ID: 1157189863

View in Genome Browser
Species Human (GRCh38)
Location 18:45571988-45572010
Sequence GGTTTAATTGGTCCAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 2, 2: 7, 3: 44, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157189863_1157189870 -10 Left 1157189863 18:45571988-45572010 CCCCATCCTGGACCAATTAAACC 0: 1
1: 2
2: 7
3: 44
4: 410
Right 1157189870 18:45572001-45572023 CAATTAAACCAAAATCTCTGGGG 0: 1
1: 4
2: 105
3: 310
4: 939
1157189863_1157189872 6 Left 1157189863 18:45571988-45572010 CCCCATCCTGGACCAATTAAACC 0: 1
1: 2
2: 7
3: 44
4: 410
Right 1157189872 18:45572017-45572039 TCTGGGGTAGAGTCCAGATATGG 0: 1
1: 0
2: 0
3: 23
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157189863 Original CRISPR GGTTTAATTGGTCCAGGATG GGG (reversed) Intronic
900625404 1:3606257-3606279 GGATTCAGTGGTCCAGGGTGGGG - Intronic
903376348 1:22868752-22868774 GATTTACTTGGTAAAGGATGTGG + Intronic
903601643 1:24546370-24546392 GTTTTTATGGGTACAGGATGGGG - Intergenic
904512196 1:31020845-31020867 TGATTAATTGGTGCATGATGTGG - Intronic
904526275 1:31136209-31136231 GTTTTTATGGGTACAGGATGGGG - Intergenic
904914984 1:33963324-33963346 GATTTATTTGGTCTTGGATGAGG + Intronic
905798587 1:40829431-40829453 AGGTTAATAGGTCAAGGATGGGG - Intronic
906705479 1:47891904-47891926 GGTGTCAGTGGTCCAAGATGAGG + Intronic
907792216 1:57678023-57678045 GGTTCAATTGGTCTAGGGTATGG + Intronic
908105985 1:60842792-60842814 CATTTAATTGGTCTGGGATGAGG + Intergenic
908228061 1:62076066-62076088 AGTTTATTTGGTCTGGGATGGGG - Intronic
909094529 1:71270999-71271021 GTTTTTATGGGTACAGGATGTGG + Intergenic
909347535 1:74609605-74609627 GGTTTAAATGGTACAGGGTTAGG - Intronic
909742331 1:79045636-79045658 GATTTTATAGGCCCAGGATGGGG + Intergenic
910050894 1:82973187-82973209 GTTTTTATAGGCCCAGGATGGGG - Intergenic
910060459 1:83085657-83085679 GATTTAATTGGTCTGGGGTGGGG - Intergenic
910149654 1:84126532-84126554 GTTTTTATGGGTACAGGATGGGG + Intronic
912156327 1:106924890-106924912 GATTTAATAAGTCCAGGATGGGG + Intergenic
912582055 1:110729772-110729794 GTTTTTATGGGTACAGGATGGGG - Intergenic
914995944 1:152543470-152543492 GATTTTATGGGCCCAGGATGTGG - Intronic
915932042 1:160066867-160066889 GGTTTTTTTGGTCCAGAAAGTGG + Intronic
915968916 1:160338278-160338300 GTTTTGATTGCCCCAGGATGTGG + Intronic
916284674 1:163093495-163093517 GGTTTTATAGGCACAGGATGGGG - Intergenic
916490401 1:165297329-165297351 GGTGTAATTGGTCTAGGCAGGGG + Intronic
917554215 1:176067376-176067398 GTTTTTATAGGTGCAGGATGGGG - Intronic
918216230 1:182393738-182393760 AGTTTAAATGGTCGAGGAAGGGG + Intergenic
918362313 1:183771813-183771835 GTTTTTATAGGCCCAGGATGGGG - Intronic
918813311 1:189149719-189149741 GTTTTTATAGGCCCAGGATGGGG - Intergenic
919240817 1:194914177-194914199 GTTTTTATGGGTACAGGATGGGG - Intergenic
919539728 1:198831487-198831509 GTTTTAATAGGCACAGGATGAGG + Intergenic
921642579 1:217572751-217572773 GATTTAATTGATCTAAGATGAGG + Intronic
923383833 1:233447283-233447305 GGTTTTATAGGCCCAGGATGGGG + Intergenic
923456753 1:234171294-234171316 GGCTTAATTAGTCTGGGATGAGG + Intronic
923761321 1:236847724-236847746 GATTTAACTGGTTCAGGGTGAGG + Intronic
924115468 1:240741848-240741870 GGTTCAATTGGTCCAAAATGTGG - Intergenic
924697923 1:246419458-246419480 GTTTTTATAGGCCCAGGATGGGG + Intronic
1063131850 10:3185274-3185296 GATTTTATGGGTACAGGATGGGG - Intergenic
1063239075 10:4149644-4149666 GGTTTTATAGGCACAGGATGGGG + Intergenic
1063456199 10:6184405-6184427 GGTTTAATCGGTCTGGGATGGGG + Intronic
1064878832 10:20026582-20026604 GATTTAATTGGTCTAGAATATGG - Intronic
1064878938 10:20028224-20028246 GATTTAATTGGTCTAGAACGTGG + Intronic
1066287545 10:33982693-33982715 GGTTATATGGGTACAGGATGGGG + Intergenic
1066412200 10:35183081-35183103 TCTTTAATTGGTACAGGAAGAGG - Intronic
1068429559 10:56913525-56913547 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1068800030 10:61130229-61130251 GCTTTCATTGGTGGAGGATGGGG + Intergenic
1069319707 10:67153329-67153351 GATTTAATTGGTCAAAGGTGGGG + Intronic
1070530790 10:77335516-77335538 GATTTAATTGGTCTAGAGTGAGG + Intronic
1070951981 10:80438573-80438595 GGTTTAACTGGACTAGGATCTGG - Intergenic
1071353254 10:84767684-84767706 GTTTTCATAGGCCCAGGATGGGG + Intergenic
