ID: 1157188021

View in Genome Browser
Species Human (GRCh38)
Location 18:45557275-45557297
Sequence TTGCAGAAACAGTTAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157188021 Original CRISPR TTGCAGAAACAGTTAGAGAA TGG (reversed) Intronic
907971340 1:59384576-59384598 TTGCCAAAACTGATAGAGAAAGG - Intronic
909404800 1:75276133-75276155 TTGGAGAAAGAATTAGACAAAGG - Intronic
911152818 1:94611331-94611353 TTGCAGAAACAATAAGACATTGG + Intergenic
912334618 1:108850677-108850699 TTACAGAAAAAGAGAGAGAATGG + Intronic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912587755 1:110782263-110782285 TTGCAGAATCTGTTTCAGAAAGG - Intergenic
912670298 1:111619112-111619134 TTGCAGAAACAGTGAAAGGCCGG - Intronic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
919170923 1:193953075-193953097 TTTCAGAAACTGTCAGGGAAAGG - Intergenic
919562313 1:199137140-199137162 TTGAAGAAAGTGTTAGAGAAAGG - Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920508899 1:206536366-206536388 TTCCAGACACTGTTACAGAAAGG + Intronic
920827999 1:209440026-209440048 GTGGAGAAAAAGTTAGACAAGGG - Intergenic
921627931 1:217399114-217399136 TTGCAGAAAAAGATAGTCAAAGG + Intergenic
922139441 1:222867914-222867936 TTGCAGAAGGAGTTAGTGAGAGG + Intergenic
922143534 1:222915137-222915159 TTGCAAATACAGTCAGAGATTGG + Intronic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
1063101317 10:2952654-2952676 TTGCACAGAAAGTAAGAGAAAGG + Intergenic
1063210983 10:3881177-3881199 TTTCAAAGACAGTTTGAGAAAGG + Intergenic
1063758537 10:9044184-9044206 ATTTAGAAAAAGTTAGAGAAAGG - Intergenic
1064794125 10:18992061-18992083 TTGAAGAAACAGGCAAAGAAGGG + Intergenic
1067158789 10:43805022-43805044 TTCCAGAAACTGTTGCAGAAAGG + Intergenic
1068075213 10:52245212-52245234 CTACAGAAACAGTTTGAAAAAGG - Intronic
1070271882 10:74964500-74964522 CTGAAGAAACATTTAGGGAATGG - Intronic
1070587142 10:77775003-77775025 TTGCAGCAGCTGTTAGGGAAGGG - Intergenic
1070670740 10:78375634-78375656 TAGCAGAAACAGTGATAGAAGGG + Intergenic
1071178175 10:82951956-82951978 TTTCAGAAATAGATAGATAATGG - Intronic
1071411092 10:85396803-85396825 TTTCTGAAACAGTTTGTGAAAGG - Intergenic
1074260240 10:111846349-111846371 TAGAAGAAAAAGGTAGAGAAAGG - Intergenic
1074994270 10:118742459-118742481 TTGATGAAACTGTAAGAGAAAGG - Intronic
1076777367 10:132705187-132705209 TTGCAGACACAGTTACCGACAGG + Intronic
1076886545 10:133265414-133265436 TTGCAGAAATAGTCCTAGAAGGG - Intronic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1079281334 11:19089718-19089740 TGGCTGAAACATTCAGAGAAGGG + Intergenic
1080766414 11:35301383-35301405 TTCCAGAAAGACTTTGAGAAAGG - Intronic
1081132520 11:39397675-39397697 TTGTAGAAGGAGTTAGAGAGGGG + Intergenic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1083197581 11:61098047-61098069 TTGAAGATATAGTTAGAGATAGG + Intergenic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084388032 11:68856271-68856293 TTGTAGATACAGTTCTAGAACGG + Intergenic
1084593413 11:70103467-70103489 TTGCAGACACAGTTACAGTTCGG + Intronic
1085549314 11:77353292-77353314 CTGCAGTGACAGTGAGAGAACGG - Intronic
1087716577 11:101615018-101615040 TAGCAGCAACAGTAAGACAACGG - Intronic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1090536255 11:127645120-127645142 TAGCAGAAATAATTAAAGAAAGG + Intergenic
