTGTCCCCAATTAACAGG + Intronic
1110467551 13:75819045-75819067 TTCATCTCACTCCAAAAACCTGG - Intronic
1113627346 13:111856812-111856834 TTCATCTGGCTCCAAACAGCAGG - Intergenic
1114052692 14:18934787-18934809 TTCATCAGTCACCAAAGTAAGGG - Intergenic
1114109866 14:19467139-19467161 TTCATCAGTCACCAAAGTAAGGG + Intergenic
1115814689 14:37151121-37151143 TTCTTCTTTCTCCAAAGAGGAGG + Intronic
1116987198 14:51233207-51233229 TTCTTCTGCCTCCAAATTACTGG - Intergenic
1117300567 14:54422122-54422144 TTCCTCTGTCTCCTGAGTACTGG + Intergenic
1117752398 14:58937561-58937583 TTCATATTTCTCCCAAGACCTGG + Intergenic
1117776094 14:59186340-59186362 TCCTTCTGTCTCCAAAGAAGTGG + Intergenic
1118068493 14:62218600-62218622 TCCATGTTTCTGCAAAGAACAGG + Intergenic
1118080808 14:62357961-62357983 TTCATCTTTCCCCAGAGGACTGG - Intergenic
1118486913 14:66223140-66223162 TTTATCTGACTCCAAAGCCCTGG - Intergenic
1119124430 14:72112459-72112481 TTCATCAGTCTCCAAAGTTCAGG + Intronic
1121036068 14:90704636-90704658 CACATCTGGCTGCAAAGAACGGG + Intronic
1121038848 14:90728635-90728657 TTCCTTTCTCCCCAAAGAACAGG + Intronic
1121162576 14:91758606-91758628 TTCTTCTGTATCCCAAGAAAAGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124788620 15:32705650-32705672 TTCATCAGTCACCAAGGATCAGG - Intergenic
1125562814 15:40650527-40650549 TTTTTCTGTTTCCAAAGAATTGG + Exonic
1126217874 15:46177316-46177338 CTCTTCTGTCCCCAAAGAATAGG - Intergenic
1126892024 15:53216633-53216655 TCTATTTGTCTCCAAAGACCAGG - Intergenic
1127017706 15:54707831-54707853 TTCAGCTGTCTTCAAAGAGGAGG + Intergenic
1127734207 15:61827176-61827198 TTCCTGTGTATCCAAAGAAATGG + Intergenic
1127860831 15:62993069-62993091 TTCATCTACCTCGAAAGAATTGG - Intergenic
1130137766 15:81196220-81196242 TCCACCTGTCTCCAAAGCCCAGG - Intronic
1130434946 15:83888582-83888604 TTCATCGGTCTCTAAGGTACCGG + Intronic
1133334039 16:4995171-4995193 GCCATCTGTCTACAAAGAACTGG + Intronic
1134416714 16:14049709-14049731 TCCATGTATCTCCTAAGAACAGG - Intergenic
1134770958 16:16809209-16809231 CTCATCCATCTCCAAGGAACAGG - Intergenic
1134792039 16:16997758-16997780 TCCATCTGACTCCTATGAACAGG - Intergenic
1136554493 16:30999863-30999885 TATATCTTTCTCCAAAGAACTGG + Intronic
1137361195 16:47817299-47817321 TACATCTGTTTCCATAGAAATGG + Intergenic
1137430341 16:48413332-48413354 TTCCTCAGCCTCCAAAGTACTGG + Intronic
1137459507 16:48647808-48647830 TCCATCTCTCTCCCAAGACCTGG + Intergenic
1137507112 16:49063749-49063771 TTCCTCTATCTCGAATGAACAGG + Intergenic
1137623115 16:49889760-49889782 TTCATCTCTCTCCTTAGACCGGG - Intergenic
1138052319 16:53792392-53792414 TTCGGCTGTTTCCAAAGCACAGG - Intronic
1138709854 16:58959178-58959200 TTCATCTTTTTCCAAAGAGAAGG - Intergenic
1140381971 16:74497388-74497410 TTCATTTGTCTCTAAAAACCAGG + Intronic
1140627873 16:76816226-76816248 TTCATCTGCCTGCAAAAATCTGG - Intergenic
1143031517 17:3970550-3970572 CTGATCTGACTCCAAAGCACAGG + Intergenic