1072000171 10:91187198-91187220 GATTTAATTGTTCTAGGATGGGG + Intronic
1072268323 10:93751621-93751643 GATTTAATTGGTCTAGGGTATGG - Intergenic
1072327201 10:94310422-94310444 GGTTTAATTGGTGCGGGGTGTGG - Intronic
1073686532 10:105760503-105760525 AATTTAATTGGCCTAGGATGAGG + Intergenic
1074272821 10:111971820-111971842 GATTTCAGTGGTCCAGGATTGGG - Intergenic
1074902707 10:117832808-117832830 GATTTAATTGGTCTAGTTTGGGG + Intergenic
1075082991 10:119396390-119396412 GGTTTCATGGGTCTAGGGTGGGG + Intronic
1075296836 10:121284771-121284793 GATTTAACTGGTCTAGGGTGGGG - Intergenic
1075975656 10:126691838-126691860 GATTTTATGGGTACAGGATGTGG + Intergenic
1076172606 10:128334713-128334735 GCTTTAATGGTTACAGGATGGGG + Intergenic
1079008249 11:16807856-16807878 GATATAATTGGTCTGGGATGGGG + Intronic
1079892008 11:26067412-26067434 GGTTTATTTGGCCAAGGTTGAGG - Intergenic
1080193131 11:29574919-29574941 GGTTCAATTGCTCTAGGATGCGG + Intergenic
1080275815 11:30502442-30502464 GTTTTAATTGTTACAGCATGAGG - Intronic
1080546667 11:33326277-33326299 GATTTAATTGGTGTAGGGTGTGG + Intronic
1080863019 11:36166796-36166818 GATTCAGTAGGTCCAGGATGGGG + Intronic
1081343288 11:41953550-41953572 GGTTTAATTAGTCCTTGATGGGG - Intergenic
1083016199 11:59456954-59456976 GGTTGATCTGGTCCATGATGGGG - Exonic
1084243156 11:67836605-67836627 GGTTTAATTGTTCTTGGGTGTGG + Intergenic
1084326178 11:68401469-68401491 GACTTAATTGCTCCAGGTTGGGG + Intronic
1084829830 11:71760337-71760359 TGTTTAATTGTTCCTGGGTGTGG - Intergenic
1085684039 11:78605614-78605636 GTTTTTATAGGCCCAGGATGAGG - Intergenic
1087261102 11:96013583-96013605 GTTTTTATAGGCCCAGGATGGGG - Intronic
1087457323 11:98403432-98403454 GGTTTATTTAGCCAAGGATGAGG + Intergenic
1088238574 11:107750619-107750641 GTTTTTATGGGTACAGGATGGGG + Intergenic
1088428302 11:109729503-109729525 GTTTTTATGGGTACAGGATGGGG - Intergenic
1088434658 11:109798359-109798381 GATTTCATTGGTCAAAGATGTGG - Intergenic
1088812710 11:113402267-113402289 GGTTTAATTGGTTGAGGGTAGGG - Intergenic
1089112226 11:116065816-116065838 GTTTTAAATTCTCCAGGATGAGG + Intergenic
1089662906 11:119997195-119997217 GTTTTAATTGGTCTGGGGTGTGG - Intergenic
1090728142 11:129545955-129545977 GTTTTAACTGGTCCAGGATATGG + Intergenic
1092598709 12:10035226-10035248 GGTTTTATAGGCACAGGATGGGG + Intronic
1092786541 12:12032107-12032129 GATTTAATTGGTTCACAATGTGG - Intergenic
1092850858 12:12625086-12625108 GGTTTTATAGGCACAGGATGGGG + Intronic
1093348995 12:18072867-18072889 GTTTTTATAGGTGCAGGATGGGG + Intergenic
1093503225 12:19836122-19836144 GTTTTTATAGGACCAGGATGGGG - Intergenic
1093555723 12:20471336-20471358 GATTTAATTGATCACGGATGGGG - Intronic
1093654312 12:21677315-21677337 GGTTTTATAGGCACAGGATGGGG - Intronic
1094227972 12:28067634-28067656 GGTGTAATTGGGCCAGGTTATGG - Intergenic
1095376197 12:41531514-41531536 GCTTTTATAGGCCCAGGATGGGG + Intronic
1095906690 12:47385531-47385553 GGTTTATTTTGCCAAGGATGAGG - Intergenic
1097154569 12:57003489-57003511 AGTTTAGATGGTCAAGGATGTGG + Exonic
1098363904 12:69682142-69682164 GATTCAATTGATCTAGGATGAGG + Intronic
1099425506 12:82518488-82518510 GTTTTTATGGGTACAGGATGGGG + Intergenic
1100207353 12:92364819-92364841 CATTTAATTGGTCTGGGATGTGG + Intergenic
1100293031 12:93235575-93235597 GTTTTTATGGGTACAGGATGGGG - Intergenic
1100757963 12:97773221-97773243 GTTTTTATGGGTACAGGATGGGG + Intergenic
1101544836 12:105702821-105702843 GATTTAATTTGTCTAGGGTGCGG - Intergenic
1101799988 12:108013348-108013370 GGTTTCATTGGTCTGGCATGTGG + Intergenic
1101989658 12:109474514-109474536 GATGTAATTGGTCCGGGATGTGG + Intronic
1104608101 12:130204645-130204667 GATTTAATTGGTCTGGGGTGGGG - Intergenic
1105673463 13:22644742-22644764 AGTTTTATAGGCCCAGGATGGGG + Intergenic
1106057496 13:26252359-26252381 TGTATAATTGGTACAGGAGGTGG + Intergenic
1106173554 13:27309213-27309235 GTTTTTATAGGCCCAGGATGCGG + Intergenic
1106176036 13:27332682-27332704 AATGAAATTGGTCCAGGATGTGG + Intergenic
1106182919 13:27383631-27383653 GTTTTTATAGGTCCAGGATAAGG - Intergenic
1106278255 13:28236338-28236360 GATTTAATAGGTCCTAGATGGGG - Intronic
1106942263 13:34792084-34792106 GGTTTTATGGGTACAAGATGGGG - Intergenic
1107440958 13:40426784-40426806 GATTTAATTGGTGTAGGGTGTGG + Intergenic
