ID: 1157187077

View in Genome Browser
Species Human (GRCh38)
Location 18:45549692-45549714
Sequence CAAGGGAGTCTGCAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157187069_1157187077 18 Left 1157187069 18:45549651-45549673 CCTTGGGAGACCAAGGGACCTAG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 252
1157187070_1157187077 8 Left 1157187070 18:45549661-45549683 CCAAGGGACCTAGTGAAGTTTTG 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 252
1157187071_1157187077 0 Left 1157187071 18:45549669-45549691 CCTAGTGAAGTTTTGCAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157187077 Original CRISPR CAAGGGAGTCTGCAAGAGGA AGG Intronic
900197508 1:1384227-1384249 CAAGGGAGTGAGCAAGAGGCAGG - Intergenic
900313216 1:2044734-2044756 CGAGGGGGGCTGCAAGGGGAAGG + Intergenic
900590000 1:3455196-3455218 CCAGGGAGTTTGAAAGAGCATGG + Intronic
900620160 1:3583082-3583104 AAAGGGAGGGTGCAAGGGGACGG + Intronic
900745655 1:4359095-4359117 CACTGGAGGCTGCAAGAGGCAGG + Intergenic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
902130164 1:14253306-14253328 GAAGGGAATCTGCAAGGGTAGGG - Intergenic
902423368 1:16299437-16299459 CAAAGGTTTCTGGAAGAGGAAGG + Intronic
902434704 1:16390815-16390837 AATGGGAGTTTGCAAGGGGAGGG + Intronic
903285445 1:22274001-22274023 CATTGGAGGCTTCAAGAGGATGG + Intergenic
903514606 1:23902147-23902169 CAAGGCAGAGTGCAAGAGGCAGG - Intronic
904281917 1:29426681-29426703 GAAGGGAGGCTGCCAGAGCAGGG + Intergenic
905662788 1:39740105-39740127 CAAGGACTTCTGCAAGAGTATGG + Intronic
905873926 1:41420220-41420242 CAAGGGAGACTGCAGGAAGCTGG - Intergenic
906222089 1:44088724-44088746 CAATTTAGTCTGCAACAGGAAGG + Intergenic
908095510 1:60733121-60733143 CCAGGTAAGCTGCAAGAGGAAGG + Intergenic
908458726 1:64329026-64329048 AAAGGGGGTCTGCAAGAATATGG - Intergenic
908915566 1:69121865-69121887 CAAAGAAATATGCAAGAGGAAGG - Intergenic
909194768 1:72604655-72604677 CAAGGGATTCTTCAATAGTATGG - Intergenic
910300542 1:85702182-85702204 CAATGGATTCACCAAGAGGAAGG - Exonic
910352802 1:86318848-86318870 CCAAGGAGTCTTGAAGAGGAGGG + Intergenic
912763096 1:112386289-112386311 CAAGGGAGTCAGCAGGAGCCAGG + Intergenic
913494398 1:119415040-119415062 AAAGGGATTCTGGAGGAGGAGGG + Exonic
916070196 1:161165600-161165622 CAAGGGAGCCTCCAGGTGGAAGG - Exonic
916162660 1:161934375-161934397 GTAGGGGCTCTGCAAGAGGAAGG + Intronic
918382790 1:183973518-183973540 CAAGGGAGTAAACAAGAGAAAGG + Intronic
924289194 1:242520803-242520825 CTAGGGAGGCTGCAAGAGCAGGG + Intronic
924686862 1:246301749-246301771 GCAGGGATTGTGCAAGAGGATGG - Intronic
1063557467 10:7094426-7094448 TCAGGGAGGTTGCAAGAGGATGG - Intergenic
1064193907 10:13230198-13230220 CTAGGGAGTCTGAAGCAGGAGGG + Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065397553 10:25255925-25255947 AAATGGTGTGTGCAAGAGGAAGG + Intronic