1145999758 17:29124147-29124169 TTCATCAGTCCCCAAATACCTGG - Intronic
1149306131 17:55348367-55348389 TTCATCTGACTTCAAAGCTCAGG + Intergenic
1149466459 17:56883969-56883991 TTGATCTGTCTCCAATTCACAGG + Intergenic
1149516970 17:57288075-57288097 CAGAACTGTCTCCAAAGAACAGG - Intronic
1150170074 17:62985404-62985426 TTCATCTCTCTCCTAAGATTTGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153325947 18:3820383-3820405 TTCATCAGGAACCAAAGAACTGG + Intronic
1156879027 18:42053700-42053722 TTAACCTTTCTCCAAAGAGCTGG - Intronic
1157186143 18:45541424-45541446 TTCATCTGTCTCCAAAGAACAGG + Intronic
1157347447 18:46852630-46852652 TTCTTCTCCCTCAAAAGAACTGG + Intronic
1157881078 18:51321631-51321653 TTCTGCTGCCTCCACAGAACTGG - Intergenic
1164022784 19:21323388-21323410 TTTATGTAACTCCAAAGAACAGG + Intronic
1164523683 19:28998175-28998197 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
1164538515 19:29105275-29105297 ATCTTCTGTCTCCAGAGAAGAGG + Intergenic
1164828376 19:31301191-31301213 TTCATCCCTCTGCAAAGAAGCGG + Intronic
1165756944 19:38299065-38299087 GTCATCTGTCTCCCAAGATGTGG + Intronic
925486162 2:4334157-4334179 TTCACTTGTATCCAAAGCACAGG - Intergenic
925860635 2:8172280-8172302 TTCCTTTGCCTCCAAAGATCTGG - Intergenic
928705207 2:33941968-33941990 TCCATGTCCCTCCAAAGAACAGG - Intergenic
929239073 2:39635071-39635093 ACCATCTGTCTCCAAAGTGCAGG - Intergenic
930281256 2:49372828-49372850 TTGTTCTTTCTCCAAAGAAATGG - Intergenic
932751585 2:74374813-74374835 TGCTTCTTTCTCCAAAGAACAGG + Intronic
934230353 2:90174891-90174913 TGCATCAGCCTCCAAAGTACTGG - Intergenic
935234459 2:101126864-101126886 TTAAACTGTCTTCAAAGAATTGG - Intronic
935247819 2:101234507-101234529 GTCTCCTGTCTCCAAAGAAAAGG - Intronic
937839104 2:126507737-126507759 TTCATTTGTCAACAAAGCACTGG - Intergenic
940645372 2:156386961-156386983 CTCATCTGTTTCCTAAGCACTGG - Intergenic
941078567 2:161033984-161034006 TTCATCAGTTTCCAAAAAACAGG + Intergenic
942094521 2:172524605-172524627 TTCATGTGACTCAAAAAAACAGG + Intergenic
943320830 2:186440047-186440069 GTCCTCTGTCTCCAAAGAAATGG - Intergenic
944985712 2:205173876-205173898 TTCAACTCTCTCCAATAAACGGG - Intronic
945517942 2:210785984-210786006 TTCCTCTGGCTCCCAACAACTGG - Intergenic
946267098 2:218555008-218555030 TACTTCTCTCTCCACAGAACTGG + Intronic
947956108 2:234193084-234193106 TTCATCTTTCTTCACAGAATTGG + Intergenic
948361800 2:237426968-237426990 TTAATCTGTACCCAAAGATCTGG + Intergenic
1169702188 20:8459300-8459322 TTAATCCATGTCCAAAGAACAGG - Intronic
1171510511 20:25679800-25679822 TTCATATTTATCCAAAGAAAAGG + Intronic
1172358130 20:34293766-34293788 TGGATCTCTTTCCAAAGAACTGG - Intronic
1177154400 21:17486538-17486560 TTCTTCTGTCTCCAAGTAGCTGG - Intergenic
1180471166 22:15657161-15657183 TTCATCAGTCACCAAAGTAAGGG - Intergenic
1183897845 22:40983454-40983476 TTCATCTGTCCACAAGAAACAGG + Intergenic
1185010640 22:48311052-48311074 ATCATCTGTCTCCCATGAGCTGG + Intergenic