1107780815 13:43900615-43900637 GATTTAATTGGTCTGGCATGTGG - Intergenic
1108319037 13:49269360-49269382 GGTTTAATAGGTCTGGGTTGGGG - Intronic
1109208253 13:59505518-59505540 GGTTGAATTGATCCAGGGTTGGG - Intergenic
1109230838 13:59755718-59755740 GATTTAATTGGTCTAAGATGGGG - Intronic
1110835127 13:80074418-80074440 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1111292725 13:86188558-86188580 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1114187829 14:20416468-20416490 GATTTAATTGGTCTGGGGTGTGG - Intergenic
1114707110 14:24738301-24738323 GGCTGAGGTGGTCCAGGATGAGG - Intergenic
1116833433 14:49745343-49745365 GATTTAATTAGTCCAGGGTGTGG + Intronic
1117242684 14:53850732-53850754 GATTTAATTGGTTCAGCAGGTGG + Intergenic
1117312962 14:54546944-54546966 GATTTAATAGGTCTAGGATCTGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1118862220 14:69673288-69673310 GGTTCAGTAGGTCTAGGATGTGG + Intronic
1119497820 14:75095949-75095971 GATTTAATTGGTCAGGGATAGGG + Intronic
1119626853 14:76184820-76184842 GATTTAATTGGTCTGGGATAAGG + Intronic
1119783326 14:77294026-77294048 GATTTAATTGATCTAGGATGAGG - Intronic
1120748812 14:88178546-88178568 GATTTAATTTGTTCAGGAAGCGG - Intergenic
1122641658 14:103163585-103163607 GTTTTTATGGGTGCAGGATGGGG - Intergenic
1124997860 15:34741428-34741450 GGTTTCACTCGCCCAGGATGGGG + Intergenic
1126228258 15:46296221-46296243 GTTTTTATAGGCCCAGGATGCGG - Intergenic
1126745064 15:51817827-51817849 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1129909039 15:79210981-79211003 GATTTAATTGGTCCAGGGTGTGG + Intergenic
1130238971 15:82167619-82167641 GGTTTAATCAATCTAGGATGAGG + Intronic
1130383235 15:83390118-83390140 GGCTGAATTGGTCCAGGACTGGG - Intergenic
1130420778 15:83745042-83745064 GTTTTTAGGGGTCCAGGATGTGG - Intronic
1130533090 15:84762555-84762577 GGTTTAATTGGTCTGAGCTGGGG + Intronic
1130786199 15:87099510-87099532 TATTTAATTGGTCTTGGATGGGG + Intergenic
1131629868 15:94165411-94165433 GGTTTCATTGGTCTGGGGTGGGG - Intergenic
1131691432 15:94831670-94831692 GTTTGTATAGGTCCAGGATGGGG - Intergenic
1131735287 15:95325581-95325603 GGTTTGATTGGTCTGGGGTGTGG - Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1132560446 16:590932-590954 GGTGTCATGGGTCCAGGATCTGG + Intronic
1132659990 16:1057058-1057080 GTTTTTATGGGTACAGGATGGGG + Intergenic
1133202223 16:4210931-4210953 GATTCAATGGGTCCAGGCTGGGG - Intronic
1133354620 16:5126847-5126869 GGTTTAATTGTTCTGGGGTGTGG + Intergenic
1133467852 16:6045039-6045061 GATTTGATTGGTCTTGGATGGGG + Intronic
1134890730 16:17839530-17839552 GATTCAATTGGTCCAGGGTGAGG - Intergenic
1135196022 16:20395463-20395485 GTTTTAATGTGTCAAGGATGAGG + Intronic
1135478456 16:22799553-22799575 GATTCAATTGGTCCTGGGTGAGG - Intergenic
1135643620 16:24142576-24142598 GATTTAATTGGTCTAGAGTGTGG + Intronic
1137814961 16:51389819-51389841 GGTTTAATTCACCCAGAATGTGG - Intergenic
1138062452 16:53906220-53906242 GATTTAATTGGTCTAAGCTGTGG + Intronic
1138144156 16:54594241-54594263 CATTTAATTGGTCATGGATGTGG - Intergenic
1139382560 16:66542819-66542841 GGTGTAATTGGTCTGGGCTGTGG - Intronic
1140564572 16:76026804-76026826 GTTTTTATGGGTACAGGATGAGG - Intergenic
1140614810 16:76649238-76649260 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1141710336 16:85695296-85695318 GATTTCTTTGGTCCAGGAGGAGG - Intronic
1143290331 17:5823267-5823289 GTTTTTATAGGCCCAGGATGGGG + Intronic
1144053583 17:11518692-11518714 GATTCAATTGGTCTTGGATGGGG - Intronic
1144404704 17:14941367-14941389 GGTCTAATAGCTTCAGGATGGGG + Intergenic
1146601567 17:34221655-34221677 GGTTGAATGGGTCTGGGATGGGG - Intergenic
1147471666 17:40667931-40667953 GATTTAATTGGCTCAGGACGGGG + Intergenic
1148537737 17:48454978-48455000 GATTTAATGGGTACAGGATGAGG - Intergenic
1148676456 17:49448425-49448447 GATTTAATTGGTCTGGGGTGAGG - Intronic
1149347879 17:55756562-55756584 GGTTTAACTGGTCTAGGGTGGGG + Intronic
1149557404 17:57584000-57584022 GGTTCAGTGGGTCCAGGGTGGGG + Intronic
1151080720 17:71325428-71325450 GGTCTGATAGGTTCAGGATGGGG - Intergenic
1153960293 18:10134538-10134560 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1154071058 18:11151414-11151436 GATTTAATTGGTCTGCGATGGGG + Intergenic