1065766513 10:29035184-29035206 AAAGCTAGTTTGCAAGAGGAAGG - Intergenic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066479871 10:35785511-35785533 GCAGGGATTCTGGAAGAGGAGGG - Intergenic
1067432780 10:46254805-46254827 CAGGGGTCTCTGTAAGAGGAAGG - Intergenic
1067757853 10:49018710-49018732 CAAGGCACTTGGCAAGAGGAGGG + Exonic
1067984972 10:51133173-51133195 AAAGGGAATCTGCATGTGGATGG + Intronic
1068665041 10:59664790-59664812 CAAGCCAGTCTGCAATATGAAGG + Intronic
1069144120 10:64867745-64867767 TAAGGGAGTTTGCATGGGGAGGG - Intergenic
1070698985 10:78585027-78585049 CCAGGGGTTCTGGAAGAGGAGGG + Intergenic
1071960474 10:90804842-90804864 CATTGGAGGTTGCAAGAGGAAGG - Intronic
1073150557 10:101308619-101308641 CATGGGCCTCTGCCAGAGGATGG + Intergenic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073323557 10:102629780-102629802 CAAGGAAGTGAGCAAGAGGGAGG + Intronic
1073472736 10:103733187-103733209 AAGTGGGGTCTGCAAGAGGAGGG - Intronic
1073526868 10:104191271-104191293 CAATGAAGTCTGAAAGAGGAAGG - Intronic
1073787056 10:106901169-106901191 CAAGGGAGTCAGCAGGAACAGGG + Intronic
1073911278 10:108347806-108347828 CAAGAGGGTCTTCCAGAGGAAGG + Intergenic
1074046512 10:109844414-109844436 CAAGGGAGTGTGGGAGAGGAAGG + Intergenic
1074720874 10:116264105-116264127 CAAGAGAGGCTGCAGTAGGAAGG + Intronic
1076550255 10:131273388-131273410 CAAGGGACTCTCCAGGAGGCAGG - Intronic
1079247275 11:18761844-18761866 GAGGTGAGTGTGCAAGAGGAAGG + Intronic
1079961651 11:26931721-26931743 TAAGGGAGTCTGCATCATGAAGG - Intergenic
1081161427 11:39755025-39755047 AAAGAGAGTCTGCCAGAGGGTGG + Intergenic
1083457034 11:62786396-62786418 GAAGGGAGGCTGGAAGGGGACGG - Intronic
1083572473 11:63768136-63768158 CCTGGGAGTCTGAAAGAGAAAGG + Intronic
1083625328 11:64069338-64069360 CACAGGAGGCTGCCAGAGGATGG + Intronic
1083728399 11:64640355-64640377 GAAGAGAGTGTGGAAGAGGAAGG - Intronic
1085700731 11:78743632-78743654 CAAGTGAGTCTTCCAGGGGAAGG - Intronic
1086852638 11:91828416-91828438 AAGGAGAGTCTGCAAGAGCATGG - Intergenic
1090033428 11:123227620-123227642 AAAGGGAGGCTGCCTGAGGATGG + Intergenic
1091885631 12:4015278-4015300 CAAGGCAGAATGGAAGAGGAAGG + Intergenic
1092071036 12:5631613-5631635 CAGGGGAGTCTGGAAGTGGGAGG + Intronic
1095085607 12:38055239-38055261 CACGGGAGTCTGCAGAACGAAGG - Intergenic
1095440838 12:42237878-42237900 GAAGGGAGTCAGGAAGAGGCAGG + Intronic
1096183511 12:49564278-49564300 CAAGGGAGTCTGCAGGCAGAGGG - Intronic
1096233026 12:49907674-49907696 CAAGGGAGTCAGAAACAGTAAGG + Intergenic
1096411767 12:51382213-51382235 CCAGGTACTCTGCAAGAGGCGGG + Intronic
1099288252 12:80742702-80742724 AAAGGGAGACTTCAAGGGGATGG + Intergenic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1100353456 12:93806975-93806997 CAAGCAAGTCTGTAAGAGTAGGG - Intronic
1101248323 12:102906830-102906852 CAATGGAGTGGCCAAGAGGATGG - Intronic
1101797241 12:107986434-107986456 CAAGAGAGTCTGAAAGAGTGAGG + Intergenic