949391588 3:3568507-3568529 TTAATCTGTCTTCAAGGAATTGG - Intergenic
949592345 3:5507681-5507703 GTCTCCTGTCTCCAAAGAAAAGG - Intergenic
949665945 3:6339813-6339835 TCCATCTGACTCCAAAGACAAGG + Intergenic
950786631 3:15441833-15441855 TTCAGCTGTCTCCAAATGCCTGG - Exonic
951730233 3:25802459-25802481 GTCTTCTGACTCCAAAGAGCAGG + Intergenic
953789080 3:45932643-45932665 TTCATCTGCCTCCAAAGCTGTGG + Intronic
955041603 3:55322794-55322816 TTCATCAGACTCCACAGAAAAGG + Intergenic
955147434 3:56334136-56334158 TTTCTCTGTCTCCAAAGGAAAGG - Intronic
955539010 3:59954432-59954454 GTTATTTGTCTCCAAAGAGCAGG - Intronic
956141884 3:66154468-66154490 GTCTTCTGTCTCCAAAGCCCAGG - Intronic
958458419 3:94363160-94363182 GTCATATGTCTCCACAGCACTGG - Intergenic
959112850 3:102142749-102142771 TTCATAAAACTCCAAAGAACAGG + Intronic
959707620 3:109353323-109353345 TTTATCTTTCTGCAAAGAGCAGG + Intergenic
960581874 3:119287686-119287708 ATCATCTGTCTCCCAAGACTTGG + Intergenic
960834768 3:121894518-121894540 TTCACCTGTCTCCATTGAAGAGG + Exonic
963291518 3:143494767-143494789 TTCATCTGTCTTCATAGGAAAGG + Intronic
963951165 3:151202894-151202916 TTCATCTGTCTCCAAAAGACAGG - Intronic
965775082 3:172220842-172220864 TTCCTCGGCCTCCAAAGTACTGG - Intronic
966505723 3:180699212-180699234 CTTATCTGCCTCCACAGAACTGG + Intronic
966667143 3:182484248-182484270 CTCACCTGTCCCCAAAGACCAGG + Intergenic
967486382 3:190036290-190036312 TTCTTGTGTCTCCAAAGGAATGG + Intronic
968220540 3:196935332-196935354 TTCATGTGTATCCAGAGTACAGG + Intergenic
968379068 4:73327-73349 TTCATGTCCCTCCCAAGAACAGG - Intronic
971370192 4:26012856-26012878 CTCATCTGTTTTCAAAGAGCTGG + Intergenic
971884176 4:32422525-32422547 TTCATATGTCTCCTAAGATTTGG + Intergenic
973798804 4:54455857-54455879 TTTACCTGTCTCCAGAGAATGGG + Intergenic
974287363 4:59886237-59886259 TTATTCTGTCCCCAAGGAACAGG + Intergenic
974349732 4:60729588-60729610 TTCATCAAACTCCAAAGACCTGG + Intergenic
974513417 4:62875013-62875035 TTCCTCTGTCTCAAAAAAAAAGG + Intergenic
977679271 4:99781026-99781048 TTGATTTATCTGCAAAGAACAGG - Intergenic
978877732 4:113662351-113662373 TTCATGTTTCTTCAAAGAAATGG - Intronic
979633520 4:122930635-122930657 TTCATCTGTTTAAAAAGAAAAGG - Intronic
981640926 4:146942921-146942943 TTTATCTGTCTACAAATAGCTGG - Intronic
982484389 4:155950370-155950392 TTCCACTGTGTCTAAAGAACTGG - Intronic
982658391 4:158176935-158176957 ATCACCTGTCTCCTCAGAACTGG + Intergenic
983708880 4:170690272-170690294 GTCTCCTGTCTCCAAAGAAAAGG + Intergenic
984184305 4:176524031-176524053 TCCACGTGTATCCAAAGAACAGG + Intergenic
984855773 4:184194811-184194833 TCCATGTGTCTCCAGAGACCAGG - Intronic
984923047 4:184782759-184782781 TTCATCTGTCTCTCAAGAGAAGG - Intronic
986889567 5:12284864-12284886 TACATCAGTCTCCAAAGTCCAGG - Intergenic
987890074 5:23864846-23864868 GTCCGCTGTCTCCAAAGAAAAGG + Intergenic
988951099 5:36261360-36261382 CACATCTGTCTACAAAGAGCGGG - Intronic
