ID: 1157187539

View in Genome Browser
Species Human (GRCh38)
Location 18:45553298-45553320
Sequence TTGGGGCCACAGTGACATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157187539 Original CRISPR TTGGGGCCACAGTGACATAG GGG (reversed) Intronic
900532270 1:3160441-3160463 TGGGTGCCACCGTGACATTGTGG + Intronic
903849226 1:26296304-26296326 CTGGGTGCACAGTGACATACAGG + Intronic
905518009 1:38576417-38576439 TGGGCGCCACAGTGGCATACAGG + Intergenic
906676963 1:47700328-47700350 TTCAGGCCACAGTGGCCTAGTGG - Intergenic
907619274 1:55959755-55959777 TAGAGGCCACAGTGGCATAGAGG - Intergenic
907680167 1:56555603-56555625 TCAGGGACACAGTGACCTAGAGG - Intronic
910946469 1:92597175-92597197 TTGGGACCACAGAGACATTCAGG + Intronic
912337406 1:108875993-108876015 TTGGGGTCACCTTGACATGGAGG + Intronic
913217518 1:116632813-116632835 GTGGGGCCACAGAGAGAAAGGGG + Intronic
914196896 1:145452308-145452330 TTGGGTCCACAGGGAGAGAGAGG + Intergenic
914845968 1:151283530-151283552 TGGGTGCCCCAGTGACTTAGAGG - Intronic
915164062 1:153938835-153938857 TTGGGGCAACAGAGACAATGAGG + Intronic
915917604 1:159950340-159950362 TTGGTGCCACAGAGACAGGGTGG - Intergenic
917604901 1:176617282-176617304 CTGAGGCAGCAGTGACATAGGGG + Intronic
918610746 1:186487998-186488020 GTGGGGCCACAGAGAAAGAGGGG + Intergenic
919708766 1:200705259-200705281 TTGCTGCCACAGTGAAATACAGG + Intergenic
920431136 1:205919966-205919988 TAGGGGCCTTAGTGACAGAGTGG - Intronic
920937567 1:210449890-210449912 GTCGGGCCACAGGGACAGAGAGG + Intronic
922744977 1:228038491-228038513 TTGGGGCCACAGTGACCTGCAGG + Intronic
1067712331 10:48658937-48658959 TTGGAGCCACAGGGACATGGAGG + Intergenic
1067768589 10:49107960-49107982 CCGGGGACACAGTGACATTGAGG + Exonic
1074449903 10:113550743-113550765 TGGTGGCCACGGTGACATGGTGG - Intergenic
1075162519 10:120037049-120037071 TTGGGTACACAGAGACAGAGGGG + Intergenic
1076726067 10:132413885-132413907 TTGGGGCCTCAGAGACAGTGGGG + Intronic
1077320836 11:1941000-1941022 TTGGGGACACAGGGAGATGGTGG - Intergenic
1077902741 11:6502891-6502913 TGGGAGCCACATTGAGATAGAGG - Exonic
1079012183 11:16837914-16837936 GTGGTGCCCCAGTGACATAAGGG + Intronic
1081105631 11:39065387-39065409 ATGGGGACACAGAGACATAGAGG + Intergenic
1085313746 11:75531203-75531225 TTGGGGACACAGTGAGTTTGAGG + Intergenic
1086369795 11:86144991-86145013 TTGGAGCCACAGTGAAAAAGAGG - Intergenic
1086528461 11:87756355-87756377 TTGGGACCTCTGTGACATACTGG - Intergenic
1088707264 11:112474984-112475006 TTAGGGCCACAATGACAGAGTGG + Intergenic
1088735686 11:112725904-112725926 ATGGGGACACAGAGACAGAGTGG + Intergenic
1097376493 12:58849276-58849298 TTGGGACCACATTGAGATAGTGG + Intergenic