1103452502 12:121039142-121039164 CAAGGGTGTCTCCAAGAAGGGGG - Exonic
1105746196 13:23379088-23379110 CCAGGGAGCCTGGTAGAGGAGGG - Intronic
1105943629 13:25171532-25171554 CGTGGGGGTCTGCAGGAGGAAGG - Exonic
1106025391 13:25950927-25950949 AAAGGGAGTGTGCATGAGGTGGG - Intronic
1106045995 13:26142705-26142727 CATGGGGGACTCCAAGAGGAGGG + Intronic
1106891885 13:34254775-34254797 CAAGGGAGGCTGGAAGAGTAGGG + Intergenic
1107948305 13:45439523-45439545 CAATGGAGGTTGCCAGAGGATGG + Intergenic
1108173934 13:47773057-47773079 CCAGGCAGTCTGGACGAGGAAGG - Intergenic
1109447028 13:62454378-62454400 TAAGGGAGACTGAAAAAGGAAGG + Intergenic
1110689615 13:78416944-78416966 CTATGGAGTGTGGAAGAGGAAGG + Intergenic
1115879494 14:37899258-37899280 GAAGCCAGTTTGCAAGAGGAAGG + Intronic
1117676054 14:58155940-58155962 GAAGAGAGACAGCAAGAGGAAGG + Intronic
1118475512 14:66112622-66112644 CACAGGAGTCTCCATGAGGAGGG - Intergenic
1119638483 14:76295635-76295657 CAAGGGTGGCTGCAAGACAAGGG - Intergenic
1120723221 14:87909897-87909919 CAAGGGAGTCTGGAACATGTGGG - Intronic
1121916577 14:97841159-97841181 CAAGGGTCTCTGCATGTGGAAGG - Intergenic
1126193625 15:45905382-45905404 CAAGGGAGGCTTGAAGAGAATGG + Intergenic
1126744537 15:51812852-51812874 AAAGGGAAGCTGCAAGTGGAAGG - Exonic
1127555840 15:60086692-60086714 TAAGGGAATCGGCAAGAGAAGGG + Intergenic
1128135939 15:65263312-65263334 CAAGGATGTCTGCAACAGCAAGG + Exonic
1130060026 15:80563048-80563070 GAAGGAAGTCAGCAGGAGGAAGG - Intronic
1133438532 16:5800957-5800979 CATGGGAGGCTCCAAGAGGCAGG + Intergenic
1135472523 16:22744059-22744081 GAGGAGAGTGTGCAAGAGGAGGG - Intergenic
1137767730 16:50991102-50991124 CAAGTGAGTCTACATGAGGAAGG - Intergenic
1138176467 16:54902581-54902603 CAAAAGAGTTTGCAAGAGTAGGG + Intergenic
1141543252 16:84743387-84743409 CAAGTGAGTGTGCAGGAGGCTGG - Intronic
1143109610 17:4545753-4545775 CCTGGGGGTCTGCAAGAGGGAGG + Exonic
1146605225 17:34252141-34252163 CAAGGGAGCCTGCACTAGGTGGG + Intergenic
1147923755 17:43934195-43934217 TAAGAGAGTCTGGAAGAGCAAGG + Intergenic
1148075532 17:44933372-44933394 CAAGGGAGACGGCAGGAGGGTGG - Intronic
1148127805 17:45245847-45245869 CAAGGCAGTCTCCATGAGGGTGG - Intronic
1148584707 17:48769157-48769179 CTGAGGACTCTGCAAGAGGAGGG + Exonic
1150722958 17:67628904-67628926 AAAGGGCCACTGCAAGAGGAAGG - Intronic
1152334533 17:79692971-79692993 CTAGTGTGTCTGCAGGAGGATGG - Intergenic
1152720221 17:81919965-81919987 GAAGGGAGTGTGGAAGAGGAGGG - Exonic
1153655519 18:7278488-7278510 CAAGGCAGTCTTCCAAAGGAAGG + Intergenic
1157066716 18:44358578-44358600 CAATGGTGACTGCTAGAGGAAGG - Intergenic
1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG + Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157764042 18:50284334-50284356 CAAGGGAGTCAGGAAGTGCATGG - Intronic
1158946639 18:62452658-62452680 GAAAGGAATCTGTAAGAGGAGGG - Intergenic
