ID: 1157188573

View in Genome Browser
Species Human (GRCh38)
Location 18:45561159-45561181
Sequence AACCATAAGACTCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157188573_1157188580 20 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188580 18:45561202-45561224 GTAGGGAGGACATTCTGGGTAGG 0: 1
1: 0
2: 0
3: 21
4: 176
1157188573_1157188581 23 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188581 18:45561205-45561227 GGGAGGACATTCTGGGTAGGAGG 0: 1
1: 0
2: 3
3: 47
4: 365
1157188573_1157188582 24 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188582 18:45561206-45561228 GGAGGACATTCTGGGTAGGAGGG 0: 1
1: 0
2: 0
3: 31
4: 236
1157188573_1157188575 3 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188575 18:45561185-45561207 TATGTGCCATAACAGCTGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 93
1157188573_1157188574 2 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188574 18:45561184-45561206 GTATGTGCCATAACAGCTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1157188573_1157188579 16 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188579 18:45561198-45561220 AGCTGTAGGGAGGACATTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 202
1157188573_1157188576 6 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188576 18:45561188-45561210 GTGCCATAACAGCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 81
1157188573_1157188578 15 Left 1157188573 18:45561159-45561181 CCAGGCAGAAGAGTCTTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 117
Right 1157188578 18:45561197-45561219 CAGCTGTAGGGAGGACATTCTGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157188573 Original CRISPR AACCATAAGACTCTTCTGCC TGG (reversed) Intronic
900209837 1:1449742-1449764 TACCATAAAAATCTTCTGGCCGG - Exonic
900698139 1:4025606-4025628 TAACATCTGACTCTTCTGCCAGG - Intergenic
901978227 1:13012262-13012284 AGCAATCAGCCTCTTCTGCCTGG + Intronic
902003858 1:13216676-13216698 AGCAATCAGCCTCTTCTGCCTGG - Intergenic
903143291 1:21353301-21353323 AAAAATAAGAATCTTCTGGCTGG - Intergenic
904203361 1:28836218-28836240 AAACATAAGACATTTCAGCCAGG + Intronic
904506346 1:30958403-30958425 AACCACAACACTTTTCTTCCAGG + Intronic
904982648 1:34519661-34519683 AACCCTAAGCCTGTTTTGCCAGG + Intergenic
906227035 1:44130667-44130689 CACCAGAAGACTCATCGGCCGGG + Exonic
908641666 1:66230371-66230393 AAAGATCAAACTCTTCTGCCTGG - Intronic
911333256 1:96549899-96549921 AAGCATAAGACTTTTCTTCTGGG + Intergenic
918100342 1:181367138-181367160 AACCACAACACTCTTTTGCGTGG - Intergenic
919792872 1:201303585-201303607 AAAAATAAAACTTTTCTGCCAGG - Intronic
921148602 1:212382335-212382357 AACCATAAAACACTCCAGCCGGG - Intronic
924402575 1:243702313-243702335 AACCATTACATTGTTCTGCCTGG - Intronic
1069824045 10:71244482-71244504 AAGGATATGACTCTTCTGCCTGG - Intronic
1071437736 10:85662601-85662623 AACCATAGGGCTCCTCTCCCAGG + Intronic
1071485529 10:86099679-86099701 AAGCATAGGCCCCTTCTGCCAGG - Intronic
1071710809 10:88047277-88047299 AAACATGAAATTCTTCTGCCTGG + Intergenic
1073322377 10:102623183-102623205 AAACATAAGTGTTTTCTGCCTGG + Intronic
1073756246 10:106583889-106583911 AACAATAAGATTGTTCTGCATGG - Intronic
1074784098 10:116823781-116823803 AACCATAAAACTCTTATGAGAGG + Intergenic
1075219755 10:120574933-120574955 AACCATAAGAATAATCTTCCAGG - Intronic
1075839085 10:125482919-125482941 AACCATAACACACTTCTACCCGG + Intergenic
1079238856 11:18708249-18708271 CACCATGTGACTCTTCAGCCGGG + Exonic
1083347980 11:62006847-62006869 AAGCAAAACACTCTTCTCCCTGG - Intergenic
1084466860 11:69328350-69328372 AGCCATAAGAGCCTTGTGCCAGG - Intronic
1085431838 11:76458808-76458830 AATGATAAAACCCTTCTGCCAGG - Intronic
1090793264 11:130110994-130111016 AAACAGAAGACTCTTCTCCTGGG - Intronic