989689662 5:44125946-44125968 ATCATCCTTCTCCACAGAACTGG + Intergenic
990616043 5:57509331-57509353 TTCATTTGTAGCCAAAGAACTGG + Intergenic
994135405 5:96280892-96280914 TTCACCTGGCTTCAAAGTACAGG - Intergenic
995979877 5:118088473-118088495 TACTGCTGTCTCCAAAGCACTGG + Intergenic
996009283 5:118463109-118463131 TTCATCTCTCTTCAAAGGACTGG - Intergenic
996642156 5:125769385-125769407 TTCATCTCTTTCCAAAGACTTGG + Intergenic
999110899 5:149120792-149120814 TTCTTCTTTCTGCAGAGAACTGG - Intergenic
999961802 5:156763854-156763876 TTCAACTGTTTCCAAATAAAAGG - Intronic
1002171695 5:177378324-177378346 AGCACCTGTCTCCAGAGAACTGG + Intergenic
1004183942 6:13406021-13406043 ATCCTCTATCTCTAAAGAACAGG + Intronic
1007204590 6:40138452-40138474 GTCCCCTGTCTCCAAAGAAGAGG + Intergenic
1008745691 6:54667294-54667316 TTCAAATGTCTTCAGAGAACAGG - Intergenic
1009531403 6:64821289-64821311 TACCTCTGTCTCCTAAGACCAGG + Intronic
1010405393 6:75499796-75499818 TTCATCTCTTTCCAAAGAGCTGG + Intergenic
1012611174 6:101222786-101222808 TCCATGTGGCTCCAAAGGACAGG + Intergenic
1014132122 6:117846516-117846538 TCCATGTGTTTCCCAAGAACAGG - Intergenic
1014435644 6:121418160-121418182 TGCCTCTGTCTCCAAAGTGCTGG - Intergenic
1014758538 6:125328940-125328962 TTCAACTTTCTCCAAAGAAAAGG + Intergenic
1016032759 6:139355068-139355090 TCCATGTTTCTGCAAAGAACAGG + Intergenic
1016642614 6:146366644-146366666 TTCATGTTTCTGCAAATAACAGG + Intronic
1016984988 6:149888417-149888439 TCCATCTCTCTCCACAGAAATGG - Intronic
1017033889 6:150250037-150250059 TTGATCCTTCTCCAAAGAGCTGG - Exonic
1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG + Intergenic
1018681292 6:166268146-166268168 TTCAGATGGCTTCAAAGAACTGG - Intergenic
1019255009 7:43999-44021 GTCAGCTGCCTCCCAAGAACAGG + Intergenic
1020603726 7:10308643-10308665 CTCACCTGTCTCCAAAGAGATGG + Intergenic
1021081381 7:16369856-16369878 TTCATCTGTCTTCACAGAGTAGG - Intronic
1021104978 7:16627625-16627647 TTCATCTGTATCTACTGAACTGG + Intronic
1021341654 7:19470816-19470838 TTTATATGTCACCAAAGAAATGG - Intergenic
1022318409 7:29265331-29265353 CTGATCTGTTGCCAAAGAACAGG + Intronic
1023018303 7:35987230-35987252 GTCATCTGTCTCCTGAGGACTGG + Intergenic
1025745367 7:64238198-64238220 TTCATGTCCCTCCCAAGAACAGG + Intronic
1027540902 7:79463968-79463990 TACATTTGTCTCCAGAGAAGAGG - Intergenic
1028101428 7:86825432-86825454 GTCTTCTGTCTCCACAGAAAAGG - Intronic
1028172046 7:87610019-87610041 TTCATCTGTGTCTCAAGAAAAGG - Intronic
1028730118 7:94137440-94137462 TTCACCTGTCTCCATAGAAAGGG - Intergenic
1028757391 7:94453138-94453160 TTCTCCTGTCTCCCAAGAACTGG - Intergenic
1030532188 7:110725396-110725418 TTCATCTATTTCCAAAGGATAGG - Intronic
1030688998 7:112513685-112513707 TTCACCTGTCTGCAAAGAGAAGG - Intergenic
1031544058 7:123031099-123031121 GTCATCTGTCTCCCAAAAAGAGG - Intergenic
1031726468 7:125246073-125246095 ATCATCTGACTCCAAAGTACTGG + Intergenic
1032062747 7:128738781-128738803 ATCATCTGTTTCCTAACAACCGG - Intergenic