1099185878 12:79515145-79515167 CTGGGGCCATAGTGCCACAGGGG - Intergenic
1099337235 12:81377999-81378021 TTGGGGACACAGAGATATACCGG + Intronic
1100692288 12:97050934-97050956 TTGGGGGTACAGTGACATAGGGG + Intergenic
1103119769 12:118371753-118371775 TCGGGCCCCCAGTCACATAGCGG - Intronic
1104491464 12:129197219-129197241 TTTGTGCTACAGTGACAGAGTGG - Intronic
1105813830 13:24015978-24016000 TTGGCTCCACAGTGACTTGGAGG + Intronic
1105842870 13:24270630-24270652 TAGTGGCTACAGTGACATTGCGG - Intronic
1107322008 13:39199885-39199907 TTGGGGCCACTGTCTTATAGTGG - Intergenic
1110066547 13:71114197-71114219 CAGGGGACACAGTGACATAATGG - Intergenic
1112920684 13:104608447-104608469 TTGGAGTCACAGTGATGTAGGGG - Intergenic
1114387879 14:22273763-22273785 TTGAAGACACAGTGACACAGTGG + Intergenic
1115785314 14:36819054-36819076 TTGCTGCCACACTGACAGAGTGG + Intronic
1118422600 14:65623246-65623268 TTGGTTCCTCAGTGGCATAGAGG + Intronic
1118775130 14:68969086-68969108 TTGGGGTCTCAGTTATATAGTGG - Intronic
1124075448 15:26439654-26439676 TTGGGGGAAAAGTGAAATAGAGG - Intergenic
1127812192 15:62573853-62573875 ATGGGGACACAGTGGCTTAGTGG + Intronic
1129930486 15:79406462-79406484 TGGGGGCCACAGTGGCATGCTGG + Intronic
1131054091 15:89365433-89365455 GTGGGGCTACAGTGAGATGGAGG + Intergenic
1132469671 16:95046-95068 ATGTGGCCACAGAGACAGAGTGG - Intronic
1132608515 16:803469-803491 TTGGTACCACACTGGCATAGGGG + Intergenic
1133225023 16:4336984-4337006 TCTGGGCCCCACTGACATAGGGG - Exonic
1135609951 16:23857595-23857617 TTGGGGCCCAAGGGCCATAGGGG + Intronic
1136278090 16:29191426-29191448 TCTGAGCCACAGTGACACAGAGG - Intergenic
1139136275 16:64208173-64208195 TGTGGGCTACAGTGAGATAGGGG - Intergenic
1139145247 16:64316072-64316094 TAGGTGCCACAGTGAAATGGAGG + Intergenic
1139653230 16:68372974-68372996 CTGGGGCCACAGTGACAGCCCGG - Intronic
1142082466 16:88157466-88157488 TCTGAGCCACAGTGACACAGAGG - Intergenic
1143280487 17:5750679-5750701 TTGGGGGCACAGAGGCAGAGAGG - Intergenic
1144444468 17:15314404-15314426 TTAGGGTCCCAGTGACGTAGAGG - Intronic
1147264478 17:39226222-39226244 TTGGGGCCGCAGCAAGATAGCGG + Intergenic
1149148843 17:53534364-53534386 TTGAGGACACAGTGAGAAAGTGG + Intergenic
1149577574 17:57725091-57725113 TTGGGGCCAGTGTGACCCAGAGG + Intergenic
1151618335 17:75229385-75229407 TTGGGGCTACAGTTGCTTAGAGG + Intronic
1153944550 18:10007699-10007721 TTGGGGACAGTGTGGCATAGGGG - Intergenic
1154412484 18:14148883-14148905 CAGGGGCCACAGTGAGATTGAGG + Intergenic
1155741931 18:29299288-29299310 TGAGGGCCACAGTGACATTTTGG + Intergenic
1157187539 18:45553298-45553320 TTGGGGCCACAGTGACATAGGGG - Intronic
1157985202 18:52429901-52429923 TTGGGGCTACAGAGAAATAATGG + Intronic