1095140211 12:38653214-38653236 AACCAGGAGACACATCTGCCGGG + Exonic
1096414838 12:51404086-51404108 AATCATAAGACTCTTCCGTGTGG + Intronic
1098670523 12:73223790-73223812 AACCATCATACACTGCTGCCAGG - Intergenic
1102690098 12:114753624-114753646 AACCCAAAGACTCTACTGCGAGG - Intergenic
1104539690 12:129652409-129652431 AACCTTAATTCTCTTTTGCCAGG - Intronic
1110160591 13:72373620-72373642 AACCAACAGCCACTTCTGCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114472470 14:22973324-22973346 CCCCAGAGGACTCTTCTGCCAGG + Exonic
1117082977 14:52170480-52170502 AGCCATAAGACTCTCCTGATTGG - Intergenic
1118417508 14:65558032-65558054 AACCATAAGACTCTCTTGGCTGG + Intronic
1119173932 14:72555348-72555370 AACCAAAAGCCCCTTTTGCCAGG + Intronic
1119955727 14:78796748-78796770 ACCAATAAGACTCTTCCTCCTGG - Intronic
1123671172 15:22660163-22660185 AAACTTAAGACTCTTGGGCCAGG + Intergenic
1124104405 15:26724127-26724149 ACCCACAACACTCTTCTGCCAGG + Intronic
1124323212 15:28733382-28733404 AAACTTAAGACTCTTGGGCCAGG + Intronic
1124527105 15:30466540-30466562 AAACATAAGACTTTTGTGCCGGG + Intergenic
1124771548 15:32541143-32541165 AAACATAAGACTTTTGTGCCGGG - Intergenic
1132071590 15:98781848-98781870 AACCTTAAGACTCTTAAACCTGG - Intronic
1133668825 16:7997691-7997713 AAAGAAAAAACTCTTCTGCCTGG - Intergenic
1137996419 16:53219556-53219578 AACCAGAAGACTCTTGTGTCAGG + Intronic
1139901929 16:70334942-70334964 AGCCATCAAACTCTTCTTCCAGG - Exonic
1141508330 16:84495737-84495759 AATCATGAGACTCTTCTCCTCGG + Exonic
1153136358 18:1921982-1922004 AACCATAAAAATTTTCTGCTTGG - Intergenic
1157188573 18:45561159-45561181 AACCATAAGACTCTTCTGCCTGG - Intronic
1157226185 18:45866866-45866888 CAGCATAAGATTCTTTTGCCAGG + Exonic
1159998522 18:74992443-74992465 ACCCAGAACACTCTTGTGCCAGG - Intronic
1161272643 19:3398543-3398565 AACCATCACCTTCTTCTGCCTGG + Intronic
1162012637 19:7827341-7827363 TATTAAAAGACTCTTCTGCCAGG - Intergenic
1165246218 19:34499994-34500016 AACATGAAGACTCTTCCGCCGGG - Intronic
1166582648 19:43915930-43915952 TACCATAAACCTCTTCTCCCAGG - Intronic
1167377241 19:49118813-49118835 AACCATTAGCCTCGTCCGCCGGG + Exonic
935387669 2:102517879-102517901 AACCAAAAGACTCTTGTCACTGG - Intronic
939003393 2:136760471-136760493 AACCTTAATCCTCTTCTGCTGGG - Intergenic
944783243 2:203041385-203041407 ACCCAGAACACTCTTCTCCCAGG - Intronic
945005182 2:205397873-205397895 ACCCCTAAGACTCTTCTGCATGG + Intronic
946464153 2:219896585-219896607 AACCATGAGAGTCTTCTCCCAGG - Intergenic
947806633 2:232973120-232973142 AAGCATTAGACCCTTCTGCTGGG - Intronic
948529631 2:238596062-238596084 AACCCAAAGCCCCTTCTGCCCGG - Intergenic
1181445814 22:22973341-22973363 AACCATTAGAGGCCTCTGCCTGG + Intergenic
1181446962 22:22984435-22984457 AACCATAGGAAACTTCTTCCTGG + Intergenic
1182990399 22:34762164-34762186 GACCATAAAACTATCCTGCCTGG + Intergenic
953301624 3:41782804-41782826 AGCCATAAGAATGTTCTCCCTGG + Intronic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
956467418 3:69533215-69533237 AACCATTAGAATCTTCTGTGAGG + Intronic
957144437 3:76405209-76405231 AACCTTAAGAAGCTTCTGGCTGG - Intronic
961560882 3:127729105-127729127 AAAAATAAGAATCTTCTGCTTGG - Intronic
965563520 3:170085520-170085542 AACCAAAACCCTCTTCTTCCAGG - Intergenic
970374850 4:15446709-15446731 AACCATAAGAATTTTATGCTGGG - Intergenic
972356342 4:38282398-38282420 AAAAATAAAATTCTTCTGCCTGG - Intergenic
975269830 4:72418703-72418725 ATCCATTTGTCTCTTCTGCCTGG - Intronic
980388361 4:132114950-132114972 AACCATCAGACCCTCCTACCTGG + Intergenic
982017963 4:151174685-151174707 AACCAACAGATTCTTCAGCCAGG + Exonic
982201094 4:152961298-152961320 AACCGTGTGACTCTTCTGCCAGG + Intronic
983471038 4:168154919-168154941 AATCATCACATTCTTCTGCCTGG + Intronic
983854033 4:172619097-172619119 AAAAAAAAGACTCTTCTCCCAGG - Intronic