1091096681 11:132829506-132829528 TTGCAGACAGTGTTTGAGAAGGG + Intronic
1091840066 12:3614434-3614456 TTTGAGAAACATTTAGAAAATGG + Intronic
1092081852 12:5723179-5723201 TAGCAGAGGCAGTTAGGGAATGG - Intronic
1092869035 12:12788999-12789021 TTGTAGAAACTGGTACAGAAAGG + Exonic
1094438655 12:30450628-30450650 TTGCAGAAAGAGTGAGAAAACGG - Intergenic
1094459524 12:30679425-30679447 TGGCAGAAACAGCTAGAAATTGG - Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095153940 12:38829843-38829865 TCCCAGTAACACTTAGAGAAAGG + Intronic
1095602521 12:44029608-44029630 TTGCAGAAAGAGAGAGAGAGAGG - Intronic
1096266711 12:50129034-50129056 TTGCAGAAACATTCAGCGAAAGG - Intergenic
1098471629 12:70851526-70851548 TTGCAGAAACAAGGAGAGATAGG - Intronic
1099267024 12:80461227-80461249 TGGCAATAACAGTGAGAGAAGGG - Intronic
1099417851 12:82415688-82415710 TAGGACAAAAAGTTAGAGAAAGG - Intronic
1102442869 12:112977092-112977114 TTGCAGTAAAAGTTGGATAAGGG + Intergenic
1103240313 12:119407797-119407819 TTGCCCAAACAGTTAGCAAATGG + Intronic
1104409707 12:128547844-128547866 TTGAAGAAACAGCTACAGATGGG - Intronic
1106833807 13:33612766-33612788 TTGCAGAAAATATCAGAGAATGG + Intergenic
1109288826 13:60447716-60447738 TAGTAGAAACAGTCAGAGAAGGG - Intronic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109650741 13:65322278-65322300 TTACAGATACAGATAGGGAAAGG + Intergenic
1110651605 13:77948754-77948776 TTGCAGTAAATGGTAGAGAAGGG - Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1111428294 13:88119072-88119094 TTGCTGAAACATCTAGAAAAAGG - Intergenic
1111974618 13:94952429-94952451 TTGGAGAAACTTGTAGAGAAAGG - Intergenic
1112299430 13:98216764-98216786 TTGTGGAAACAGCTACAGAATGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116072418 14:40065338-40065360 TTCCAGAAACATTTATACAATGG - Intergenic
1116976121 14:51117862-51117884 TTCAAGTAACAGTGAGAGAATGG - Intergenic
1118556058 14:67023851-67023873 TTGCAAAAACAATTAGATTAAGG - Intronic
1118740777 14:68737877-68737899 CTGCAGAAATAGCTAGAGATTGG - Intergenic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1123077309 14:105674566-105674588 TTCCAGAAAAAATTAGATAATGG + Intergenic
1123173244 14:106393855-106393877 TTTTTGAAAAAGTTAGAGAATGG - Intergenic
1124571561 15:30869074-30869096 TTACAGAAAAATTAAGAGAAAGG - Intergenic
1124709330 15:31992618-31992640 ATGCTAAAACAGGTAGAGAAAGG - Intergenic
1125824666 15:42666227-42666249 TTGGAAACACATTTAGAGAATGG + Intronic
1126199531 15:45970108-45970130 TTGGAAAAAGAGGTAGAGAAGGG - Intergenic
1127169653 15:56287707-56287729 TTACAGAAACAGAGAGAAAATGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128597998 15:68970679-68970701 TGGCAGAAACAGTAATAGACTGG - Intronic
1130797569 15:87226185-87226207 TTGCAGAATCTATCAGAGAAAGG - Intergenic
1131667351 15:94584797-94584819 TTGCTGAAATAGCTGGAGAATGG - Intergenic
1133636098 16:7667155-7667177 TTCCAGAGACTGTTAGAGACAGG - Intronic
1133845652 16:9451193-9451215 TTGCAGAACCATTTACATAATGG + Intergenic
1134612495 16:15620664-15620686 TTCCAGAAAAATTTAAAGAAAGG + Intronic
1135497729 16:22967138-22967160 CTGCAGAATCTGTTAAAGAAAGG - Intergenic
1137228031 16:46533827-46533849 TTACCAAGACAGTTAGAGAAAGG - Intergenic
1141725073 16:85782596-85782618 TTGAAGAAACAGTCATGGAAGGG - Intronic