1162961739 19:14131971-14131993 TTGGGGCCCCTGAGAAATAGGGG + Intronic
1168516309 19:57012986-57013008 TTGGGGACCCATTGACACAGGGG + Intergenic
926837160 2:17035842-17035864 TTGGGATCACAGTGACCGAGGGG + Intergenic
927040914 2:19229299-19229321 TTGTGGCCTCAGTGTCATACAGG - Intergenic
927041101 2:19231095-19231117 TTGGGGTCACAGTAACAAAATGG + Intergenic
929344121 2:40859857-40859879 TGTGGGCCCCAGTGACACAGAGG + Intergenic
929921270 2:46173287-46173309 TTTGGGCTACAGTGGCAGAGCGG + Intronic
930392209 2:50776013-50776035 TTGGGTCCACAGTAATATATTGG - Intronic
936853853 2:116933917-116933939 GTGGGGACACAGTGAAAAAGTGG + Intergenic
937915881 2:127098510-127098532 CTGGGGCCACAGTGGCCTTGGGG - Intronic
939994326 2:148906127-148906149 TTGGGGCCAGAGGGAAAAAGGGG + Intronic
944521219 2:200569437-200569459 TTGGGGCCACTGTGACTAAGGGG + Intronic
945850152 2:214996052-214996074 TTGGGGTCAAAGTCACATGGTGG - Intronic
947744570 2:232500904-232500926 TTGGGGCCACTGGGACATCTGGG + Intergenic
1170475580 20:16711014-16711036 CTGGGGCAACAGTGATCTAGAGG + Intergenic
1170789314 20:19494722-19494744 TTTGGGCTGCAGTGACTTAGAGG + Intronic
1171289738 20:23975408-23975430 GGGGGGCCACAGGCACATAGGGG + Intergenic
1174459501 20:50672632-50672654 TGGGGGCAACAGGGACACAGGGG + Intronic
1176390187 21:6159210-6159232 CTGAGGCCACAGTGAGATTGTGG - Intergenic
1176860524 21:14009373-14009395 CTGGGGCCACAGTGAGATTGAGG - Intergenic
1178217055 21:30611376-30611398 TTTGTGTCACAGTGTCATAGGGG - Intergenic
1179080258 21:38164307-38164329 GTGGGGTCACAGAGACAAAGGGG - Intronic
1179253766 21:39697517-39697539 TTAGGGCCACACTGTCATCGAGG + Intergenic
1179733279 21:43379030-43379052 CTGAGGCCACAGTGAGATTGTGG + Intergenic
1180818828 22:18810886-18810908 GTGGGGCCACAGAGAGAAAGGGG + Intergenic
1180922334 22:19527390-19527412 TTGTGTCCACAGTGCCACAGTGG + Exonic
1181205052 22:21245341-21245363 GTGGGGCCACAGAGAGAAAGGGG + Intergenic
1181967671 22:26668229-26668251 TTCTGGCCACAGTGACTTAGCGG + Intergenic
1182030170 22:27152840-27152862 TTGTGGCCACATTGACATTCAGG + Intergenic
1183194073 22:36341265-36341287 TTGGTGCCACATTGATCTAGTGG - Intronic
1185223439 22:49640364-49640386 TGGGGGCCTCAGTGCCATGGGGG - Intronic
1185365787 22:50436151-50436173 CTGGGGCCACAGTGAGATTGAGG - Intronic
1203221873 22_KI270731v1_random:50074-50096 GTGGGGCCACAGAGAGAAAGGGG - Intergenic
950264477 3:11563961-11563983 GTGAGGCCACAGGGACACAGAGG + Intronic
950704567 3:14771903-14771925 TTGGGGACCCAGTGACATGCTGG - Intronic
961009347 3:123425545-123425567 CTGGGGCCACTGGGACAGAGAGG - Intronic
961772547 3:129260591-129260613 TTGGGAGGACAGTGACAGAGAGG - Intronic