1163288072 19:16361720-16361742 CCAGGGAAGCTGCAAGCGGAAGG + Intronic
1163403291 19:17107525-17107547 CAAGGGAGTCTCCAACAACAGGG + Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1166281429 19:41796756-41796778 CCTGGGAGTGGGCAAGAGGAGGG + Intronic
1166864429 19:45827413-45827435 CAAGGGAGTGTGGAAGACGTGGG + Intronic
1168383912 19:55946718-55946740 CACTGGAGTCTGCTAGAGGCTGG - Intergenic
927515463 2:23669410-23669432 CGTGGGAGCCTGGAAGAGGAGGG - Intronic
927763090 2:25778362-25778384 CAAGGAAGTCAGCAAGAAAAAGG + Intronic
929618606 2:43332298-43332320 CAAGGAAGTCTTCAGGAAGAGGG - Intronic
932035888 2:68246617-68246639 GAAGGGAGTCTTAAAGAGGAAGG - Intronic
935863428 2:107359267-107359289 TAAGGGTGTTAGCAAGAGGAAGG - Intergenic
937299907 2:120832782-120832804 CCATGGAGTCTTCAAGAGGACGG + Intronic
938378122 2:130822027-130822049 CCGGGGAGTGTGCATGAGGAGGG + Intergenic
940282862 2:152005505-152005527 CAATGGAGACTTCAAAAGGAGGG + Intronic
940890873 2:159034205-159034227 CAAGGGAGAAGGCAGGAGGAGGG - Intronic
942347837 2:175021329-175021351 CAAGGCAGTATGCAAGAGGCAGG + Intergenic
943043755 2:182833390-182833412 TAAGGAACTCTGCCAGAGGAAGG + Exonic
946964274 2:225021010-225021032 CAAGGGAGTTTGCTAAAGGCAGG + Intronic
948798284 2:240418184-240418206 CTAGGGACTTTGCAACAGGATGG + Intergenic
1168824620 20:801478-801500 CAAGGGAGTCTGGCAGAACAAGG + Intergenic
1169409569 20:5356091-5356113 CAATGGAGCCTGAGAGAGGAGGG + Intergenic
1169542304 20:6613383-6613405 CAAGGGAGGCTTGGAGAGGAGGG + Intergenic
1170107802 20:12770633-12770655 CACTGGAGTCTACAAGAGGGTGG + Intergenic
1170319841 20:15083284-15083306 AAAGGGATTCTGCAAGATGTAGG + Intronic
1170414338 20:16124094-16124116 AAAGGGAATTGGCAAGAGGAAGG - Intergenic
1173269017 20:41514699-41514721 CTAGGGAGTGTGCTAGAGAAAGG + Intronic
1173410728 20:42807392-42807414 TAAGGGAAACTGCAAGAGGTTGG + Intronic
1173552734 20:43944559-43944581 CCAGCGTGTCTGCAGGAGGAGGG - Intronic
1173927378 20:46790956-46790978 CAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1174921594 20:54708675-54708697 TAAGGGAGTGTGCAAGAGCAAGG + Intergenic
1175207004 20:57318756-57318778 CAAGGGAGGCTTCTCGAGGAAGG - Intergenic
1175661123 20:60813317-60813339 CAAGGAATTCTCCTAGAGGATGG + Intergenic
1178231049 21:30785132-30785154 CAAGGGAGTTACCTAGAGGAGGG + Intergenic
1178414470 21:32392889-32392911 CATGGGGGTCCCCAAGAGGAAGG - Exonic
1178600299 21:33988671-33988693 CAAGGGAGGCTGGAAAAGGCAGG + Intergenic
1181924283 22:26345618-26345640 CATGGGTGTCTGCAAGAAGAAGG - Intronic
1181933115 22:26418632-26418654 TCAGGGAGTTTGCAGGAGGAAGG - Intergenic
1182425673 22:30270818-30270840 CCATGCAGCCTGCAAGAGGAAGG + Intergenic
1182711014 22:32323410-32323432 CATTGGATTCTGCAAGAGGCTGG + Intergenic
1183257280 22:36770697-36770719 CAAGGGAGGCTGCCTGAAGATGG - Intronic