1143679875 17:8468369-8468391 TTCCAGGAGCAGTTTGAGAATGG + Intronic
1145850879 17:28094874-28094896 TTGCAGAGAAAGTCAGAGAAAGG - Intronic
1146455101 17:33003774-33003796 TTGCAGAATCAGTGAGTGAATGG + Intergenic
1146757586 17:35447419-35447441 ATGCAGAAACATGTAGAGAGAGG + Intronic
1150599568 17:66639026-66639048 TTGGAGAAACCCTGAGAGAAAGG + Intronic
1150956973 17:69869953-69869975 TTGAAGAAAGAGTTACTGAAAGG + Intergenic
1151002542 17:70394802-70394824 TTGGAGAAAAAGTAAGACAAGGG - Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1153323354 18:3794233-3794255 ATGCTGCCACAGTTAGAGAAGGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156225611 18:35103899-35103921 TTGAGGAAAAAGTTGGAGAAAGG + Intronic
1156249537 18:35339296-35339318 TTGCATAAATACTTAGAAAAAGG + Intronic
1156933130 18:42669393-42669415 TCACAGAAACCTTTAGAGAAAGG - Intergenic
1157011039 18:43649154-43649176 TTGCAAAGAAAGTTAGATAAGGG + Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1158056995 18:53293249-53293271 TTTCTGAATCATTTAGAGAAAGG - Intronic
1159901085 18:74046431-74046453 TTGCACAACCAGTTAGGCAATGG - Intergenic
1162023350 19:7879032-7879054 GGGCAGAATCAGTTAGAGCAGGG + Intergenic
1165152377 19:33768401-33768423 TTTTAGAAATAGTTAGAGATGGG - Intronic
1165544875 19:36526974-36526996 TTGCTGAAACAGGTACAGAGGGG + Intronic
1167576200 19:50319022-50319044 TTGCTGAAACAGTGAATGAATGG + Intronic
1167686793 19:50961619-50961641 TTACAGAGACAGATAGAGACAGG - Intronic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925980657 2:9174415-9174437 AGGCAGAAACATTAAGAGAAAGG + Intergenic
926032486 2:9604127-9604149 GAGCAGAAACACTGAGAGAACGG + Intronic
926222601 2:10946082-10946104 ATGCAGAAATTGTTAGGGAAGGG + Intergenic
926805941 2:16711060-16711082 TTGAATAAATAGTTAGATAAGGG + Intergenic
926828845 2:16937580-16937602 GTGCAGAAGCAGTTATAGATAGG + Intergenic
926858724 2:17285175-17285197 TTGTCTAAACAGTAAGAGAAGGG - Intergenic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
930507125 2:52297211-52297233 GTGCAAATACAGTTTGAGAAAGG + Intergenic
930568649 2:53056081-53056103 TTGCAGGAATAGTAATAGAAAGG - Intergenic
930969638 2:57379213-57379235 TTCCAGAAGAAATTAGAGAAGGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931051417 2:58419099-58419121 GTGCAGGAACAGTAAGTGAAAGG - Intergenic
932403974 2:71501244-71501266 TTTCAGAAAGGGTTAGAAAATGG + Intronic
935122898 2:100197857-100197879 AGGCAGAAACAGTGAGAGATGGG + Intergenic
936097411 2:109541588-109541610 TTTCAGAAGCAGTTAAGGAATGG - Intergenic
938189093 2:129258163-129258185 TTGAAGAATGAGGTAGAGAATGG + Intergenic
938767733 2:134471789-134471811 ATGCATAAACAGTTGGAGAGAGG + Intronic
939138549 2:138325215-138325237 ATGAAGAACCAGTTACAGAACGG - Intergenic
939876057 2:147579388-147579410 TTAGAGAAAGAGTAAGAGAATGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940956243 2:159731410-159731432 TAGAAGAAACAGTTTGAAAACGG - Intronic
941254921 2:163217017-163217039 TTGCAGAAACAGAAAAAAAAGGG + Intergenic
943195790 2:184747161-184747183 AAGCAGAAAAGGTTAGAGAATGG - Intronic
943642240 2:190372214-190372236 TTGCAGAGACAGGGAGAGACAGG + Intergenic
943763032 2:191630515-191630537 CTGCAGAAAGGGTTAGATAAGGG - Intergenic
944060460 2:195566435-195566457 TTCCAGCTACAGTAAGAGAAGGG + Intergenic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944628439 2:201596732-201596754 TTCTGGAAACAGTAAGAGAAAGG - Intronic