961931019 3:130532782-130532804 TTAGGGTCTCAGTGAGATAGTGG + Intergenic
962405025 3:135093225-135093247 TTGGGGACACAGAGACATGATGG + Intronic
966680664 3:182638558-182638580 TTGGAGCCACTTTGACAAAGTGG - Intergenic
967939815 3:194757089-194757111 CTGGTGCCACAGTCACATGGGGG - Intergenic
969083869 4:4640938-4640960 TTCCTGCCACAGTGACATGGGGG + Intergenic
970109203 4:12618459-12618481 TGAGGGCCACAGAGACAGAGTGG - Intergenic
970935554 4:21566058-21566080 TTGGAGCAACAGTCACATACAGG + Intronic
976138374 4:81963115-81963137 TTGGGGCCAGAGTGGGATGGGGG - Intronic
979390395 4:120120530-120120552 TTGAGGACACAGTGAAAAAGTGG - Intergenic
979987631 4:127334658-127334680 TTGGGGCCACTCTGTCATCGGGG - Intergenic
983495140 4:168435073-168435095 TTGGGAGCACAGTGACATTTTGG - Intronic
984607926 4:181806232-181806254 TTGGGGCTTCAATGACATATGGG - Intergenic
984765590 4:183398318-183398340 TTGGGGCAACAGTGACCACGTGG + Intergenic
986105297 5:4654030-4654052 TTGGAGTCACAGAGACACAGTGG - Intergenic
986247903 5:6027948-6027970 TGGTGACCACAGTGACAAAGAGG - Intergenic
986741031 5:10705346-10705368 TAGGGGTCACAGTGATCTAGTGG + Intronic
989542794 5:42637173-42637195 TTAGGGCTACAGTGGCAGAGTGG + Intronic
989855438 5:46282007-46282029 TTGGGAGCACATTGACACAGTGG - Intergenic
995839237 5:116427923-116427945 TTGGGGGCAGAGTGGCATAGAGG - Intergenic
997580635 5:135014639-135014661 TGGGGGCCACAGTGGGATACAGG + Intergenic
998769258 5:145523577-145523599 TAGGGGCCACAGAGAGATGGTGG - Intronic
999246513 5:150157843-150157865 TTGTGGCAACAGGGAAATAGGGG + Intergenic
999353719 5:150904311-150904333 ATGGGGCCACGGTGTCATGGTGG - Intronic
1001754735 5:174159620-174159642 CTGGGGCCTCAGTGACCAAGAGG + Intronic
1001866532 5:175110877-175110899 TGGGGGCAACTGTGACAGAGGGG + Intergenic
1002769614 6:279901-279923 GTGGGGACACAGAGACACAGAGG - Intergenic
1002769932 6:282119-282141 GTGGGGACACAGAGACACAGAGG - Intergenic
1003236842 6:4302522-4302544 TGGGGGACACAGTGGCAGAGGGG - Intergenic
1004054439 6:12121490-12121512 AGGGGGACACAGTGACATGGTGG - Exonic
1006704355 6:36005103-36005125 TTTAGGCCATAGTGAAATAGAGG + Intronic
1009496823 6:64359692-64359714 TTGAGGACACAGTGAGAAAGAGG - Intronic
1011047018 6:83095768-83095790 TTGGGGCCACAGTCAAATTAAGG + Intronic
1014886136 6:126783866-126783888 ATGAGGAGACAGTGACATAGAGG + Intergenic
1015302600 6:131670938-131670960 TTGGGGCCTCAATGGCAGAGTGG + Intronic
1018731791 6:166656950-166656972 TTGGGGCCCCAAGGACAGAGTGG - Intronic
1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG + Intronic
1019262000 7:86961-86983 CTGGGTCCAGGGTGACATAGGGG - Intergenic
1020781319 7:12519556-12519578 TTGGGTTCACAGTGAGAGAGTGG - Intergenic