1155108471 18:22690059-22690081 AATCTAATTGGTCTAGGATGAGG + Intergenic
1155516272 18:26626560-26626582 GGATTAATTGAGCCAGGAAGTGG - Intronic
1155791137 18:29971921-29971943 GGTTTTATAGGCACAGGATGGGG + Intergenic
1155883098 18:31174760-31174782 GACTTAATTGGTCTAGGGTGGGG - Intergenic
1156400677 18:36736712-36736734 GTTTTTATGGGTACAGGATGGGG + Intronic
1156522753 18:37735632-37735654 GAATTAATTGGTCTGGGATGTGG + Intergenic
1157189863 18:45571988-45572010 GGTTTAATTGGTCCAGGATGGGG - Intronic
1157535067 18:48451996-48452018 GGTTTTATAGGCACAGGATGGGG + Intergenic
1157553762 18:48599172-48599194 GGTTCTATTGGCCCAGGGTGTGG + Intronic
1157589169 18:48825834-48825856 GGTTTAATTGGTTGAAGAAGGGG - Intronic
1157791242 18:50533056-50533078 GGTTGAACTGGTCCAGGATATGG - Intergenic
1157797123 18:50585172-50585194 GATTTAATTGGTCATGGATGTGG + Intronic
1157911334 18:51619881-51619903 GATTTAATTGGTCTGGGGTGGGG + Intergenic
1158968510 18:62644476-62644498 GTTTTTATGGGTACAGGATGGGG - Intergenic
1159236361 18:65679278-65679300 GATTCAGTTGGTCTAGGATGGGG - Intergenic
1162944747 19:14035704-14035726 GTTTTAATTGGTACAGGGAGGGG + Intronic
1163098454 19:15078411-15078433 GGTTTATTTGGTCCCAGAAGTGG - Intergenic
1163188690 19:15659158-15659180 GGCTTGATGGGGCCAGGATGGGG + Intronic
1163216102 19:15878976-15878998 GGCTTGATGGGGCCAGGATGGGG - Intronic
1163763682 19:19150687-19150709 GATTCCTTTGGTCCAGGATGCGG + Exonic
1168184648 19:54691843-54691865 GGTTTTATAGGCACAGGATGGGG + Intronic
924958525 2:11938-11960 ACTTTAATTGGTGCAGGAGGCGG - Intergenic
925705740 2:6683365-6683387 GTTTTTATGGGTACAGGATGGGG + Intergenic
925953493 2:8938035-8938057 GGTTTAAATGGTACTGGTTGTGG + Intronic
926227859 2:10981158-10981180 GATTTAATTGGTCTAAGGTGTGG - Intergenic
926434958 2:12828064-12828086 GGTTTTATGGGCACAGGATGGGG + Intergenic
926825457 2:16901542-16901564 GTTTTTATAGGCCCAGGATGGGG - Intergenic
929044804 2:37778891-37778913 GGATGAAATGGTGCAGGATGAGG - Intergenic
929115745 2:38442449-38442471 GATGTAATTGGTCTAGGATGGGG - Intergenic
929194320 2:39169883-39169905 GGTTTACTTGAGCCAGGAGGCGG - Intergenic
930879396 2:56254380-56254402 TATTTAATTGTTTCAGGATGGGG - Intronic
931396679 2:61893868-61893890 TGTTTTAGGGGTCCAGGATGTGG + Intronic
931449557 2:62356905-62356927 AATTTAATTGGTCTAGGATATGG + Intergenic
931811882 2:65862179-65862201 GATCTAATTGGTCCAGGGTTGGG + Intergenic
933398789 2:81765397-81765419 GTTTTTATAGGCCCAGGATGAGG - Intergenic
933705688 2:85288257-85288279 GATTTAATTGGTCTGGGGTGCGG + Intronic
933882234 2:86681177-86681199 GTTTTCATAGGTACAGGATGTGG + Intronic
934775893 2:96937270-96937292 GGTTTAATTAGTCTGGGGTGTGG + Intronic
934913373 2:98278732-98278754 GTTTTTATGGGTACAGGATGGGG + Intronic
935543707 2:104378536-104378558 GTTTTTATAAGTCCAGGATGGGG + Intergenic
935664052 2:105494791-105494813 GTTTTAATAGGCACAGGATGGGG + Intergenic
936052280 2:109233484-109233506 GGTTTTATAGGTACAGGATGGGG + Intronic
936647516 2:114388882-114388904 GGTTTTATAGGTACAGGATAGGG - Intergenic
936972917 2:118191989-118192011 GATTCAGTTGGTCCAGGGTGGGG - Intergenic
938708269 2:133952894-133952916 AGTTTATTTGGGCCAAGATGAGG - Intergenic
938797687 2:134731947-134731969 GGGTTAATTAGTCTGGGATGGGG + Intergenic
939064420 2:137465416-137465438 GATTTAATTGGTCCAGGAAGAGG - Intronic
939846436 2:147252112-147252134 GGTTTAATTGGTCCAGCATGGGG - Intergenic
940599855 2:155845230-155845252 GTTTTTATAGGCCCAGGATGGGG - Intergenic
940658721 2:156520179-156520201 GTTTTTATAGGTACAGGATGGGG + Intronic
940689364 2:156896190-156896212 GGTTTAATTAGAGGAGGATGAGG + Intergenic
941186237 2:162324580-162324602 GTTTTTATAGGTACAGGATGGGG + Intronic
942068785 2:172296554-172296576 GGTTCAGTAGGTCCAGGAGGAGG - Intergenic
942105469 2:172629331-172629353 GTTTTCATGGGTACAGGATGGGG - Intergenic
943027552 2:182648066-182648088 GGTTTAGTAGGTCCGGGCTGAGG - Intergenic
943292625 2:186093830-186093852 GATTTATTTGGTCCACAATGTGG + Intergenic
944083718 2:195819892-195819914 GGTTTAATTGGTCTAGAGTGTGG + Intronic
944699854 2:202237481-202237503 TGTTTAATTAGAACAGGATGAGG + Intronic
944728400 2:202495528-202495550 GTTTTTATAGGCCCAGGATGGGG + Intronic
944843657 2:203646980-203647002 GTTTTTATTGGCACAGGATGGGG + Intergenic