944678736 2:202056388-202056410 TTGAAGAAACAGGTACTGAATGG - Intergenic
945492565 2:210473814-210473836 TTGCAGAAATTGTTAAATAATGG - Intronic
945564602 2:211381639-211381661 TAGTAGACACAGTTAGATAAAGG + Exonic
945946566 2:216001087-216001109 ATGCAGAGACAGCTAGAGAGAGG - Intronic
946471294 2:219963672-219963694 TTGCAGAAAAGGAAAGAGAAAGG - Intergenic
947897220 2:233686860-233686882 ATGCAGAAAAAGTGACAGAAAGG - Intronic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948675886 2:239596428-239596450 ATGCAGAAATTGCTAGAGAAGGG + Intergenic
948719806 2:239892351-239892373 TTTCAGGTACTGTTAGAGAAAGG - Intergenic
1169001917 20:2174156-2174178 TTCCAGGAACAGCTAGAGGAAGG + Intronic
1169484407 20:6014882-6014904 ATGCAGATACAGTCAGAGTATGG + Intronic
1170395202 20:15918706-15918728 TTACAGCAACAGCTTGAGAAAGG - Intronic
1170417587 20:16160902-16160924 TTTCAGAAAAAGATAGATAATGG - Intergenic
1172285313 20:33736253-33736275 TTGCAGAGGCAGTTTCAGAATGG - Intronic
1173043504 20:39488212-39488234 CTGCTGAAAAAGTTAAAGAAAGG + Intergenic
1176690113 21:9896398-9896420 TTACAGAAACCTTTAGAGAAGGG - Intergenic
1177033410 21:16011580-16011602 TTTCAGATACAGTCACAGAAGGG + Intergenic
1177168962 21:17634505-17634527 TTGCAGATGTAGCTAGAGAAAGG + Intergenic
1177751499 21:25290524-25290546 TTTAACAAACAGTAAGAGAATGG + Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180025222 21:45156960-45156982 TGGCAGACACTGCTAGAGAATGG - Intronic
1180930186 22:19584918-19584940 ATTCAGAAACAGCTAGAAAATGG - Intergenic
1181180431 22:21064116-21064138 TTCCAGAAACAGGAAGATAATGG - Intronic
1181721913 22:24781895-24781917 TATCAGAAACAAATAGAGAAAGG + Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
949102645 3:164579-164601 TTGGAGAAACAGTGAAAAAAAGG + Intergenic
949568365 3:5266607-5266629 TTGCAGAAATACTTATAAAATGG + Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
956807768 3:72834066-72834088 ATGCTGAATCAGTTAGAGATAGG + Intronic
957015520 3:75059635-75059657 TAGGAGAAACATTTAAAGAAAGG + Intergenic
957314924 3:78564692-78564714 TGCCAGAAACAGTAGGAGAAAGG + Intergenic
957392242 3:79591441-79591463 TTACAGAAAAATTTAGAGAGAGG - Intronic
957617324 3:82547424-82547446 TTCCAGACACAGATAGACAAAGG + Intergenic
959550308 3:107648396-107648418 TTGCATACAGAATTAGAGAAAGG + Intronic
960195357 3:114760502-114760524 TTCTAGTAACAGTTTGAGAAAGG - Intronic
960417627 3:117404170-117404192 TTGCAGAGACACTTTCAGAATGG - Intergenic
960789292 3:121410093-121410115 TTCTAAAAACAGTTTGAGAAAGG - Intronic
962481665 3:135803301-135803323 TTTCAGAACCAGTAAGACAAAGG - Intergenic
963536849 3:146540112-146540134 TTTCAGAAATACTCAGAGAAAGG + Intronic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
965381103 3:167989625-167989647 TTTGAGAAACATTCAGAGAATGG + Intergenic
965947299 3:174258952-174258974 TTACAGAAACATTTAAAAAATGG - Intronic
966290659 3:178353942-178353964 ATGCAAGCACAGTTAGAGAAAGG + Intergenic
967210407 3:187163209-187163231 TTGCTTTAACAGTTAGAGATGGG + Intronic
967608581 3:191477792-191477814 TTTCAAGAACACTTAGAGAAGGG + Intergenic
968351056 3:198052383-198052405 ATGCAGAACCATGTAGAGAAAGG + Intergenic
968531541 4:1094455-1094477 AGGAAGAAACAGGTAGAGAATGG + Intronic
