ID: 1157195603

View in Genome Browser
Species Human (GRCh38)
Location 18:45617938-45617960
Sequence CCTAAGCCTTCATTTTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157195603_1157195607 4 Left 1157195603 18:45617938-45617960 CCCTAGAAAAATGAAGGCTTAGG 0: 1
1: 0
2: 3
3: 42
4: 304
Right 1157195607 18:45617965-45617987 ACCTCTGAAGTGCTCTTAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1157195603_1157195609 5 Left 1157195603 18:45617938-45617960 CCCTAGAAAAATGAAGGCTTAGG 0: 1
1: 0
2: 3
3: 42
4: 304
Right 1157195609 18:45617966-45617988 CCTCTGAAGTGCTCTTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 108
1157195603_1157195606 1 Left 1157195603 18:45617938-45617960 CCCTAGAAAAATGAAGGCTTAGG 0: 1
1: 0
2: 3
3: 42
4: 304
Right 1157195606 18:45617962-45617984 TCAACCTCTGAAGTGCTCTTAGG 0: 1
1: 0
2: 0
3: 8
4: 134
1157195603_1157195610 11 Left 1157195603 18:45617938-45617960 CCCTAGAAAAATGAAGGCTTAGG 0: 1
1: 0
2: 3
3: 42
4: 304
Right 1157195610 18:45617972-45617994 AAGTGCTCTTAGGTGGGAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157195603 Original CRISPR CCTAAGCCTTCATTTTTCTA GGG (reversed) Intronic
902007044 1:13240492-13240514 CATATGCCTTCATTTTACTGAGG - Intergenic
902026093 1:13384772-13384794 CATATGCCTTCATTTTACTGAGG - Intergenic
902187452 1:14735912-14735934 CCAAAGCTTTTATTCTTCTATGG - Intronic
902638653 1:17751719-17751741 CCAAAGCCTGCCTTTTTCCATGG + Intergenic
902731740 1:18374250-18374272 CCTGAGCCTTCATTTCCTTATGG + Intronic
903090986 1:20916996-20917018 CATAAGCTGTCATTTTTCTTGGG - Intronic
903563003 1:24242923-24242945 CATAAGCTTTCATTTCTCTTGGG + Intergenic
903693066 1:25187804-25187826 CATATGCTTTCATTTTTCTTGGG - Intergenic
904674387 1:32189839-32189861 CATGTGCCTGCATTTTTCTAGGG + Intronic
906693341 1:47807427-47807449 CCCAAGCCTTCATTGTTGAATGG - Intronic
907235808 1:53046143-53046165 CGTAAGTTTTCATTTTTCTTCGG + Intronic
907873547 1:58464940-58464962 CCTAACCCATCATGTTGCTAAGG + Intronic
908115498 1:60936105-60936127 CCTCATCCTCCATTTTGCTATGG - Intronic
909698753 1:78496193-78496215 CTTAAGCCTGTATTTTTATAAGG - Intronic
909985924 1:82160546-82160568 CCTAAGCATTCATTTGGGTAGGG + Intergenic
911378071 1:97076058-97076080 CCTATGTCTTCATTTTTAAATGG + Intergenic
911520541 1:98924675-98924697 CCCAAGCCCACATTTTACTATGG - Intronic
911818929 1:102391403-102391425 CCTATGTGTTCATTTTTCTTGGG - Intergenic
912342361 1:108929257-108929279 CCTAAGACGTGATTTTTTTAAGG + Intronic
913175707 1:116271298-116271320 CCTAGGGCTTCAGTCTTCTAAGG + Intergenic
913193885 1:116437289-116437311 CCTAAGTATTTATTTTTTTAAGG + Intergenic
915849010 1:159301053-159301075 CCAAAACCTTTAGTTTTCTATGG - Intronic
916478575 1:165194026-165194048 ACTAAGCTTTAAGTTTTCTAAGG + Intergenic
916743375 1:167665450-167665472 CATAAGCTTTCATTTCTCTTGGG + Intronic
917216954 1:172688992-172689014 CCCAAACCTTCATTTTTGAAGGG + Intergenic
917813951 1:178688609-178688631 CCAATGCTTTCATTTTTCAATGG + Intergenic
918651751 1:186973308-186973330 TCTCTGCCTTCATTTTTGTATGG + Intronic
918700100 1:187597651-187597673 CCTGAGCATTCTGTTTTCTAAGG - Intergenic
918917415 1:190662048-190662070 CCTAAGTCTTTTTTATTCTAAGG - Intergenic