944851506 2:203724448-203724470 GATTTAATTGGTCTAGGCTGGGG - Intronic
944898334 2:204188723-204188745 GATTTAATTGGTCTTGGGTGAGG + Intergenic
946151979 2:217780974-217780996 TTTTTTAATGGTCCAGGATGTGG - Intergenic
946252648 2:218422989-218423011 GATTTAATTAGGCCAGGGTGGGG - Intronic
947398337 2:229708320-229708342 GATTTAATTGGCCTAGGGTGGGG - Intronic
1168961613 20:1873964-1873986 GATTCTATAGGTCCAGGATGGGG + Intergenic
1169062375 20:2670707-2670729 GATATAATTGGTCTGGGATGGGG + Intergenic
1169537180 20:6557781-6557803 GATTTAACTGGTCTAGGATGTGG - Intergenic
1169946769 20:10997247-10997269 GGTTCAATTGGTCTGGGATGTGG - Intergenic
1170218387 20:13916177-13916199 GAATGAATTGGTCCAGGATGTGG + Intronic
1170549451 20:17464179-17464201 GATTTACTTGGTCTGGGATGAGG + Intronic
1170639563 20:18139472-18139494 GGTTTAAATGGTCTGGGGTGGGG - Intronic
1171182319 20:23099791-23099813 GATATAGTTGGTCCAGAATGGGG - Intergenic
1171212127 20:23325162-23325184 GATTTAATTGATCTAGGACGAGG + Intergenic
1173853104 20:46231376-46231398 TATTTAATTGGTCAGGGATGGGG - Intronic
1173938710 20:46891697-46891719 GGTTTAATTGGTCTAGGATGGGG + Intergenic
1175308166 20:57992261-57992283 GATCTAGTTGGTCCAGGCTGGGG - Intergenic
1175327529 20:58140187-58140209 GGTTTGATGGCTCCAGGGTGGGG - Intergenic
1175693373 20:61082676-61082698 TGTTTTGTTGCTCCAGGATGGGG - Intergenic
1177363629 21:20104928-20104950 GCTTTTATGGGTACAGGATGTGG - Intergenic
1177504149 21:21999752-21999774 GGTTTAATTGGACATGGCTGGGG + Intergenic
1177703811 21:24674332-24674354 GGTTTTATGGGCACAGGATGGGG - Intergenic
1178410443 21:32359436-32359458 TCTTTAATTCTTCCAGGATGAGG + Intronic
1178498733 21:33108943-33108965 GATTTAATTGATCTAGGTTGAGG - Intergenic
1179056875 21:37944496-37944518 GATTTATTAGGTCCAGGGTGAGG + Intergenic
1179917998 21:44490414-44490436 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1182868765 22:33627738-33627760 GGTTAAATGGGTCATGGATGTGG - Intronic
1183134411 22:35872800-35872822 GTTTTTATAGGCCCAGGATGGGG + Intronic
1185187426 22:49410264-49410286 CGTTTAAGTGGTCCTGGATTTGG + Intergenic
949318763 3:2785909-2785931 GTTTTTATGGGTACAGGATGGGG - Intronic
949786419 3:7746562-7746584 GACTCAATTGGTCTAGGATGGGG + Intergenic
950297651 3:11846099-11846121 GATTTAATTGGTTTGGGATGAGG - Intronic
950319446 3:12036471-12036493 GGTTCAAATGGTCCTGGGTGTGG - Intronic
951165436 3:19480181-19480203 GGTTTCATAGGTCCAGGCTGTGG + Intronic
951383925 3:22021848-22021870 GATTTAATTAGTCTAGGATGCGG + Intronic
951635724 3:24773378-24773400 GGATTAATTGATCTAGAATGGGG + Intergenic
951813475 3:26727251-26727273 GAGTTAATTGGTCCAAGGTGTGG - Intergenic
953097404 3:39792256-39792278 GGTTTCTCTGGGCCAGGATGTGG - Intergenic
953742440 3:45549107-45549129 AATTTAATTGGTCCATGGTGTGG + Exonic
954054687 3:48012044-48012066 GGTTAAATAGGTGAAGGATGGGG - Intronic
955741159 3:62093080-62093102 GATGTAATTGGTCCAGGAGATGG + Intronic
958135748 3:89488188-89488210 GGTTTAATGGGTTCAGTTTGAGG + Intergenic
959694155 3:109231695-109231717 GTTTTTATGGGTACAGGATGCGG - Intergenic
959749918 3:109821973-109821995 GGTTTATTTTGTCAAGGTTGAGG + Intergenic
960062863 3:113341133-113341155 GTTTTAATAGGCCCAGGATAGGG + Intronic
960246335 3:115404343-115404365 GGTTCAATATGTCCAGGGTGGGG + Intergenic
960906488 3:122606704-122606726 CCTTTAATTGGTCAGGGATGTGG + Intronic
961042020 3:123684220-123684242 GGTTTCATTGGTCTGGGTTGGGG + Intronic
961731171 3:128966029-128966051 GATTTAATTGGTCTGGGGTGTGG + Intronic
961890961 3:130129991-130130013 GGTTTAATTGTTCTTGGGTGTGG + Intergenic
962135360 3:132725907-132725929 GATCTAATTGGTCTAGGGTGAGG - Intergenic
963512604 3:146267557-146267579 GGTTTAATTGCTACAGCATGGGG + Intergenic
963540192 3:146577040-146577062 GACTTAATTGGTACAGAATGAGG + Intronic
964247428 3:154669815-154669837 GTTTTTATGGGTACAGGATGGGG - Intergenic
964308066 3:155361943-155361965 GGTTTTATAGGCACAGGATGGGG + Intergenic
964527552 3:157631238-157631260 GGTATCCTTGGTCCAGGAGGAGG + Intronic
964670234 3:159217168-159217190 GATTTAATTGGTTTGGGATGAGG + Intronic
964988565 3:162775231-162775253 GGTTTATTTGGCCAAGGCTGAGG - Intergenic
965208387 3:165751450-165751472 GTTTTTATGGGTACAGGATGGGG - Intergenic
965208900 3:165759174-165759196 GTTTTTATGGGTACAGGATGGGG - Intergenic