1183258337 22:36777572-36777594 GAGGGGAGCCGGCAAGAGGAAGG - Intergenic
1184398552 22:44260284-44260306 CATTGGATTCTGCAAGAGGCTGG + Intronic
949194185 3:1286020-1286042 GAATGGAGTCTGAAAGTGGAGGG - Intronic
950564757 3:13761962-13761984 GAAGGGTGTTTGGAAGAGGAAGG - Intergenic
953111221 3:39941087-39941109 TGAGGGAGTGTACAAGAGGAAGG + Intronic
953694793 3:45149029-45149051 CAAGGTATTCTGCAACTGGAGGG + Intergenic
954377713 3:50203814-50203836 CCAGGGTGTCTGCAAGTGGGAGG + Intergenic
955964082 3:64370146-64370168 CAAGAGAGTCAGCAAGTGCAAGG + Intronic
956167322 3:66406454-66406476 CCAGGGAGTGTGAAAGAGGCCGG - Intronic
956171397 3:66436361-66436383 TGAGGGAGTCTGCAAGAGGCGGG - Intronic
956460180 3:69463807-69463829 CAAGGAAATTTGCAAAAGGAGGG + Intronic
957771360 3:84696355-84696377 GAAGGGAGTCAGACAGAGGAAGG + Intergenic
958462653 3:94418675-94418697 CAAGGAAGGCTGCAAGTTGATGG - Intergenic
958673780 3:97239245-97239267 TAAGGGAGTCTCCTATAGGAAGG + Intronic
958921507 3:100111195-100111217 CAATGGAGGCAGAAAGAGGATGG + Intronic
959942629 3:112095514-112095536 AAGAGCAGTCTGCAAGAGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961902349 3:130225291-130225313 CAGGGGACTCTGAAAGGGGAGGG - Intergenic
962135394 3:132726300-132726322 AAAGGAACTCTGCAAAAGGAAGG + Intergenic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
964406271 3:156352243-156352265 AAAGGGAGGCAGCCAGAGGAAGG - Intronic
964528480 3:157641818-157641840 AAAGGCAGTCTGCAAGAGAATGG - Intronic
967143891 3:186589539-186589561 TAAGGGAGACTAAAAGAGGAGGG - Intronic
967685370 3:192410232-192410254 GAAGGGAGTCTGGAAGCGGAGGG - Intronic
968736575 4:2300277-2300299 CAAGGGTGACTTCGAGAGGACGG + Intronic
968877306 4:3279050-3279072 CAAGAGAGTCAGCAAGAGCAGGG - Intergenic
968962392 4:3752252-3752274 CAGTGGAGTGTGCATGAGGAAGG - Intergenic
969532335 4:7736855-7736877 CAAGGGAGCATGCAGGAGGGAGG + Intronic
972768236 4:42171495-42171517 GAAGGGAGGCTGGAAGAAGAGGG - Intergenic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
975804669 4:78099425-78099447 AAAAGGATTCTGCAAGTGGAGGG - Intronic
977704368 4:100054643-100054665 CAAGAAAGTCTTCAAGTGGAGGG - Intergenic
978021908 4:103824740-103824762 CAAGGGTGTCAGTAAGAGAAAGG - Intergenic
979957992 4:126979458-126979480 CACTGGAGTGAGCAAGAGGAGGG + Intergenic
981454057 4:144933416-144933438 AATGGCAGTCTGCAAGAAGATGG + Intergenic
981790901 4:148535666-148535688 GAATAGAGTCTGGAAGAGGAAGG - Intergenic
983196100 4:164808185-164808207 CTATGGAGTCTTCAGGAGGATGG - Intergenic
983653172 4:170053624-170053646 AAAGGGAGACTGGAAGAAGAAGG - Intergenic
984697147 4:182790599-182790621 CAGGTGAGTTTGCAAGAGGACGG - Intronic
985722502 5:1497134-1497156 CAAGAGAGTCTGGAAGAACAGGG + Intronic
985749450 5:1666040-1666062 CAAGTGAGGATGCAAAAGGACGG + Intergenic
986828703 5:11551081-11551103 CAATAGAGTGTCCAAGAGGAGGG - Intronic
987010931 5:13763826-13763848 CAAGGGAGAGTCCAAGAGCAGGG + Intronic