919793692 1:201308573-201308595 CCAAATCCTACATTTATCTAAGG - Intronic
920271917 1:204771819-204771841 CCAAAGCCTTCATTCTGCTCAGG + Intergenic
920733157 1:208507586-208507608 CCTAAGATTTCATTTTTCTTAGG - Intergenic
922462212 1:225822647-225822669 GCTAAGCCTTCACCTTTCCAAGG - Intronic
924004782 1:239597224-239597246 CCTATACCTTCTTTTTTCTCCGG - Intronic
924290750 1:242534172-242534194 CCTCAGCCTTTACCTTTCTATGG - Intergenic
924483391 1:244456454-244456476 TGTAAGCGCTCATTTTTCTAAGG - Intronic
924837754 1:247671300-247671322 CCTTAGCCTTCATTCTACTTGGG + Intergenic
924933860 1:248751673-248751695 GCTAAGGCTTGATTTTTCTTAGG - Intronic
1063522705 10:6755307-6755329 CCAAAGCCTTCAAGTTTCAAAGG + Intergenic
1064365537 10:14704168-14704190 CCTAAGCCTTAAAATCTCTAAGG - Intronic
1064445771 10:15391569-15391591 CCCAAGCCTTCATTTCTAAAAGG + Intergenic
1065578568 10:27148832-27148854 CTTAATCCTTCATTTGTTTAAGG + Intronic
1066176214 10:32909688-32909710 CATAAGCTTTCATTTCTCTTGGG - Intronic
1067397237 10:45933235-45933257 CATATGCCTTCATTTTTATATGG - Intergenic
1067852939 10:49766782-49766804 CATAAGTCTTCATTTCTCTGGGG + Intergenic
1067865559 10:49902336-49902358 CATATGCCTTCATTTTTATATGG - Intronic
1068095544 10:52486832-52486854 TCTAAGTCCTCATTTTTCTCTGG - Intergenic
1068327836 10:55517998-55518020 TCTCAGCCTTCAGTTTTCTCAGG - Intronic
1069238582 10:66109495-66109517 CCTAAGCCTCCAAATTTCCAGGG - Intronic
1071316526 10:84405951-84405973 TATAAGCTCTCATTTTTCTATGG - Intronic
1073389603 10:103163265-103163287 CCTAAGTTTTCATTTCTCTAGGG + Intronic
1073651015 10:105358114-105358136 TCTGAGCCTTCATTCTTTTATGG + Intergenic
1074427463 10:113364494-113364516 GATAAGCCTTCATTTTGCTTTGG - Intergenic
1074542982 10:114381026-114381048 CATATGCTTTCATTTTTCTTGGG - Intronic
1075579449 10:123606043-123606065 CCTATGCCTGCATTTTTCACAGG - Intergenic
1076505344 10:130969065-130969087 CATATGTCTTCATTTTTCTTGGG - Intergenic
1077819625 11:5724165-5724187 CCTAAAACCTAATTTTTCTATGG - Intronic
1078970738 11:16408152-16408174 CACAAGCCTTGATTTTTCTATGG - Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1081121704 11:39274266-39274288 GCTAAGCCTTTACTATTCTAGGG - Intergenic
1082955100 11:58862789-58862811 CATAAGCCTTTATTTCTTTAGGG + Intronic
1085583205 11:77674510-77674532 CCTAAACCTTCATCTTCATAGGG - Intronic
1086299377 11:85409241-85409263 CTGAAGCTTTCATTTTTCTCTGG - Intronic
1086387196 11:86321412-86321434 CCTATGCTTTCATTTCTCTTGGG + Intronic
1087438028 11:98146955-98146977 CTTATGCCTCCCTTTTTCTAAGG + Intergenic
1087569739 11:99910269-99910291 CAAAAACCTTCATTTTTCTATGG + Intronic
1088178192 11:107078317-107078339 CATAAGCTTTCATTTTTCTTGGG + Intergenic
1089740775 11:120580757-120580779 CCTAAGTTTTCATTTCTCTAGGG + Intronic
1090561265 11:127935361-127935383 CCAAAGTCTACATTTTTGTAAGG + Intergenic
1092082601 12:5729664-5729686 CGTATGCTTTCATTTTTCTTGGG - Intronic
1093659280 12:21735805-21735827 CTTAAGCCTCCATCTTTCCATGG + Intronic
1094672096 12:32580222-32580244 TCTAAGCCTAGATTTCTCTATGG + Intronic
1096017671 12:48293291-48293313 TTTTAGCTTTCATTTTTCTAGGG - Intergenic
1096063097 12:48718433-48718455 GCAATGCCTTCATTTTTGTATGG + Intergenic
1097723813 12:63051768-63051790 CCCAAACCTTCTTTTATCTATGG - Intergenic