1022339766 7:29456961-29456983 TTCAGGCCACAGTCACACAGAGG + Intronic
1027536351 7:79406996-79407018 TTGGTCCTACTGTGACATAGGGG - Intronic
1027694980 7:81399129-81399151 ATGGGGTCACAGTGAGATATTGG + Intergenic
1030084733 7:105806547-105806569 CTGGGGCCAGAGAGACAGAGTGG + Intronic
1033027508 7:137790059-137790081 TTTGTGCTACAGTGACAGAGTGG - Intronic
1034234677 7:149557404-149557426 CTTGGGCCACAGTCACAGAGTGG - Intergenic
1034239457 7:149598636-149598658 CTTGGGCCACAGTCACAGAGTGG - Intergenic
1034451234 7:151138346-151138368 CTGGGGCCCCAGTGACAGAGAGG + Intronic
1036393765 8:8348945-8348967 TTGAGGCCACAGTGGCATCTGGG + Intronic
1040523067 8:48194154-48194176 CTGGGGCCACAGTGCCACAACGG + Intergenic
1041144288 8:54856285-54856307 TTGGGGAGACAGTGACTGAGAGG + Intergenic
1041962382 8:63633497-63633519 CTGGGGCCACACTGACCTTGAGG + Intergenic
1042433305 8:68734378-68734400 GTGGGGCCACAGGAACATACAGG - Intronic
1042804742 8:72759077-72759099 TTGGGGCCACGGGGATAGAGTGG + Intronic
1043683694 8:83063496-83063518 TTGGGGCCACAGCCAATTAGAGG - Intergenic
1047052927 8:121133177-121133199 TTGTAGCCACATTGACATGGTGG - Intergenic
1051890981 9:21942618-21942640 GTGGGGACACAGTGACAAGGGGG + Intronic
1055484429 9:76743554-76743576 TTGGGGGAACAGTCCCATAGAGG + Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1059799655 9:117737477-117737499 ATGAGACCACAGAGACATAGTGG + Intergenic
1062248085 9:135580046-135580068 TTCGGGGCACAGTGACCTACAGG - Intergenic
1062697838 9:137884534-137884556 TTGGGTCCACAGGGAGAGAGAGG - Intronic
1185755610 X:2650826-2650848 TGGGGGCCAAAGGGACAGAGGGG - Intergenic
1186502801 X:10065567-10065589 TAGGGGTCACCGGGACATAGGGG - Intronic
1188613585 X:32130066-32130088 TTGAGGTCTCAGTGACATATAGG + Intronic
1190254749 X:48754116-48754138 CTGGGGCCACAGTGACTAAGGGG - Intergenic
1190483528 X:50901253-50901275 TTGGGTCCACAGTTACAAATAGG - Intergenic
1191021184 X:55862031-55862053 TTGGAGCCAGTATGACATAGTGG + Intergenic
1191224309 X:58026087-58026109 TGGGGGCCACAGTGGTATTGAGG + Intergenic
1191884185 X:65872752-65872774 ATGATGCCACAGGGACATAGGGG - Intergenic
1194455274 X:94095409-94095431 TTGGGGACACAGTATCATAGAGG + Intergenic
1194864375 X:99048261-99048283 TTGAGGCCACAGAGACACAGAGG + Intergenic
1195701791 X:107711263-107711285 CTGGCCCCACAGTCACATAGTGG - Intergenic
1196654385 X:118201767-118201789 TTGGGGCCACGATGACAAAACGG + Intergenic
1197733187 X:129829204-129829226 TGGGGGCCAGATTGACATACTGG - Intronic
1201125493 Y:10910156-10910178 CTCTGGCCACAGGGACATAGTGG + Intergenic
1201849798 Y:18466834-18466856 CTGGGGCAACACTGACATTGCGG - Intergenic
1201883520 Y:18853541-18853563 CTGGGGCAACACTGACATTGCGG + Intergenic