ID: 1157195944

View in Genome Browser
Species Human (GRCh38)
Location 18:45620136-45620158
Sequence TATTCCCTAGAGGAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157195936_1157195944 20 Left 1157195936 18:45620093-45620115 CCCGTTGTAACAGAGTAAACATT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1157195941_1157195944 -4 Left 1157195941 18:45620117-45620139 CCGTGGCAAAGGAACGCTGTATT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1157195937_1157195944 19 Left 1157195937 18:45620094-45620116 CCGTTGTAACAGAGTAAACATTC 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1157195934_1157195944 29 Left 1157195934 18:45620084-45620106 CCAAAATTCCCCGTTGTAACAGA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1157195940_1157195944 -3 Left 1157195940 18:45620116-45620138 CCCGTGGCAAAGGAACGCTGTAT 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1157195935_1157195944 21 Left 1157195935 18:45620092-45620114 CCCCGTTGTAACAGAGTAAACAT 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157195944 Original CRISPR TATTCCCTAGAGGAGGTGCA AGG Intronic
904364185 1:29999977-29999999 TTGTCCCTTGAGGAGATGCATGG + Intergenic
907694374 1:56707077-56707099 TATTGCCTTGGGGAGGTGGAGGG - Intronic
909532020 1:76692416-76692438 TATTCCCTAGATGTGGGACATGG - Intergenic
918257787 1:182765581-182765603 TATTCCCAACGGGAGGTGAATGG - Intergenic
920333733 1:205230002-205230024 TTTTCTCCAGAGAAGGTGCAGGG + Intronic
922012218 1:221600300-221600322 TGTGCCAGAGAGGAGGTGCAAGG - Intergenic
1066486596 10:35851905-35851927 ACTTCCCAAGAGGAGGGGCATGG + Intergenic
1067307586 10:45079511-45079533 AATTCCCAAGAGGAAGGGCATGG + Intergenic
1069606382 10:69741357-69741379 TATGCCTTTGAGGAGGTACAGGG + Intergenic
1072793333 10:98335390-98335412 TTTTCCTTAGAGGTGGTGCAGGG - Intergenic
1077931727 11:6739884-6739906 TATGCCCCAGAGCAGGTGCTAGG + Intergenic
1079715562 11:23739324-23739346 TATTGCTTAGAGATGGTGCATGG + Intergenic
1080566308 11:33512714-33512736 TATTACCTAGAGCAGGGGCCGGG - Intergenic
1080778848 11:35412238-35412260 TATTCCCTAGGGGATTTTCAAGG + Intronic
1081091131 11:38867441-38867463 CATCCCCTAGAGCAGCTGCAGGG - Intergenic
1083277099 11:61603069-61603091 TGCTCCCTAGAGGGGGTGCAGGG - Intergenic
1083701086 11:64478052-64478074 GATTCCCTAGAGGTGGAGCCTGG + Intergenic
1087602785 11:100337986-100338008 AGTTCCCTAGAGAAGGGGCAAGG - Intronic
1088982301 11:114874773-114874795 GCTTCACTAGAGGAGGTGGAAGG + Intergenic
1090752812 11:129762428-129762450 CACTCCCTAGAGCAGATGCAGGG + Intergenic
1093946446 12:25115107-25115129 TTTTCCCTTGAGGAGTGGCAAGG - Intronic
1101660717 12:106763147-106763169 TATTCCCTATAAGAGCTGAAAGG - Intronic
1103458461 12:121085693-121085715 TGTTGCCTGGAGGAGGTGCTTGG + Intergenic
1105345234 13:19565135-19565157 TGTTCCCTTGGGCAGGTGCACGG - Intergenic
1105657301 13:22455245-22455267 TATTTCCAAGAGCATGTGCAGGG - Intergenic
1106009007 13:25799924-25799946 TATTTCCTAAAGGAGGTTAAAGG + Intronic
1106821752 13:33472573-33472595 TGTTCCCTAGAGCAGGTAGAGGG + Intergenic
1118792491 14:69107688-69107710 AAATCCTTAGAGGAGGTGTAAGG - Intronic
1118895033 14:69938727-69938749 TGTTCCCCAAAGGAGGTGAATGG - Intronic
1120627861 14:86851364-86851386 TATTCCCTAAAGGGGGAGTATGG + Intergenic
1126149824 15:45513837-45513859 AGTTCCCTAAAGGACGTGCAAGG + Intronic
1128995595 15:72292153-72292175 TACTCCCTAGAGGGGCTCCAAGG + Intronic