965320438 3:167247134-167247156 GTTTTTATAGGCCCAGGATGGGG - Intronic
965376240 3:167927775-167927797 GATTTAATTCGTCTAGAATGAGG + Intergenic
967225773 3:187289613-187289635 GGTTTAATTGCTCTGGGGTGAGG + Intronic
968217144 3:196902540-196902562 GCTTTAATAGGTCTGGGATGAGG + Intronic
968733426 4:2282978-2283000 GGTTTAATTGTGCTTGGATGTGG + Intronic
969751657 4:9116103-9116125 GGTTTAATTGTTCTTGGGTGTGG - Intergenic
970489236 4:16555179-16555201 GATTCAATTGGTCTGGGATGTGG + Intronic
971585688 4:28402973-28402995 GTTTTTATAGGCCCAGGATGGGG + Intergenic
972368279 4:38396155-38396177 GATTTAATTGGTCCAGGGTGTGG + Intergenic
974013792 4:56630771-56630793 GATTTAATTGGTCTGGGGTGTGG - Intergenic
974019272 4:56678404-56678426 GATTTAATTGGTCCAGGGTGGGG + Intronic
974752025 4:66154116-66154138 GTTTTTATAGGCCCAGGATGGGG - Intergenic
977357820 4:95969138-95969160 GATTTTATGGGTACAGGATGGGG - Intergenic
977964505 4:103128507-103128529 GGTATGATTGGTCCAGAATGTGG - Intronic
978980648 4:114940947-114940969 GTTTTTATGGGTACAGGATGGGG + Intronic
979088974 4:116453459-116453481 GGTTTTATAGGCCCAGAATGGGG + Intergenic
979275705 4:118812424-118812446 GTTTTTATAGGCCCAGGATGGGG - Intronic
979416284 4:120443399-120443421 GATTTCATTGGTCAGGGATGGGG + Intergenic
979615051 4:122733014-122733036 GGGTGAATTGGTCCAGCATGTGG + Intronic
979716518 4:123844868-123844890 GTTTTTATGGGTACAGGATGGGG + Intergenic
980648819 4:135682911-135682933 GGTTTAATTGTTCCTGTTTGGGG - Intergenic
981423763 4:144580869-144580891 GTTTTTATAGGTCCGGGATGCGG - Intergenic
981906207 4:149924334-149924356 GTTTTTATAGGCCCAGGATGGGG + Intergenic
982504378 4:156198646-156198668 GCTTTTATAGGCCCAGGATGGGG - Intergenic
983515460 4:168651533-168651555 GTTTTAATTGGTCCAAGGTCGGG - Intronic
984245905 4:177275136-177275158 GGTTTTTATGGTACAGGATGGGG - Intergenic
984289910 4:177781967-177781989 GGTTTAACAGGCCCAGGGTGGGG + Intronic
984300651 4:177912645-177912667 GTTTTTATGGGTACAGGATGAGG + Intronic
984522602 4:180819197-180819219 AGTTTAATTGGTACATGATTTGG - Intergenic
985252964 4:188041924-188041946 GTTTTTATAGGCCCAGGATGCGG - Intergenic
985269871 4:188183842-188183864 GGTTTTATGAGTACAGGATGCGG - Intergenic
986165316 5:5267694-5267716 GTTTTTATAGGCCCAGGATGGGG + Intronic
988297856 5:29390111-29390133 TGTTAAATAGTTCCAGGATGCGG + Intergenic
989558568 5:42825411-42825433 GTTTTTATGGGTACAGGATGGGG - Intronic
991170868 5:63624219-63624241 GGTTTAATTGGTTTGGGATGTGG - Intergenic
991289003 5:65012913-65012935 GATTTAATTGTTCTGGGATGGGG - Intronic
992252421 5:74888636-74888658 GGTTTATTTTGTCAAGGTTGAGG - Intergenic
992596362 5:78351417-78351439 GATTTAATTGGCCCATGATTTGG - Intergenic
993162974 5:84313714-84313736 GATTTAATTGGTCGGAGATGTGG - Intronic
993184545 5:84600624-84600646 GTTTTTATGGGTACAGGATGGGG + Intergenic
993946707 5:94124002-94124024 GGTTTAATTGGTTCATGGTTCGG + Intergenic
994006791 5:94846709-94846731 GGTTTAATTGGTCTTGGATAGGG - Intronic
994174844 5:96700506-96700528 GGTTTAGGAAGTCCAGGATGAGG + Intronic
995532536 5:113105969-113105991 GATTTAATTGGTCTGGGGTGGGG - Intronic
995610128 5:113900710-113900732 GATTTAATTGGTCTATGGTGAGG - Intergenic
996052219 5:118947585-118947607 GTTTTTATGGGTACAGGATGGGG + Intronic
996203752 5:120704658-120704680 GATTTAATTGGTCCAGGTTGGGG - Intergenic
996215011 5:120855977-120855999 GTTTTTATAGGTTCAGGATGGGG - Intergenic
997139308 5:131361987-131362009 GTTTTTATAGGCCCAGGATGGGG + Intronic
997712296 5:136015888-136015910 GGTTTAAGTGGTCTGGGATGTGG + Intergenic
999239757 5:150120640-150120662 GCTATAATGGGTCCAGGGTGGGG - Intronic
1000718080 5:164671839-164671861 GGTTTAATTGGTCTGTGGTGGGG + Intergenic
1000852905 5:166362269-166362291 GGGTTTATGGGTACAGGATGGGG + Intergenic
1002169000 5:177364928-177364950 GGTTCAGTAGGTCCAAGATGGGG - Intronic
1002475753 5:179464801-179464823 GTTTTTATGGGCCCAGGATGGGG + Intergenic
1002622488 5:180498165-180498187 GGGTTATTTGATCCAAGATGAGG + Intronic
1003339356 6:5204756-5204778 GGTTTATTTGGCCAAGGTTGAGG - Intronic
1004054131 6:12117703-12117725 GGTTGAATAGGTCCTGGATGGGG + Intronic
1004166170 6:13258405-13258427 GATTTAATTGGTTAAGAATGTGG + Intronic
1004417281 6:15436488-15436510 GTTTTCATAGGCCCAGGATGGGG + Intronic