1100578884 12:95919990-95920012 CCTATGCTTTCATTTCTCTTTGG - Intronic
1100683123 12:96951683-96951705 CTTAAGCCTTCTTTTTTCCATGG + Intronic
1101155307 12:101922351-101922373 CCTAAGCCTTAACATTTCAAGGG - Exonic
1101237273 12:102802403-102802425 CCAAAGCCATCATTTTCCTCTGG + Intergenic
1101356309 12:103980827-103980849 CCTAAGCCTTAGCGTTTCTATGG - Intronic
1103109622 12:118264236-118264258 CATAAGCTTTCATTTTTCTTGGG - Intronic
1107230332 13:38101970-38101992 CATAAGCCTTCATTGTTCTTAGG + Intergenic
1108009808 13:45994362-45994384 CCTACCCCTTCATTGTTCAAGGG + Intronic
1108584089 13:51852907-51852929 CCTAAGCACTCATTGTTCAAGGG - Intergenic
1108806447 13:54162451-54162473 TCTCTGCCTTCATTTTTATATGG + Intergenic
1109845743 13:67988393-67988415 CCTTGGCCTCCATTTTTCTCAGG + Intergenic
1110670017 13:78166972-78166994 CTTAAGCCATCATCTTTCTAAGG + Intergenic
1110833879 13:80062729-80062751 CCCAAACCTTCATTTTTGAAGGG + Intergenic
1111075488 13:83229792-83229814 CCTAAGCCTCCTTTTTGATAAGG - Intergenic
1111504098 13:89163446-89163468 CATATGCCTTCATTTCTCTATGG - Intergenic
1111530714 13:89534179-89534201 CTCAGGCCTTCCTTTTTCTAAGG - Intergenic
1112447205 13:99475172-99475194 CATAAGCTTTCATTTCTCTAGGG + Intergenic
1112682393 13:101781916-101781938 ACTATGCTTTCATTTTTCTCTGG + Intronic
1114901492 14:27065385-27065407 CATATGCAATCATTTTTCTAGGG + Intergenic
1116491764 14:45511985-45512007 CATAAGTTTTCATTTCTCTAAGG + Intergenic
1116999554 14:51358413-51358435 CCTAAGCCTTCAAAATACTAAGG + Intergenic
1117495256 14:56296034-56296056 CATGAGCCTTCATTTTTAGAAGG - Intronic
1117593518 14:57301831-57301853 CATAATCCTACATGTTTCTAGGG + Intergenic
1117865267 14:60141857-60141879 CATAAGCTTTCATTTCTCTTGGG + Exonic
1119014238 14:71032677-71032699 TCTAATCCTTCATTGTTCTCTGG - Intronic
1121216084 14:92249141-92249163 TATAAGTGTTCATTTTTCTAGGG + Intergenic
1121216137 14:92249568-92249590 CGTAAGTGTTCATTTTTCTAGGG - Intergenic
1121709859 14:96029903-96029925 ATTAAGCCTTCTCTTTTCTAGGG - Intergenic
1123792647 15:23737756-23737778 CCGAAGTCTTCATCTCTCTAGGG + Intergenic
1123962661 15:25421960-25421982 CATATGTTTTCATTTTTCTAGGG - Intronic
1124070822 15:26391665-26391687 CCTAAGTATCCATTTTTCCACGG - Intergenic
1124120654 15:26885723-26885745 CCAAACCCTTCCTTTTTCCATGG - Intronic
1126611197 15:50531221-50531243 CCTAAGGCTTCATTTCTCTTGGG - Intronic
1127092665 15:55481920-55481942 GCCAAGCCTTCATTTGTGTAGGG + Intronic
1128659243 15:69485785-69485807 CATAAGTTTTCATTTCTCTAGGG + Intergenic
1131547730 15:93329896-93329918 ACTCTGCCTTCATCTTTCTATGG + Intergenic
1132165645 15:99586158-99586180 CATATGCTTTCATTTTTCTTGGG + Intronic
1132361018 15:101215352-101215374 CCTACCCCTTCATCTTTTTATGG - Intronic
1133394364 16:5434226-5434248 TCTAAGGCCTCATTTTGCTAAGG - Intergenic
1133653559 16:7836391-7836413 TCTCAGTCTTCATTATTCTACGG - Intergenic
1133872897 16:9706145-9706167 CCTCAACCTTTATTTTTCTTAGG - Intergenic
1134381914 16:13735444-13735466 ACTATGTCTTCATTTTTCTTGGG + Intergenic
1137454301 16:48606419-48606441 CCTCAGCCTTCATCTTTCCCAGG + Intronic
1137855872 16:51794225-51794247 CCTAAATCTCCATTTTGCTAGGG - Intergenic
1137915126 16:52421663-52421685 GATAATCCTTAATTTTTCTAAGG - Intergenic