970099043 4:12499729-12499751 TTGGAGAAACAGATAGTTAATGG - Intergenic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970657871 4:18251475-18251497 TTGCTGAAACTATTAGAAAAGGG + Intergenic
971201014 4:24509217-24509239 TTGCAGATATGGTTAGATAAAGG - Intergenic
972672129 4:41222869-41222891 TGGCAGGAACAAATAGAGAAAGG - Intergenic
972836886 4:42882043-42882065 GTACAGAAACAGTTAAAGATAGG - Intergenic
974583601 4:63839145-63839167 TGGCAGAAACAGTAAGGTAATGG + Intergenic
974853060 4:67426958-67426980 TTTCAGAATCAGTAAGAAAATGG - Intergenic
975155376 4:71066547-71066569 TAGCAGAAACAGTTCCAGAGAGG + Intergenic
976043305 4:80913627-80913649 TTGAAACAACAGTTACAGAAGGG + Intronic
976144950 4:82033070-82033092 TTGCAGAAACAGATAGTGGCTGG - Intronic
978113272 4:104988511-104988533 TTGTAGAAAAAGTCATAGAAGGG - Intergenic
979018437 4:115464609-115464631 GTGCAGAACCAGTTAGAGACTGG + Intergenic
979147954 4:117269591-117269613 TTGAAGAAACAGTTGGAAAATGG + Intergenic
979706962 4:123731749-123731771 TTGTAGAATGAGTTAGGGAAGGG + Intergenic
980212980 4:129813993-129814015 TTATAGAATCAGTTAGAAAAGGG + Intergenic
980398532 4:132248017-132248039 TTGCTGAAAGAGTTGGAGAATGG - Intergenic
981437341 4:144740933-144740955 TGGCAGAAACAGTAGTAGAAAGG - Exonic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
984408102 4:179359363-179359385 TTGCAGTAACATTAAGAGATAGG - Intergenic
984630552 4:182055863-182055885 TAGCAGAAAGTGTTAGAGGAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986851215 5:11816387-11816409 GTGCAGCAACAGTTTGAGAGAGG + Intronic
987078360 5:14404360-14404382 TTTCAGAAATAGTAAGAGAAAGG - Intronic
988037191 5:25842298-25842320 TTGCAGAAGAAATTAGAGAGAGG + Intergenic
988158651 5:27490342-27490364 AATCAGAGACAGTTAGAGAATGG - Intergenic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
989639751 5:43571503-43571525 TTACAGAAACAGATAGACAAAGG + Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990516256 5:56533659-56533681 TTGGTGCAACAGTTGGAGAAAGG + Intronic
990929361 5:61070909-61070931 TTGGAGTAATAGTTATAGAAAGG - Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
992880547 5:81105185-81105207 CTGCACTAACAGTCAGAGAATGG - Intronic
993706451 5:91177202-91177224 TTGGAGAAAGAATGAGAGAATGG + Intergenic
995770341 5:115663020-115663042 TTTCTGAAACAGTTAAAGCAAGG - Intergenic
995979577 5:118085281-118085303 TTGCAGAAACAATTGAAGACAGG + Intergenic
996624138 5:125549553-125549575 TTGCAGAAACAGCTAAAGAAAGG - Intergenic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998662096 5:144250296-144250318 TTGCAGAAAGAGCTAGAGTGTGG - Intronic
999353564 5:150902618-150902640 TTATAAAAACAGTTGGAGAATGG + Intronic
999851909 5:155549818-155549840 TTGTAGAATGAGTTAGAGAGGGG + Intergenic
1000090399 5:157925136-157925158 TTTCAGGAAAGGTTAGAGAAAGG + Intergenic
1000912829 5:167043348-167043370 TTGCAGATACAGTCAAAGAAAGG + Intergenic
1001075175 5:168621278-168621300 TTTCCTAAACTGTTAGAGAATGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1002711713 5:181198889-181198911 TGGCAGAAAGAGGTAGAAAAGGG + Intronic
1004059525 6:12178974-12178996 TTGCAGAAAAATTTATACAATGG + Intergenic
1005169242 6:22963015-22963037 TTGCGAAAAAAGGTAGAGAAAGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005616343 6:27576912-27576934 TAGCAGAAACAGGTATTGAAAGG + Intergenic