1004705960 6:18123984-18124006 AGTTTAATTGGCCCATGGTGTGG + Intergenic
1007144584 6:39615555-39615577 GATTTGATTGGTCCAGGGTATGG + Intronic
1007524111 6:42476046-42476068 GATTCAGTTGGTCCAGGATGGGG - Intergenic
1009292267 6:61897200-61897222 GGTTTAATTGGCCTAGGGTATGG - Intronic
1010621816 6:78085882-78085904 GTTTTTATGGGTACAGGATGGGG + Intergenic
1011659625 6:89583072-89583094 GGTTTAGTTGGTCTGGGATATGG + Intronic
1012263273 6:97112013-97112035 GTTTTTATGGGTACAGGATGGGG + Intronic
1012692751 6:102335261-102335283 GTTTTTATGGGTACAGGATGGGG + Intergenic
1014253351 6:119137753-119137775 GGGTTTCTTGGTCCAGGAGGAGG - Intronic
1014276346 6:119394443-119394465 GTTTTTATGGGTGCAGGATGGGG + Intergenic
1014335008 6:120122487-120122509 TGTTTCATTTGTCCAGGATCAGG - Intergenic
1015143917 6:129964626-129964648 GATTTAATTGGTCTAGGGTGAGG + Intergenic
1015194509 6:130510550-130510572 GATTTTATGGGTACAGGATGGGG + Intergenic
1015622365 6:135144763-135144785 TGTTTAATTGGTCTGGGATGGGG - Intergenic
1016475560 6:144423233-144423255 GGCTTAATGGGTCTAGGGTGTGG - Intronic
1017392943 6:153960662-153960684 GGTTTGATGGGTCCAGGAAAGGG + Intergenic
1019043432 6:169124856-169124878 GTTTTAATGGGTACAGAATGGGG - Intergenic
1020406419 7:7840381-7840403 GATTTAATTGGTCTGGGGTGGGG - Intronic
1020942988 7:14563675-14563697 GGTTTAATTGGTCCACTGTTGGG + Intronic
1020990674 7:15192268-15192290 GTTTTTATGGGTACAGGATGTGG - Intergenic
1021770186 7:23992151-23992173 GGTTTAATCAGTCTAAGATGGGG - Intergenic
1023093241 7:36635503-36635525 GGTTTAATTGGTCTAGGGTGGGG + Intronic
1023307843 7:38849749-38849771 GGTTTTATAGGCACAGGATGGGG + Intronic
1024265085 7:47600233-47600255 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1024933365 7:54687788-54687810 GGTTTATTTGGCCAAGGTTGAGG - Intergenic
1025041030 7:55645954-55645976 GGTTTATTCGGTCCTGGATTTGG + Intergenic
1025820148 7:64955309-64955331 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1027533182 7:79361491-79361513 GTTTTTATAGGCCCAGGATGGGG - Intronic
1028299784 7:89183288-89183310 TGTTTAATTTCTCCAGGATCTGG - Intronic
1029038607 7:97549494-97549516 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1029137428 7:98383823-98383845 TGTTTCCTGGGTCCAGGATGGGG - Intronic
1029932048 7:104382567-104382589 GATTTAATTGTTCTAGAATGTGG + Intronic
1030257527 7:107527859-107527881 GTTTTAATTGGTCAGGGCTGTGG - Intronic
1030261172 7:107565435-107565457 GATTTAATTGGTCTAGGGTATGG + Intronic
1032316356 7:130842242-130842264 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1032625819 7:133590514-133590536 GTTTTTATGGGTACAGGATGGGG - Intronic
1033357786 7:140614452-140614474 GGTTTATTTTGCCCAGGTTGAGG - Intronic
1034240114 7:149603927-149603949 GATTTAATTGGTCTGGGGTGGGG - Intergenic
1034278545 7:149835737-149835759 GATTTAATAGGCCTAGGATGGGG - Intergenic
1034289278 7:149915539-149915561 TGGTCAATTGGTTCAGGATGAGG + Intergenic
1035220822 7:157405680-157405702 GGTTTAATTGGCGCAGGATGTGG - Intronic
1035281458 7:157781011-157781033 GGTGTGAGTGGACCAGGATGTGG - Intronic
1036374868 8:8191529-8191551 GGTTTAATTGTTCTTGGGTGTGG - Intergenic
1036686004 8:10910699-10910721 GGTTTAAAGGGCCCAGGAGGAGG + Intronic
1036876034 8:12474115-12474137 GGTTTAATTGTTCTTGGGTGTGG + Intergenic
1037666587 8:20975136-20975158 GATTTAATTGGTCTGGGGTGTGG - Intergenic
1038475279 8:27862006-27862028 GGTGTAATTGGTCCAAGCTTTGG - Intergenic
1039390047 8:37172115-37172137 GGTTTTATAGGAACAGGATGGGG + Intergenic
1040065800 8:43142672-43142694 GATTTAATTGGTCTGGAATGGGG + Intronic
1040787350 8:51181364-51181386 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1040969131 8:53114790-53114812 GGTTTATTTAGTCAAGGTTGAGG + Intergenic
1041988435 8:63954848-63954870 GTTTTTATGGGTACAGGATGGGG + Intergenic
1042238660 8:66640587-66640609 GTTTTTATGGGTACAGGATGGGG - Intronic
1042507106 8:69572686-69572708 GGCTTAGTAAGTCCAGGATGGGG - Intronic
1043562685 8:81513141-81513163 GGTATAATCATTCCAGGATGTGG - Intergenic
1043599768 8:81923375-81923397 GTTTTTATGGGTACAGGATGGGG - Intergenic
1044894055 8:96869726-96869748 GATTTAGTAGGTCCAGGGTGAGG - Intronic
1045333314 8:101176287-101176309 GATTTAATTGGTCTGGGGTGGGG + Intergenic