987730250 5:21761524-21761546 CATTTGAATCTGCAAGAGGAAGG + Intronic
990104768 5:52245203-52245225 CAAGGGAGGGACCAAGAGGAAGG + Intergenic
991618180 5:68518180-68518202 CAATGGAGTCTTCATGGGGATGG + Intergenic
992116311 5:73541382-73541404 CAAGGGAGGTGGGAAGAGGAAGG + Intergenic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
995835859 5:116399054-116399076 CATGGCAATCTCCAAGAGGAAGG - Intronic
996601634 5:125271151-125271173 CAAGAGAGTCAGCAAAATGAGGG - Intergenic
997212624 5:132086429-132086451 CAAAGGAAGCTGCAAGAGGGAGG + Intergenic
999243124 5:150138880-150138902 CCAGGGAGACTGGGAGAGGAGGG - Intronic
999995250 5:157086303-157086325 CAAGGGAATCTTCAAGATCAAGG + Exonic
1002172581 5:177383772-177383794 GAAGGGAGCCTGGAAGCGGAGGG - Intronic
1002672002 5:180875232-180875254 CAAGGGACTCTGCCACAAGAAGG - Intergenic
1002676303 5:180916111-180916133 CAAGAGAGTAAGAAAGAGGAAGG + Intronic
1003483576 6:6555341-6555363 AAAAGAAATCTGCAAGAGGATGG + Intergenic
1003511579 6:6785698-6785720 CTAGGGTGCCTGCAAGGGGAAGG + Intergenic
1007169153 6:39850265-39850287 CAAGGAAGGGTGCAAGGGGAGGG - Intronic
1007795575 6:44344082-44344104 CAAGTGTGTCTGCAACAGCAAGG + Intronic
1009776309 6:68209965-68209987 CAAAGGAGTATTAAAGAGGAGGG + Intergenic
1011238268 6:85242013-85242035 CAAGGGAGGCTGCAAAAAGGGGG - Intergenic
1011388525 6:86823862-86823884 CCAGGGAGACTGTAAGAGGAAGG - Intergenic
1012631212 6:101470063-101470085 CAAGGGACTGTCCAATAGGAAGG - Intronic
1013272259 6:108556211-108556233 CAAGGAGGCCTACAAGAGGAAGG + Intergenic
1016826416 6:148392494-148392516 CAAGGGACTCAGCAAGTGGTTGG + Intronic
1017248966 6:152259523-152259545 TAAGGTAGTATGAAAGAGGAGGG + Intronic
1017343218 6:153350639-153350661 CAAAGGAAAATGCAAGAGGAAGG - Intergenic
1019230994 6:170562923-170562945 AAAGGGAGTATGAAGGAGGAAGG - Intronic
1019447824 7:1080556-1080578 CAGAGGAGTCTGGAACAGGACGG + Intronic
1019650873 7:2157557-2157579 AGAGGGTGTCTGAAAGAGGAGGG + Intronic
1019874010 7:3792674-3792696 GATGGGAGACTGCAGGAGGAGGG - Intronic
1022276574 7:28861205-28861227 CAAGGGAGCTTGCAAAATGAAGG - Intergenic
1023929743 7:44697981-44698003 CTAGGGAGTCTGCACCAGCAGGG - Intronic
1024213717 7:47228777-47228799 GAAGGGAGGTTGCAGGAGGAGGG - Intergenic
1024769130 7:52697645-52697667 CAAGTGAGAATGCCAGAGGATGG + Intergenic
1027561145 7:79731986-79732008 CATGGGAGTCTGCCTGATGATGG - Intergenic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1028842318 7:95441758-95441780 GAAGAGAGTCTGGAAGATGAGGG - Intergenic
1031593245 7:123619404-123619426 CAAGGCAATCTCCAAGAGCAAGG - Intronic
1033613161 7:142984991-142985013 CAAGGGAGTCTGGGAGAGCATGG + Intergenic
1034079339 7:148261899-148261921 GGAGGGACACTGCAAGAGGAAGG - Intronic
1035446910 7:158949422-158949444 CCAGGGAGTAGACAAGAGGAAGG + Intronic
1035767771 8:2120492-2120514 CAAGGGGATTTGCAGGAGGATGG + Intronic