1129238893 15:74240230-74240252 TGTCCCCGAGGGGAGGTGCAGGG + Intronic
1133381726 16:5336569-5336591 TATCCTCTGGAGTAGGTGCAGGG + Intergenic
1133996311 16:10751209-10751231 TGTTCCCTAAAGGAAGGGCATGG + Intronic
1134456969 16:14401980-14402002 TAGTTCATAGAGGAGGGGCAGGG - Intergenic
1135158130 16:20071888-20071910 CACTCAGTAGAGGAGGTGCAAGG + Intronic
1136053512 16:27670716-27670738 AATTCCCTAGAGGAGTGGCGGGG - Intronic
1137347153 16:47674842-47674864 TTTTCCGTAGAGGAGTTACACGG - Intronic
1139081308 16:63524983-63525005 TATTCCCAACAGGAGGTGAGGGG - Intergenic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1142014877 16:87740105-87740127 TGTCCCCTGGAGAAGGTGCAGGG - Intronic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1146991097 17:37273458-37273480 TTTTCCCTTGGGGAGGAGCAAGG - Intronic
1149781387 17:59399242-59399264 TATTTCCTTGAGGAGGGGGAAGG - Exonic
1153925060 18:9828173-9828195 TATTCCCCAGGGCAGGCGCAGGG - Intronic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1157929528 18:51806023-51806045 TATTCCCTAATGGAGGCACACGG - Intergenic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1162196031 19:8985446-8985468 TTTTCCATAGGGGAAGTGCAAGG - Intergenic
1165442634 19:35839185-35839207 TATTCCTCAGAGGATGTGTAGGG - Intronic
1165701247 19:37939862-37939884 TGTTCCCTAGTGGAGCTGAAAGG + Intronic
1167314913 19:48757546-48757568 TGTTTCCTAGAGGAGGGGCTGGG + Intronic
1167661151 19:50796793-50796815 CATTCCCTAGAGGAGCTGGGTGG + Intergenic
925476361 2:4221082-4221104 GATACCCTTGAGAAGGTGCAAGG - Intergenic
927324244 2:21784975-21784997 TATTCTCTAGAGATGGTGAAAGG + Intergenic
928595240 2:32853830-32853852 TCTCCCCTAGAGAAGGTGTAAGG - Intergenic
928739195 2:34329776-34329798 TAATCCTTTGAGAAGGTGCATGG + Intergenic
929805579 2:45142256-45142278 ATTCCCCTAGAGGAGTTGCAAGG + Intergenic
931221398 2:60291419-60291441 TATTCCACAGATGATGTGCACGG - Intergenic
932427058 2:71644751-71644773 TACTCCTTAAAGGAGTTGCATGG + Intronic
933263344 2:80154193-80154215 TTTTCCCTAGAGAAGGCTCATGG + Intronic
934117536 2:88811259-88811281 GCTTCCCTAGAGTAGGTTCAGGG - Intergenic
938796985 2:134725816-134725838 TCTTCCATAGAGGCTGTGCATGG - Intergenic
939901097 2:147850373-147850395 TATTCCCAAGAGGGTGTGCGAGG - Intronic
941375380 2:164722278-164722300 TATTTACTAGAGGGGTTGCAGGG + Exonic
942836540 2:180305664-180305686 TATGCCTTAAAGGAGGTGCATGG + Intergenic
942899944 2:181103344-181103366 TATGCCCTGGAGGAGGAGGAAGG - Intergenic
943694461 2:190909749-190909771 TATCCCCTATAGGCTGTGCATGG + Intronic
1173461715 20:43248343-43248365 TATGCCCCAAAGGAGATGCAGGG - Intergenic
1175942789 20:62545659-62545681 TATTCAGTGGGGGAGGTGCACGG - Intergenic
1178542738 21:33468346-33468368 TCTTCCCTAGAGCCGCTGCAGGG + Intronic
1179150285 21:38803972-38803994 TATTCTGTAGAGGAGGCCCAAGG + Intergenic
1179234094 21:39529654-39529676 GACTCCCTGGAGGAGGTGGAGGG + Intergenic
1180179444 21:46111496-46111518 GATTCCCCAGAGCAGGAGCACGG - Exonic
1182412256 22:30197118-30197140 TTTTCCCTAGAGGGAGTGCTGGG + Intergenic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1184234338 22:43175005-43175027 TCTGCCCCAGAGGAGGTGGAGGG + Intronic
1184426574 22:44412271-44412293 TATTCCCCAGGAGAGGAGCAAGG - Intergenic
1185419773 22:50728840-50728862 GATTCCCAAGGGGAGGTGCCAGG - Intergenic
949689731 3:6621815-6621837 TATTCACTAGAAGAGGAGAAGGG + Intergenic
950554410 3:13686487-13686509 TGTTCCTTAGAGGAGGGGTATGG + Intergenic