1045861479 8:106818975-106818997 GTTTTTATAGGCCCAGGATGGGG - Intergenic
1046142679 8:110115710-110115732 GGTTTTATAGGCACAGGATGGGG - Intergenic
1046229556 8:111335363-111335385 GTTTTTATAGGGCCAGGATGGGG + Intergenic
1046250564 8:111624859-111624881 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1046870202 8:119197355-119197377 GTTTTTATAGGTCCAGGATTGGG + Intronic
1047065201 8:121274239-121274261 GATTTAATTGGTCATGAATGTGG - Intergenic
1047202126 8:122776091-122776113 GTTTTTATAGGACCAGGATGAGG + Intergenic
1047222765 8:122931733-122931755 GATGTAACTGGTCTAGGATGTGG + Intronic
1048660289 8:136592160-136592182 AGTGTAATTGATCAAGGATGAGG + Intergenic
1048909526 8:139121631-139121653 GGTGTCATTGTTCCAGGAGGAGG + Intergenic
1049456180 8:142690841-142690863 AGTTTAATTTGTCAAGGTTGAGG + Intergenic
1049982019 9:912830-912852 GGTTTAACTGCTCTGGGATGTGG - Intronic
1050003002 9:1098514-1098536 GGTTTAGTAGGTCTAGGAGGAGG + Intergenic
1050784864 9:9388226-9388248 GTTTTTATAGGCCCAGGATGGGG + Intronic
1050803486 9:9644740-9644762 GTTTTTATGGGTACAGGATGTGG - Intronic
1050900882 9:10947358-10947380 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1051144020 9:14007549-14007571 GCTTTCATAGGCCCAGGATGGGG - Intergenic
1051863909 9:21657086-21657108 GATTTAATTGGTCTGAGATGTGG - Intergenic
1052024182 9:23556650-23556672 GGTTTAATTGGTCTGGGTTGGGG - Intergenic
1052289337 9:26824135-26824157 GTTTTTATGGGTACAGGATGGGG + Intergenic
1053032920 9:34797728-34797750 GGTTTTATAGGCACAGGATGGGG + Intergenic
1053264814 9:36704031-36704053 TGTTTAATTTGTCTAGGGTGGGG + Intergenic
1053525473 9:38825995-38826017 GGTTTTATAGGCACAGGATGGGG - Intergenic
1054197701 9:62050422-62050444 GGTTTTATAGGCACAGGATGGGG - Intergenic
1054640652 9:67537950-67537972 GGTTTTATAGGCACAGGATGGGG + Intergenic
1055754578 9:79544001-79544023 GATTTAATTGGTCTGGGGTGAGG + Intergenic
1056987562 9:91377640-91377662 GATTTAATTGGTCTAGGCTGCGG + Intergenic
1057889793 9:98860852-98860874 GGTTCAGTAGGTCTAGGATGGGG + Intergenic
1058057194 9:100460801-100460823 GATTCAGTAGGTCCAGGATGGGG - Intronic
1058321397 9:103636149-103636171 GATTTTATGGGTACAGGATGGGG - Intergenic
1059042655 9:110830825-110830847 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1060333206 9:122694677-122694699 GATTTAATTGGTCTAGGGTGTGG - Intergenic
1060934458 9:127507198-127507220 GGTCTCTGTGGTCCAGGATGAGG - Exonic
1061745215 9:132734404-132734426 GGTATACTTGGTCCAGGGTGAGG + Intronic
1061872974 9:133530427-133530449 CCTGTCATTGGTCCAGGATGGGG - Intergenic
1185942909 X:4341057-4341079 GTTTTTATAGGCCCAGGATGAGG + Intergenic
1186036505 X:5429057-5429079 GTTTTTATGGGTACAGGATGGGG + Intergenic
1186147732 X:6642272-6642294 GGTTTATTTTGTCAAGGTTGAGG - Intergenic
1186411585 X:9348713-9348735 GGTTTCATTGGTCTGGGGTGTGG + Intergenic
1186590892 X:10928918-10928940 GATTTAATTGGTCTAAGGTGGGG + Intergenic
1186730555 X:12405058-12405080 GATTTAATTGGTTTAGGGTGGGG - Intronic
1186898486 X:14029479-14029501 GATTTCATTGGTCCGGGATGGGG + Intronic
1187653929 X:21447882-21447904 AATTTAATGGGTCCAGTATGGGG - Intronic
1188187004 X:27128365-27128387 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1188435981 X:30159176-30159198 GGTTTAATTGGTTCATGGTTTGG + Intergenic
1189959110 X:46307835-46307857 GTTTTTATAGGTACAGGATGGGG + Intergenic
1190566089 X:51731911-51731933 GTTTTAATGGGTACAGGATAGGG - Intergenic
1190750463 X:53357542-53357564 GGTTTGTTTGGTCCAGGGTGGGG + Intergenic
1192439935 X:71166899-71166921 GGTTTAAATGGGCTAGGAAGGGG - Intronic
1193702544 X:84780443-84780465 GTTTTTATAGGCCCAGGATGGGG + Intergenic
1194690677 X:96980460-96980482 GTTTTTATGGGTACAGGATGGGG + Intronic
1195039318 X:100999817-100999839 GATTTAATTGGTCTGGGGTGTGG - Intergenic
1195432591 X:104806035-104806057 GGTTCAATTGATCTGGGATGAGG + Intronic
1195647594 X:107249944-107249966 GTTTTTATGGGTACAGGATGGGG + Intergenic
1196258925 X:113555011-113555033 GGTTTTATAGGCACAGGATGAGG + Intergenic
1197462129 X:126755506-126755528 GTTTTTATGGGTACAGGATGGGG + Intergenic
1197913723 X:131513370-131513392 GGTGCAATGGGCCCAGGATGGGG + Intergenic
1198386653 X:136135241-136135263 GGTTTTATAGGCACAGGATGGGG + Intergenic
1201412413 Y:13713442-13713464 GTATTTATAGGTCCAGGATGGGG + Intergenic