1008287078 6:49666890-49666912 TTGCAAAAATAGTGACAGAAGGG + Intergenic
1008874980 6:56315704-56315726 GTGCAAAAACAGGTAGAGGAGGG - Intronic
1008900442 6:56608586-56608608 TTGAAGAAGCTGTCAGAGAAGGG - Intronic
1008923046 6:56862756-56862778 TTTGAGAAACATTTAGAGACTGG + Intronic
1009321650 6:62297979-62298001 TTGCAGAAACCATTAGGTAAAGG + Intergenic
1010054546 6:71550176-71550198 TAGCAGAAACTGTTATAAAAGGG - Intergenic
1010885460 6:81232831-81232853 TTGCAGAAACTGTCACTGAAAGG + Intergenic
1011330473 6:86199692-86199714 TGGCAAAAAAACTTAGAGAATGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1013659412 6:112279641-112279663 TTGGAGAAACAGCTAAAGCAAGG + Intergenic
1013892386 6:115039851-115039873 TTACAGAAACACTTATAGAAAGG + Intergenic
1014055514 6:117010275-117010297 TTATAGAAGCAGTTACAGAATGG + Intergenic
1014372886 6:120634779-120634801 TTGCTGAAACAGGTATACAAAGG + Intergenic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1017582412 6:155880749-155880771 TTGCAGAAACAGATGCATAAGGG - Intergenic
1017588513 6:155953206-155953228 TTGGAGAAACAATTAGGAAAAGG + Intergenic
1018071724 6:160170549-160170571 TTCCTGGAACAGTTAGAGAGAGG - Intergenic
1020416743 7:7954885-7954907 TTGCAGAAGAAGTTCAAGAAGGG - Intronic
1021773026 7:24023998-24024020 ATGAATAATCAGTTAGAGAATGG - Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1022605348 7:31808009-31808031 TTTTAGAAAAAGTTTGAGAACGG + Intronic
1023056825 7:36297394-36297416 TTACAAAAACAATTAGAGAATGG - Intronic
1023115789 7:36860956-36860978 TTGCATAAACAGCTTTAGAAAGG - Intronic
1023234573 7:38070904-38070926 TTGCTGAAAGAGCCAGAGAAAGG - Intergenic
1024202119 7:47118300-47118322 TTGCAGGACCAGCAAGAGAATGG - Intergenic
1024967453 7:55036707-55036729 TTGCAGTAACAGTAAGATGAGGG - Intronic
1025236455 7:57237922-57237944 TTGCAAGAAGAGTGAGAGAATGG - Intergenic
1025872744 7:65449952-65449974 TAGCAGAAAAAGTTACAAAAGGG + Intergenic
1026940531 7:74285283-74285305 TTGCAGAAAAATTCAGAAAAGGG + Intergenic
1027400722 7:77803283-77803305 TTGCAAAAACAGTACAAGAAAGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028241209 7:88423267-88423289 TTTCAGAAAGAGTTTAAGAATGG - Intergenic
1030858146 7:114587806-114587828 TTGCAGAACTAGTGTGAGAATGG - Intronic
1031125740 7:117771670-117771692 TTGCTGAGTCAGTGAGAGAATGG - Intronic
1031633655 7:124075233-124075255 GTGCAGAAAGAGTAAGAGAAAGG - Intergenic
1032759222 7:134923170-134923192 TGGCACAAACACTTGGAGAAAGG - Intronic
1034212825 7:149380085-149380107 TTTGAGAGACAGTGAGAGAAAGG + Intergenic
1035091250 7:156313440-156313462 AAGCAGAAACAGTTTGAAAAGGG - Intergenic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037870042 8:22485546-22485568 TTGCAGAAGCCGTTAGAGGAGGG + Intronic
1038036457 8:23690788-23690810 TTGCACACACAGTTACAGAGTGG - Intergenic
1039359525 8:36860799-36860821 GTGCAAAAACAGTTAGGGACAGG + Intronic
1039487795 8:37925259-37925281 TTGCAAAATCAGTGAGAGACTGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040870633 8:52097226-52097248 TGGGAGAAACAGTTAAAGAAAGG + Intergenic
1041972946 8:63763970-63763992 TTCCAGAAACTGGAAGAGAATGG - Intergenic
1042521757 8:69720060-69720082 TTGCTGAAAGATTTAGAGATGGG - Intronic
1044095154 8:88054673-88054695 TTGCATATACAGTTAGTAAAAGG + Intronic
1045537711 8:103047881-103047903 TTGCAGACAGAGAGAGAGAAAGG - Intronic