993160789 5:84288307-84288329 ATCCATAATCCTCTTTTGCCTGG + Intronic
994171117 5:96661067-96661089 AACCAGAATTCTGTTCTGCCAGG + Intronic
1003929325 6:10908370-10908392 CCCCATAATACTCTTCTGCCAGG - Intronic
1004194528 6:13491232-13491254 ACCCATAAGACTGGTCTGCATGG + Intergenic
1006326762 6:33360119-33360141 AACCACATGCCTCTGCTGCCAGG - Intergenic
1013150697 6:107443170-107443192 AACCATAGCAGTCTTCTGCCAGG + Intronic
1014315858 6:119863840-119863862 ATCCATAAGACCCTGCTGCAGGG - Intergenic
1019094474 6:169567662-169567684 AACAATAAAACTGTACTGCCGGG + Intronic
1024912325 7:54459372-54459394 AACTATTGGACTCTACTGCCAGG + Intergenic
1025156948 7:56615501-56615523 AATAATGTGACTCTTCTGCCTGG - Intergenic
1025751592 7:64298562-64298584 AATGATGTGACTCTTCTGCCTGG - Intergenic
1025761455 7:64399824-64399846 AACAATACGACTCTTTTGCTTGG + Intergenic
1026687213 7:72521630-72521652 AACCATTAGAATCTTCTGGATGG + Intergenic
1027137773 7:75637442-75637464 GACCAGAAGACTCATCTGTCTGG - Intronic
1027342067 7:77220272-77220294 AGAAATATGACTCTTCTGCCTGG + Intronic
1032434292 7:131887586-131887608 AACCTTTAGAGTCTCCTGCCTGG + Intergenic
1033526827 7:142224321-142224343 CACCATGAGATTCTGCTGCCAGG + Intergenic
1033529395 7:142247290-142247312 AATCCTAAGAATTTTCTGCCAGG - Intergenic
1034054583 7:148021316-148021338 AACCATAAGCCTCTTTTGGTAGG - Intronic
1035916570 8:3631060-3631082 ACCCAAAATACTCTTCAGCCAGG + Intronic
1040358716 8:46644594-46644616 GATAATTAGACTCTTCTGCCTGG + Intergenic
1040358931 8:46646351-46646373 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040359333 8:46650435-46650457 AGCCATGTGACTCTCCTGCCTGG + Intergenic
1040377355 8:46839306-46839328 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040378168 8:46846477-46846499 AATGATAAGACTCTCTTGCCTGG + Intergenic
1040379566 8:46859194-46859216 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040382244 8:46884206-46884228 AATAATGTGACTCTTCTGCCTGG - Intergenic
1042886821 8:73561661-73561683 CACCACAATACTCCTCTGCCAGG + Intronic
1043259080 8:78175304-78175326 AATCTTAATAATCTTCTGCCTGG - Intergenic
1048497233 8:134945471-134945493 AACCATCACACTCTCCTGCAGGG + Intergenic
1052498499 9:29258945-29258967 AACCATAAGACTCTAGTGTCAGG + Intergenic
1054872281 9:70058898-70058920 AACAACAAGAATTTTCTGCCTGG + Intronic
1055537288 9:77262205-77262227 AAAAATAAAACGCTTCTGCCTGG - Intronic
1056313463 9:85366464-85366486 AAGAATAAGTCTCTTCAGCCGGG + Intergenic
1057995409 9:99818889-99818911 AACAAAAAAACTCTTCTCCCTGG - Intergenic
1059255733 9:112929145-112929167 GACCATAAGAGTCTTGGGCCGGG + Intergenic
1194814121 X:98421974-98421996 AACAAGAAGAAACTTCTGCCAGG - Intergenic
1195652921 X:107304499-107304521 AACCATGAGACTTTTCCCCCAGG + Intergenic
1196902713 X:120401670-120401692 AACCATAAGAGTCAACTGACAGG + Intergenic
1200226675 X:154421357-154421379 GACCCTAAGACTCCTCGGCCTGG + Exonic
1200843747 Y:7810431-7810453 AAAGATATGACTCTTCTGACTGG - Intergenic
1200858490 Y:7964863-7964885 AACAATATGACTCTCTTGCCTGG - Intergenic
1200858714 Y:7966926-7966948 AACAATATGACTCCTCTGCCTGG - Intergenic
1200867737 Y:8063154-8063176 AATAATGTGACTCTTCTGCCTGG + Intergenic
1200869951 Y:8086973-8086995 AACAATATGACTCCTCTGCTTGG - Intergenic
1200892301 Y:8336961-8336983 AATGATATGACTCTTCTGCCTGG + Intergenic
1200894542 Y:8360848-8360870 AATGATGTGACTCTTCTGCCTGG - Intergenic
1200894769 Y:8363408-8363430 AATAATATGACTCTTCTGCCTGG - Intergenic
1200902736 Y:8449131-8449153 CATTATAACACTCTTCTGCCTGG + Intergenic
1200904247 Y:8465123-8465145 AAAAATGTGACTCTTCTGCCTGG + Intergenic
1202245829 Y:22819118-22819140 AATAATATGACTCTTCTGCCTGG + Intergenic
1202398817 Y:24452866-24452888 AATAATATGACTCTTCTGCCTGG + Intergenic
1202471963 Y:25217220-25217242 AATAATATGACTCTTCTGCCTGG - Intergenic