1032170188 7:129578190-129578212 GTCTCCTGTCTCCAAAGAAAAGG + Intergenic
1032383670 7:131507052-131507074 TTCATCTCCCTCCCTAGAACGGG + Intronic
1032721490 7:134553894-134553916 TACATCTGTCTCCATAGTAATGG - Intronic
1032734303 7:134676830-134676852 GTCACCTGACTCCAAACAACAGG + Intronic
1033577075 7:142695726-142695748 ATCATTTGTCTCCTAAGAGCAGG + Intergenic
1033923164 7:146420416-146420438 TGCACCTGTCTCCAATGATCTGG - Intronic
1035050650 7:155997064-155997086 TTTATCAGACTCCACAGAACTGG + Intergenic
1035879464 8:3229033-3229055 CTCATCTGTCTTCAGACAACTGG + Intronic
1036094067 8:5703780-5703802 TTTATCTGACTTCAGAGAACAGG - Intergenic
1036444626 8:8810855-8810877 TTCATTTTTCTCCAAGGAAGGGG + Intronic
1036749873 8:11436786-11436808 TACATCTGTTTCCAAAGCAGGGG - Intronic
1037604221 8:20423833-20423855 TTCAGCTGTCTCCAATGAACAGG - Intergenic
1038404642 8:27312339-27312361 TTCTTGTCTCTCCAAAGATCTGG + Exonic
1039158166 8:34586588-34586610 TTCATCTGTGTCCACAGAATTGG + Intergenic
1039741091 8:40383397-40383419 TTCATCTGTCTGCAATCAGCTGG + Intergenic
1041513267 8:58674055-58674077 TTCCTCTGTCTCCCAAGGTCTGG + Intergenic
1041585588 8:59513649-59513671 TTCATCTGGCTCCAGAAAATTGG + Intergenic
1041854587 8:62436812-62436834 TTCATGTTTCTCAAAAGTACTGG + Intronic
1042312327 8:67391478-67391500 TCCACCTGCCTCCAAAGTACAGG - Intergenic
1042563562 8:70091583-70091605 TTAATCTGTTTCCAAAGGTCAGG - Intergenic
1044964241 8:97559646-97559668 GTTATCTGTCTCAAGAGAACAGG - Intergenic
1046633136 8:116641673-116641695 TTCATTTGACTCCAAATTACTGG - Intergenic
1049272770 8:141704760-141704782 CCCATCTGTCTCCAAAGAGTGGG + Intergenic
1051769438 9:20560500-20560522 TTTATCTAGCTCCAAAGAGCAGG - Intronic
1051989872 9:23139641-23139663 TTCATCTCTCACCAAAGTAAAGG + Intergenic
1052432283 9:28381988-28382010 TCCATCTGTATCCAAAGACTTGG - Intronic
1052890565 9:33695607-33695629 ATCATTTGTCTCCTAAGAGCAGG + Intergenic
1056400619 9:86223845-86223867 TTCAAATGTCTCCAAGGACCTGG - Intronic
1061643120 9:131975759-131975781 ATCAACTGGCTGCAAAGAACAGG + Intronic
1185826880 X:3259834-3259856 TTCTTCTGTCTCCTAGGAAACGG - Intergenic
1186329863 X:8520277-8520299 TACAGCTGTCTCCAAAGTGCAGG - Intergenic
1187371226 X:18708315-18708337 ATCATCTGTTTCCAAAAAAAAGG + Intronic
1190315667 X:49148960-49148982 GTCCCCTGTCTCCAAAGAAAAGG - Intergenic
1191607073 X:63074264-63074286 GTCCCCTGTCTCCAAAGAAAAGG + Intergenic
1192800440 X:74460262-74460284 TTTCTGTGTCTCCCAAGAACAGG - Intronic
1195596601 X:106698316-106698338 TTCAGCTGTGTCCAACGAAGTGG + Intronic
1195678904 X:107528997-107529019 TCCCTCTCTCTCCAAAGAAGGGG - Intronic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1197111690 X:122782430-122782452 TTCATCTGTCTATGAACAACTGG - Intergenic
1197263205 X:124337960-124337982 TTTCTCTGTCTCCAAAGCCCAGG - Intronic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1202036602 Y:20643144-20643166 GTCCCCTGTCTCCAAAGAACAGG + Intergenic