1045799342 8:106083793-106083815 CTGTAGAAACATGTAGAGAAAGG - Intergenic
1045856004 8:106766411-106766433 TGGCAGATACAGGGAGAGAAGGG + Intronic
1046199557 8:110906250-110906272 TTGCAGAAACACTTTGAAGATGG - Intergenic
1047206921 8:122809905-122809927 TTTCAGAAGGAGTTAGAAAAGGG + Intronic
1048233501 8:132667216-132667238 TATCATAAACAGGTAGAGAATGG - Intronic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1050372310 9:4934286-4934308 TTGAAGAAACAATTAATGAAAGG + Intergenic
1050389998 9:5132478-5132500 TTGGAGCAACTGTGAGAGAATGG - Intronic
1050616141 9:7403637-7403659 TGGCAGAAACAGATAGAGATCGG - Intergenic
1051009500 9:12394175-12394197 TTGCAGAAATCTTTAGAAAAGGG + Intergenic
1053100158 9:35364913-35364935 TTGCAGCAACAGGTAGAAAATGG - Intronic
1053539319 9:38957641-38957663 TTGCAGAGACACTAAGAAAAAGG - Intergenic
1053578524 9:39378396-39378418 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1053843048 9:42206475-42206497 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054100108 9:60937201-60937223 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054121505 9:61212828-61212850 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054586237 9:66969684-66969706 TTGTAGAAAAAGTGAGAGAAAGG + Intergenic
1054626820 9:67406277-67406299 TTGCAGAGACACTAAGAAAAAGG + Intergenic
1055644962 9:78354790-78354812 TTGCACAAACAGGAAGGGAATGG + Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056663330 9:88560516-88560538 TAACAGAATCAGTTAGAAAAGGG + Intronic
1057493859 9:95544337-95544359 TTTCAGAAGCAGTAAGAGACTGG - Intergenic
1058125317 9:101186815-101186837 TTGCAGAACCAGGTAAAGATAGG + Intronic
1058953449 9:109924716-109924738 CAGCAGAAACAGTTATAAAATGG - Intronic
1059428047 9:114233368-114233390 AGGTAGAAACAGGTAGAGAAAGG - Intronic
1061576690 9:131511802-131511824 TTGCAGAAACTTTAGGAGAAAGG + Intronic
1062532031 9:137006260-137006282 TGGCAGAAAGAGGTCGAGAAAGG - Intergenic
1186368345 X:8919397-8919419 TTGAAGATGCAGTGAGAGAATGG - Intergenic
1188089385 X:25944460-25944482 CAGCAGAAACAGTTATAAAAAGG + Intergenic
1188954720 X:36420445-36420467 TTCCAGGAACAGGTAGATAATGG - Intergenic
1188975510 X:36669100-36669122 TTGCAGATAAGGTCAGAGAAGGG + Intergenic
1189362557 X:40363894-40363916 TTGCAGCAAGAGTTTGGGAAGGG + Intergenic
1191959006 X:66678986-66679008 TTCTAGCAGCAGTTAGAGAATGG + Intergenic
1193548545 X:82859620-82859642 TTGCAGAATGAGTAAAAGAAGGG - Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1195906403 X:109848680-109848702 TTGGAGGAAGAGCTAGAGAAAGG + Intergenic
1196556195 X:117087297-117087319 TAGCAGCAACATTTATAGAAGGG - Intergenic
1196611377 X:117718414-117718436 TGTCAGAGACAGTTAGAAAAAGG - Intergenic
1197018473 X:121656394-121656416 CTGCAGAAATATTTAGAGAATGG + Intergenic
1197566220 X:128090314-128090336 TAGCAAAATCAGTTAGAAAAGGG + Intergenic
1201390831 Y:13495738-13495760 TTGTGGAAACAGTTAGGAAAAGG - Intergenic
1201402388 Y:13617436-13617458 GTGCAGAAACAGTTGCAAAAGGG - Intergenic
1201717130 Y:17057530-17057552 TTGCAGGAACAGACACAGAAAGG - Intergenic
1201797530 Y:17914244-17914266 TTGCATTAAGAGTGAGAGAAAGG + Intergenic
1201804023 Y:17991715-17991737 TTGCATTAAGAGTGAGAGAAAGG - Intergenic
1201967163 Y:19750679-19750701 TTGTAGAATGAGTTAGGGAAGGG + Intergenic