953004405 3:38964733-38964755 TATTGCCAAAAGGAGGAGCATGG + Intergenic
959840796 3:110971677-110971699 GATTCCCTAAAGGAGGGGCAAGG - Intergenic
963270367 3:143280238-143280260 TGTTCCCTAAAAGAGCTGCAGGG - Intronic
963666357 3:148192764-148192786 TATTCCCAAGTGTAGGGGCAGGG - Intergenic
964765250 3:160173038-160173060 GATTCCAGAGAGGAGATGCATGG - Intergenic
967282940 3:187839948-187839970 TATGCCCTAGAGGGTCTGCAAGG + Intergenic
977895819 4:102363671-102363693 TATTCTCAAGAGAAGGGGCAGGG + Intronic
977913604 4:102565394-102565416 TATTCCCCAGAGGGTTTGCAGGG - Intronic
978423640 4:108560179-108560201 TATTCCCACAAGGAGCTGCAGGG + Intergenic
980471817 4:133262864-133262886 GATTCTCTGGAGGGGGTGCACGG + Intergenic
986293765 5:6420837-6420859 TTTTCTCTAGAGGAGCTGTAGGG - Intergenic
987963539 5:24842030-24842052 TCATCCCTAGAGGAGGTGCTTGG - Intergenic
991259429 5:64650835-64650857 TATGCCCTGGATGAGGGGCATGG + Intergenic
991307534 5:65195472-65195494 TAGTCCCTTGAAGAGGTGTAGGG - Intronic
994577973 5:101605487-101605509 TATTGCCTTGAGGAGGAACATGG + Intergenic
997907810 5:137837033-137837055 TATCTCCTAGAGGAGTTGGATGG + Intergenic
998753627 5:145352127-145352149 TATTGCCTAGAGGAGGTGTGAGG - Intergenic
998961341 5:147490058-147490080 TATTCAGTAGATGGGGTGCAGGG - Intronic
1010404027 6:75482163-75482185 TATTCCCTGGAAGATGTGAATGG + Intronic
1011012817 6:82721246-82721268 TATTCCCTTGATCCGGTGCATGG - Intergenic
1017708379 6:157145466-157145488 TATTCCCTACAGGCGACGCACGG - Intronic
1018454743 6:163941683-163941705 TGTTCCCTAGAGGATTTGAAGGG - Intergenic
1019644304 7:2120919-2120941 CCTGCCCTAGAGCAGGTGCAGGG - Intronic
1020372821 7:7452960-7452982 TTTTTCCTTGAGGAGGAGCATGG - Intronic
1024432603 7:49306877-49306899 TATTCCCAAGAGGAATTACATGG - Intergenic
1024658742 7:51473726-51473748 TCTTCCCGAGGGGAGGTGCAAGG - Intergenic
1024693701 7:51833029-51833051 TATTGCCTATAGGATGTGAATGG - Intergenic
1026337654 7:69408584-69408606 TATTCCCACCAAGAGGTGCAAGG - Intergenic
1028610578 7:92706181-92706203 TATTCCCAAGAGGAAGTGATCGG + Intronic
1030610066 7:111679691-111679713 TACTCCATAGAGCAGCTGCAAGG + Intergenic
1031986346 7:128166934-128166956 TCCTCCCTGGAGGAGGTGCGGGG + Intergenic
1036620847 8:10423802-10423824 CAGGCCCTAGAGGAGGTGCTGGG + Intronic
1037803137 8:22045781-22045803 TATTCTATGAAGGAGGTGCACGG - Intronic
1040621415 8:49096523-49096545 GATTCCTTAGAGGAGGGGAATGG - Intergenic
1042059944 8:64805643-64805665 TTGTCCCAAGATGAGGTGCAGGG + Intergenic
1042348097 8:67748153-67748175 TATTCCCTCGAGGAGGTATAAGG - Intergenic
1042857417 8:73281761-73281783 TATTCTCTGGAGGAGGAGCCAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1047216275 8:122878656-122878678 GAGTCCCTGTAGGAGGTGCAGGG + Intronic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1052409642 9:28106438-28106460 TATCCCCTAGGGGTGGGGCACGG - Intronic
1059543873 9:115157009-115157031 GATTCCCCAGAGGAAGTGAAGGG - Intronic
1188546195 X:31310099-31310121 TATTCCCTGGGGGATGTGAAGGG - Intronic
1189126321 X:38451161-38451183 TATTACTTAGAGGAGGGGGAAGG - Intronic
1190221372 X:48514400-48514422 TGCTGCCTAGAGGAGCTGCAGGG + Intronic
1190321899 X:49184655-49184677 TGCTCCCTACAGGAGTTGCAGGG + Exonic
1190916008 X:54811639-54811661 TATTCCTTGGAGAAGGTGAAGGG + Exonic
1193758420 X:85436770-85436792 TATTCCCTGGATGTGGGGCATGG + Intergenic
1195899768 X:109785551-109785573 TATTCCCTCAAGGACATGCAAGG + Intergenic