1139012776 16:62653374-62653396 CATATGCTTTCATTTTTCTTGGG + Intergenic
1140983304 16:80132252-80132274 CATAAGTTTTCATTTCTCTAGGG + Intergenic
1142313424 16:89327731-89327753 CCTAAGCATTTATTTTTATTTGG - Intronic
1146199582 17:30844813-30844835 CCCAAGTATTTATTTTTCTAAGG + Exonic
1146960483 17:36971583-36971605 TGTATGTCTTCATTTTTCTAGGG - Intronic
1147916565 17:43891097-43891119 CCTAGACCTTTATTCTTCTAGGG + Intronic
1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG + Intronic
1150675445 17:67242789-67242811 CCTAAGTTTTTATTTTTTTAAGG + Intronic
1150861895 17:68809183-68809205 CCTAACCAATCATTTTTCTGGGG + Intergenic
1151141807 17:72000379-72000401 CCTAAGAATTCAGTGTTCTATGG + Intergenic
1153513186 18:5877808-5877830 CCTAAGCCTTCCTTCTTGAAAGG - Intergenic
1154247923 18:12716116-12716138 CATAAGCCATAATTTTTCCATGG + Intronic
1155335381 18:24758746-24758768 CATAAGTTTTCATTTCTCTAGGG + Intergenic
1155607541 18:27624569-27624591 CCTAAGTTTTCATTTCTCTTGGG - Intergenic
1156169690 18:34467414-34467436 CATATGTTTTCATTTTTCTAGGG - Intergenic
1156678695 18:39563194-39563216 CACAAGCTTTCATTTTTCTTGGG - Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157870681 18:51227722-51227744 CCCAAGCCTTCATTTCTGAAGGG + Intergenic
1158160465 18:54477293-54477315 CCTATGCTTTCATTTATCTTGGG - Intergenic
1158566251 18:58556627-58556649 CCTAAGCCCTCATTATACCAAGG + Intronic
1160017584 18:75156486-75156508 CCAAAGCCTTCCTTTCTTTAGGG + Intergenic
1160045454 18:75382543-75382565 CCCAAAACTCCATTTTTCTATGG - Intergenic
1165142384 19:33707741-33707763 CCTATGTTTTCATTTTTCTTGGG + Intronic
1166483021 19:43188700-43188722 CCTTGGCATTCATTTTTATAAGG + Intronic
926433287 2:12812718-12812740 CATATGCTTTCATTTTTCTTGGG - Intergenic
928346149 2:30498363-30498385 GCTAAGTCTTCATTTATATAGGG - Intronic
931528828 2:63189482-63189504 TCCAGGCCCTCATTTTTCTATGG - Intronic
931604425 2:64038165-64038187 CATATGCTTTCATTTTTCTTTGG + Intergenic
931806494 2:65812197-65812219 CATAACCCTCCATTTTCCTATGG + Intergenic
932654221 2:73594642-73594664 CCTAAGGCTTCAGTTATCAAAGG + Intronic
933203849 2:79482454-79482476 CCTAAGCCTTTATGTTTTTCAGG - Intronic
933505333 2:83170145-83170167 CCTGAGCATTCACTTTTTTATGG - Intergenic
933523507 2:83405445-83405467 CCTAAGCCACCATTCTTCAAAGG + Intergenic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
934864262 2:97791887-97791909 CCTCAGCTTTCATGCTTCTATGG - Intronic
935930070 2:108114183-108114205 CTTAAGACTTCATTTCTTTAAGG + Intergenic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
936480564 2:112881038-112881060 CATAAGCCTTCATCTTTCCTTGG - Intergenic
936679593 2:114754739-114754761 TCTAAGCATTGATTTTTCTCAGG + Intronic
937666609 2:124495034-124495056 CCTATGCCTACATATTTATATGG + Intronic
937965654 2:127506718-127506740 CTTAAGCTTTCTTGTTTCTAGGG - Intronic
938410185 2:131057192-131057214 CCTGTGTTTTCATTTTTCTAGGG - Intronic
940232878 2:151477119-151477141 GCTAAATCTTCATTTTGCTATGG + Exonic
940233720 2:151486506-151486528 CCTATGTCTTCATTCTTCTTGGG - Intronic
941317084 2:164007070-164007092 CCTAAACCTACAGTTTTCTGTGG - Intergenic
941669321 2:168274403-168274425 CATATGCTTTCATTTTTCTTAGG + Intergenic
943288576 2:186038662-186038684 TCCAAGCATTCATTTCTCTATGG - Intergenic
943644288 2:190392031-190392053 CATATGCCTTCATTTCTCTTGGG + Intergenic
943763261 2:191632306-191632328 CCTTAGCCCTCATTCTTCTTTGG + Intergenic
944041723 2:195363314-195363336 CCTAGGACACCATTTTTCTACGG - Intergenic
944863433 2:203837370-203837392 CATAAGTTTTCATTTCTCTAGGG - Intergenic
946555429 2:220851549-220851571 CATAAGTTTTCATTTCTCTAGGG + Intergenic
946915688 2:224518456-224518478 CATATGCTTTCATTTTTCTTGGG + Intronic
947041626 2:225928501-225928523 CATAAGTCTTCATTTTTTTATGG + Intergenic
947085254 2:226443958-226443980 CCTAAGGATACATTTTTCTAAGG + Intergenic
948668286 2:239549996-239550018 TCTCAGCCTTCTGTTTTCTATGG - Intergenic
1168733618 20:110217-110239 CCTAACCCTGCATATTTCAAAGG - Intergenic
1168784168 20:523307-523329 CCTAAGTTTTCATTTTTCTAGGG - Intronic
1170162344 20:13326300-13326322 CCTAAGATTTCATTTCTCTAGGG + Intergenic
1170314445 20:15028095-15028117 CCTTAGCCTCCCTTTTGCTAGGG - Intronic
1170880682 20:20294536-20294558 TCTAAGCCCTCATTTCTGTAAGG + Intronic
1170924507 20:20711449-20711471 CCTAAGTCTTAACTTTTCTTTGG - Intronic
1171323839 20:24273143-24273165 CCTCAGGTTTCATTTGTCTAAGG + Intergenic
1172988036 20:39008906-39008928 CCTGAGCCTCCATTTCTCTTTGG + Intronic
1173397588 20:42694535-42694557 CATAAGTTTTCATTTTTCTGGGG + Intronic
1174196937 20:48779509-48779531 CATAAGTTTTCATTTCTCTAGGG - Intronic
1174250364 20:49214990-49215012 CCTCAGCCTTCATTTATGTGAGG - Intergenic
1175425628 20:58864071-58864093 TCTGTGCCTCCATTTTTCTAGGG + Intronic
1177642022 21:23855736-23855758 AATAAGCATTCATTATTCTAGGG + Intergenic
1179566951 21:42254903-42254925 CCAAAGCCGTGATTTTTCTTTGG - Intronic
1180585259 22:16882789-16882811 CATAAGCTTTCATTTGTCTTGGG - Intergenic
1183874930 22:40772072-40772094 CATATGCCTTCATTTCTCTTGGG + Intronic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
949843569 3:8348190-8348212 CATAAGCTTTCATTTATCTTGGG - Intergenic
950795316 3:15505840-15505862 TCCATGCCTTCATTTTTCCATGG + Intronic
951130786 3:19041442-19041464 CCTATGCTTTTATTTTTCTCAGG - Intergenic
957702536 3:83734919-83734941 CCTAAGCCTTCTTTTTTCCAGGG + Intergenic
959570653 3:107879944-107879966 CATATGCCTTCATTTCTCTCGGG + Intergenic
959979926 3:112504543-112504565 CCTCAGCCTTCAGTCTTGTATGG - Intergenic
960915759 3:122693333-122693355 TCTAAGCCTTCACTATTCCATGG + Intronic
961085351 3:124062693-124062715 ATTAGGCCTCCATTTTTCTAAGG - Intergenic
961632230 3:128309509-128309531 CCTAAGCCTTTATTTTCAGATGG + Intronic
961991842 3:131200486-131200508 CATAAGCATACATGTTTCTAAGG - Intronic
962077503 3:132099018-132099040 CATAAGTTTTCATTTTTCTTTGG - Intronic
964935319 3:162077374-162077396 CGTAAGCTTTCATTTTTCTGGGG + Intergenic
964954884 3:162341404-162341426 CCAATTCCTTCATTTTTTTATGG - Intergenic
967368543 3:188716195-188716217 ACTAGGCCTTCATTTTTCAAAGG + Intronic
968496106 4:916850-916872 CATGTGCCTTCATTTTTCTTGGG - Intronic
970762798 4:19512182-19512204 CCTATGCCTTTAGTTTTCCATGG - Intergenic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971863318 4:32137567-32137589 CCCAAGCCTTCATTTTCCCTGGG - Intergenic
972722632 4:41715909-41715931 CCTGAGCCTTCATATTTCTAGGG - Intergenic
973157920 4:46980544-46980566 CCTAAGGCTCTATTTTTCTTAGG - Intronic
975791256 4:77954331-77954353 CCTAAGTTTTAATTTTTCTGTGG - Intergenic
975795216 4:77999847-77999869 CCTAACCTTTCATTGTTCAAGGG - Intergenic
978039787 4:104045645-104045667 CACAAGCCTTCATTTTTGAAAGG - Intergenic
978226757 4:106344343-106344365 CCTAGACTTTCATTTTTCCATGG + Intronic
978524626 4:109653005-109653027 CATAAGCTTTCATTTCTCTAGGG + Intronic
979111227 4:116760776-116760798 CATATGCTTTCATTTCTCTAGGG + Intergenic
981224719 4:142280199-142280221 CCTAAGTTTTCATTTCTCTAGGG - Intronic
981558396 4:146021193-146021215 CCTCAGCCTTTGTTTGTCTAGGG + Intergenic
981778977 4:148403447-148403469 CCTAAACTTGTATTTTTCTATGG - Intronic
982275483 4:153632920-153632942 GCCTAGCCTTCATTTTTGTAAGG - Intronic
982694311 4:158582234-158582256 TGTAAATCTTCATTTTTCTATGG + Intronic
982953232 4:161727610-161727632 CCTAACCCTGCATTTTTGCATGG + Intronic
984019886 4:174472427-174472449 CCTAGGTTTTCATTTTTGTAAGG + Intergenic
984824808 4:183915034-183915056 CCTAAGCCGTAATTTTTCAACGG - Intronic
986566788 5:9123645-9123667 ACTAAGCTTTCATTTTTTAAAGG - Intronic
988850498 5:35175621-35175643 CCTAAGCCTTAATATTTCAGAGG + Intronic
989488119 5:42015735-42015757 CTTAAATCCTCATTTTTCTATGG - Intergenic
989745005 5:44818850-44818872 TGTAAGCTTTCATTTTCCTAAGG - Intronic
990109272 5:52304029-52304051 CATAAGTTTTCATTTCTCTAAGG - Intergenic
990992033 5:61696017-61696039 CATAAGTTTTCATTTCTCTAGGG - Intronic
993435961 5:87894438-87894460 CCTACTCCTTCTTTTATCTAAGG + Intergenic
993983888 5:94574096-94574118 CCTTTGCCTTCCTTTTTCTTGGG - Intronic
993998083 5:94746138-94746160 CCTAAATCCTCAGTTTTCTAAGG - Intronic
994440619 5:99798933-99798955 CATAACCCTGCATCTTTCTACGG + Intergenic
994767446 5:103936676-103936698 CCAAAGCCTTCATTTTAGCATGG + Intergenic
995479270 5:112578859-112578881 ACTAAGCATTCTTTTTGCTAGGG + Intergenic
995634107 5:114165895-114165917 CCTAACCCCACATTTTTCAAGGG + Intergenic
997059268 5:130480874-130480896 CATATGCTTTCATTTCTCTAGGG - Intergenic
997127485 5:131242792-131242814 CAGTAGTCTTCATTTTTCTAGGG + Intergenic
997339302 5:133130300-133130322 CCTCAGCCTTCATCTTTCAGAGG - Intergenic
997357642 5:133274057-133274079 CCCAAGTGTTCATTTTTCTTTGG + Intronic
998069146 5:139183128-139183150 CCTAAGTCATCAGCTTTCTAGGG + Intronic
998683798 5:144501039-144501061 CAGAAGCCTTCCTTTTTCTCGGG - Intergenic
998858371 5:146418198-146418220 GCTATGCTTTCATTTTTCTTGGG - Intergenic
999227535 5:150038929-150038951 CCTAAGTTTTCATTTCTCTTGGG + Intronic
999403233 5:151283655-151283677 CCACAGCCTTCATTTTTCCAAGG - Intronic
1000770921 5:165352722-165352744 CATAAGCACTGATTTTTCTAAGG - Intergenic
1002969644 6:2000983-2001005 CCTATGCTTTCATTTCTCTTGGG + Intronic
1003160792 6:3632652-3632674 CTTTAGCCTACTTTTTTCTATGG - Intergenic
1004109853 6:12706695-12706717 CATATGCCTTCATTTCTCTTAGG + Intergenic
1004717735 6:18234410-18234432 TCTAACCACTCATTTTTCTATGG + Intronic
1005198950 6:23321502-23321524 CCTAAGGGATCATATTTCTATGG + Intergenic
1005610697 6:27521558-27521580 CCTAAGACTTCATATGACTAGGG - Intergenic
1006537245 6:34709620-34709642 CCTTAGCATACATTTTTCAAGGG + Intergenic
1007050385 6:38822234-38822256 CCAATGCTTTTATTTTTCTAGGG - Intronic
1007123564 6:39403641-39403663 CCTAAGTTTTCATTTCTCTAGGG + Intronic
1007155192 6:39736182-39736204 TGTAAGCCTTCATTTATCTAGGG + Intergenic
1008241416 6:49117309-49117331 CCTTTGCCTTCTTTTTTTTAGGG + Intergenic
1008387487 6:50909294-50909316 CTTAGGCTTTCATTTTTCTTGGG + Intergenic
1008493629 6:52111098-52111120 CCAAAGCCATCATTTTTCAATGG + Intergenic
1010965993 6:82209226-82209248 CCTATGTTTTCATTTTTCTTGGG - Intronic
1010986197 6:82427247-82427269 CCTAAGCATTCATTTTTCAGTGG + Intergenic
1011096408 6:83669980-83670002 CATATGCCTTCATTTCTCTTGGG + Intronic
1011710554 6:90048394-90048416 CCTAAGCCTTCATGCTGCCATGG + Intronic
1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG + Intronic
1015748054 6:136531902-136531924 TCTTAGCTTTCTTTTTTCTATGG - Intronic
1016351212 6:143170455-143170477 CCTGATCCTTCGTATTTCTATGG + Intronic
1016486683 6:144547501-144547523 ACTAAGAATTAATTTTTCTATGG + Intronic
1016817085 6:148313042-148313064 CCTAAGACTTCTTTTTTGTTGGG - Intronic
1017331274 6:153200413-153200435 ACTCAGCCTTCATTATTATATGG + Intergenic
1017413010 6:154189387-154189409 CATATGCCTGCATTTCTCTACGG - Intronic
1017480122 6:154845132-154845154 CCTAAGCCATAATTGTTCTGTGG - Intronic
1018276825 6:162141369-162141391 CCTAATGCTTTATTTTTCAATGG + Intronic
1018606048 6:165599269-165599291 CGTAAGCCTTCACCTTTATAAGG + Intronic
1019579621 7:1754335-1754357 CTTAAGTTTTCATTTTTCTGGGG + Intergenic
1019943150 7:4307056-4307078 CATATGTCTTCATTTCTCTAGGG + Intergenic
1020235646 7:6353364-6353386 CCTAAACTTGCATTCTTCTAAGG - Intergenic
1020537455 7:9418999-9419021 CATATGCCTTCATTTATCTTGGG + Intergenic
1021291433 7:18850398-18850420 CCTACGCTTTCATTTTTGGAAGG - Intronic
1022353730 7:29590178-29590200 CCTAAATTTTCATTTCTCTATGG + Intergenic
1028284803 7:88982582-88982604 CCTAATCTTTCCTTTTTATAAGG + Intronic
1029862042 7:103583094-103583116 TATAATCCTCCATTTTTCTAGGG + Intronic
1030559331 7:111064965-111064987 CCTAAACCTTCATTTCTGAAGGG - Intronic
1031495261 7:122439036-122439058 CATAAGCATTCATTTCACTAAGG - Intronic
1031681759 7:124683556-124683578 CCTGATTCTTCATTTTTCCAGGG - Intergenic
1032813637 7:135448591-135448613 CCTTTGCCTTTATTTTTCTCTGG - Intronic
1032980550 7:137277410-137277432 CCTAAGTTTTCATTTTTCTTGGG - Intronic
1033575773 7:142683008-142683030 CCTAATCCTTCATGTTTAAATGG + Intergenic
1033892507 7:146032461-146032483 ACTGACACTTCATTTTTCTATGG + Intergenic
1034901276 7:154909476-154909498 CCCAAGCCTTCGTGTTGCTAAGG - Intergenic
1034999474 7:155601273-155601295 CCTAAGTTTTCATTTTTCTTGGG - Intergenic
1035422781 7:158743166-158743188 CCTAAGTCTTAACTTTTCAAAGG - Intronic
1037502804 8:19501450-19501472 TCAAAGCCTTCACTTTTCTGTGG + Intronic
1037555751 8:20020539-20020561 CCTAAGCTTCCCTTTCTCTATGG + Intergenic
1038098645 8:24345947-24345969 CCCAAGCCTTGTTTTTTTTAGGG + Intronic
1038125014 8:24663848-24663870 CCCAAGCTCTCATTTTTTTAAGG + Intergenic
1039227871 8:35409229-35409251 CATACGTCTTCATTTTTCTGGGG + Intronic
1039768785 8:40661575-40661597 CTTAAGGCTACTTTTTTCTATGG + Intronic
1041208255 8:55520728-55520750 AGAAAGCCTTCATTTTTCTACGG + Intronic
1041707654 8:60863556-60863578 CATAAGTTTTCATTTTTCTAGGG + Intronic
1041935015 8:63324256-63324278 CCTATGCCTTCATTTCTCCCTGG - Intergenic
1042963913 8:74330639-74330661 CCTAATCCTTCATTTCTGGAAGG - Intronic
1043985322 8:86688361-86688383 CATAAGCCTTAATTTTTTTCAGG + Intronic
1043991124 8:86756178-86756200 CCTAAGCATTCATTTCTCTTGGG - Intergenic
1044096112 8:88067901-88067923 CATAAGTTTTCATTTTTCTTGGG + Intronic
1044385160 8:91579293-91579315 CCTAAGTCTTCACTTTTCTTGGG + Intergenic
1044817289 8:96126077-96126099 TCTGAGCCTTCATTTTCCTTTGG - Intergenic
1045286655 8:100797427-100797449 CCGAAGCGTTCATGTTTTTAAGG + Intergenic
1045745317 8:105412211-105412233 CCTTCCCCTTCATTTTTCAATGG + Intronic
1046610795 8:116423099-116423121 CATAAGTTTTCATTTCTCTAGGG - Intergenic
1046907051 8:119584900-119584922 CCCAAGCCCTTATTTTTCCAAGG - Intronic
1047242493 8:123104701-123104723 CCTATACCTTCATTTTTATGGGG - Intronic
1047586300 8:126277602-126277624 CCAAAGCCTTCCTCTTCCTAGGG + Intergenic
1048750903 8:137673943-137673965 CATAAGTTTTCATTTTTCTTTGG - Intergenic
1048793991 8:138131522-138131544 CCTAGCCCTTTATTTTCCTAAGG + Exonic
1051173365 9:14341667-14341689 CCTCAGACTTCCTTTTTCCATGG - Intronic
1051198081 9:14585916-14585938 CAGATGCCTTCATGTTTCTAGGG - Intergenic
1052143220 9:25014868-25014890 CCTACGCATCCATTTTTTTATGG - Intergenic
1053398206 9:37794432-37794454 CATAAGCTTTCAATTTTCTTGGG - Intronic
1054785055 9:69202431-69202453 CCTAACCTCTCATTTTTCTAGGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057115109 9:92513452-92513474 CCTAAGTGTTCATTTCTCTAGGG - Intronic
1057224027 9:93277365-93277387 CATAAGTTTTCATTTTTCTAGGG - Intronic
1057720118 9:97525547-97525569 CCTAAGCTTTCATTTCTGAAAGG + Intronic
1057762028 9:97883741-97883763 CATATGCTTTCATTTTTCTTGGG - Intergenic
1058938276 9:109789542-109789564 GCTAACCCTTCATTTTTGGAAGG + Intronic
1059654722 9:116347231-116347253 GCTCAGCCTTCCTTTGTCTATGG + Intronic
1059661200 9:116402698-116402720 ACTAAGTTTTCATTTGTCTAAGG + Intergenic
1186883007 X:13885327-13885349 GCTAAGAATTCCTTTTTCTAAGG - Intronic
1187020275 X:15374229-15374251 CATAAGGCTTCATTTATCAAGGG - Intronic
1187955689 X:24516347-24516369 CATATGCCTTCATTTATCTTGGG - Intronic
1190378859 X:49818442-49818464 CTTAAGCCTTTATTTCTGTAAGG + Intergenic
1190491306 X:50984938-50984960 CATATGCTTTCATTTTTCTTAGG - Intergenic
1190689764 X:52903738-52903760 CCTAAGTTTTCATTTCTCTAGGG + Intronic
1190696219 X:52952054-52952076 CCTAAGTTTTCATTTCTCTAGGG - Intronic
1192536304 X:71930883-71930905 CATATGCTTTCATTTTTCTTGGG + Intergenic
1193143823 X:78057281-78057303 GATAAGTTTTCATTTTTCTAGGG + Intergenic
1195204637 X:102584672-102584694 CATAAGTTTTCATTTTTCTTGGG + Intergenic
1195634055 X:107092866-107092888 TATATGCCTACATTTTTCTAAGG - Intronic
1198412236 X:136382555-136382577 CCCAAGCCTTCATTTTTGAAGGG + Intronic
1198971708 X:142288807-142288829 CATAAGCCTTCAGTTATCTTGGG - Intergenic
1199146226 X:144370853-144370875 CATATGCTTTCATTTCTCTAGGG + Intergenic
1199259483 X:145754567-145754589 CATATGCCTTAATTTCTCTAGGG + Intergenic
1199617217 X:149666592-149666614 CCTATGAGTTAATTTTTCTAAGG - Intergenic
1199625424 X:149736657-149736679 CCTATGAGTTAATTTTTCTAAGG + Intergenic
1199710580 X:150466417-150466439 TCTGAGCTTTCATTTTTCAATGG - Intronic
1200036227 X:153333531-153333553 CATATGCTTTCATTTTTCTTGGG - Intergenic