1035976235 8:4314820-4314842 CAAAGGATTTTGTAAGAGGAGGG + Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1038854759 8:31319484-31319506 CAAAGGAGACTGGAAGATGAGGG - Intergenic
1040669007 8:49664322-49664344 CATGGTAGTCTGGAAAAGGAGGG - Intergenic
1041781880 8:61585758-61585780 GAAGCAAGTCTGCCAGAGGAGGG + Intronic
1044180701 8:89190785-89190807 CACTGGAGAATGCAAGAGGAGGG + Intergenic
1045395169 8:101753630-101753652 CAAGTCAGTCTGCAAGGGTAGGG + Intronic
1045732927 8:105263162-105263184 CCAGGCAGTCTGAATGAGGAAGG - Intronic
1047526139 8:125635925-125635947 CAAAGGATTCTGCAAAAGCATGG + Intergenic
1047773434 8:128049307-128049329 CAAGGGAGAGTGAATGAGGAAGG + Intergenic
1048216226 8:132498158-132498180 CAAGGGAAACTGGAAGAGGTGGG - Intergenic
1048294870 8:133206727-133206749 CGAGGGAGGCTGCCAGTGGATGG + Intronic
1048454535 8:134565960-134565982 CAGGTGAGTCTGCAGGATGATGG + Intronic
1048814899 8:138323335-138323357 CAAGGGAGTCAGCAAAGGGTGGG - Intronic
1049831879 8:144705871-144705893 CCACAGAGGCTGCAAGAGGAGGG - Intergenic
1050233041 9:3548809-3548831 CTAGGGAGTATGCAGGAGGATGG + Intergenic
1051262750 9:15280703-15280725 CAGGGGAGTTTGCTAGAAGAGGG + Intronic
1053269584 9:36740738-36740760 CAAGGGAGACGGAAAGAGGGAGG - Intergenic
1055025667 9:71717602-71717624 CTAAGGAGTTTTCAAGAGGAAGG + Intronic
1055364479 9:75528004-75528026 CAGGGGAGTGTGCAAGGGGCAGG + Intergenic
1057279119 9:93697841-93697863 CAAGTGAGTGTTCAAGAGGGCGG - Intergenic
1057999370 9:99849416-99849438 CAAGGCAGTCTCAAAGAGTATGG + Intronic
1058414661 9:104775065-104775087 CAAGTGAGTGTTCAAGTGGAGGG - Intronic
1059277967 9:113111275-113111297 CCAGGGAGCCTGGAAGAGGAAGG + Intergenic
1059278284 9:113113276-113113298 CCAGGGAGCCTGGAAGAGGAAGG - Intergenic
1060150939 9:121287631-121287653 CAAAGCATTCTGCAAGAGAAGGG - Intronic
1062042129 9:134408974-134408996 CAAGGGCTTCTTCAAGCGGACGG + Exonic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1187656099 X:21475704-21475726 GAAGGCAGTTTTCAAGAGGAAGG + Intronic
1187880166 X:23839371-23839393 CAGGGGAGTCTGCTTGAGGCTGG + Intronic
1188209319 X:27401472-27401494 GAAGGGAAACTGCAAGAGAAAGG + Intergenic
1188482503 X:30649917-30649939 CTAGGGACTCTCCAAGAGGGAGG + Intergenic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190449933 X:50568885-50568907 AAAGGGAGTCTCCAGGAAGAAGG - Intergenic
1192594865 X:72395692-72395714 AAAGGCAGTCTGGAGGAGGAAGG + Intronic
1193239888 X:79155887-79155909 CAAAGGATTCTGCAAAGGGAAGG - Intergenic
1194142999 X:90228418-90228440 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1195538921 X:106040223-106040245 CAAGGGAGTCTGCAGAGGGAAGG - Intergenic
1199776433 X:151015876-151015898 AAAGGCTGTCTTCAAGAGGAAGG + Intergenic
1199939796 X:152613790-152613812 CAAGGCAGAACGCAAGAGGAGGG - Intergenic
1200488752 Y:3797737-3797759 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic