ID: 1157196457

View in Genome Browser
Species Human (GRCh38)
Location 18:45624013-45624035
Sequence GCCCTGACCCTGGTGGTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157196450_1157196457 17 Left 1157196450 18:45623973-45623995 CCTCAGGCAAAGGATGTTCCAAA 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1157196452_1157196457 -1 Left 1157196452 18:45623991-45624013 CCAAAAGCAAGTCATGGCATAAG 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157196457 Original CRISPR GCCCTGACCCTGGTGGTACG GGG Intronic
900175928 1:1291356-1291378 GCCCTCACCCTGGTGCTAGGCGG + Exonic
900608594 1:3534936-3534958 GCCCTCACCCTGGATGGACGCGG - Intronic
900660152 1:3778104-3778126 TCCATGACCCTGGGGGTACTGGG - Intergenic
900799376 1:4727951-4727973 GCCCAGCCCCAGGTGGTACACGG + Intronic
903474972 1:23613359-23613381 GCCCTGGCCCAGGTGGGGCGGGG - Intronic
903481454 1:23656548-23656570 GCTTTGACCCTGGTGGTATATGG - Intergenic
904614347 1:31741998-31742020 GCTCTGACCATGGGGGTACCTGG - Intronic
905031158 1:34885428-34885450 GCTCTGACCCTGGTCGGTCGGGG - Intronic
908785133 1:67728205-67728227 ACTCTGACTCTGGAGGTACGGGG - Intronic
916714730 1:167439356-167439378 GTTCTGGCCCTGCTGGTACGCGG + Exonic
920102441 1:203525773-203525795 GCCCTGGGCCTGGTGGTCTGTGG - Intergenic
921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG + Exonic
924710540 1:246527227-246527249 GCCCTCACCCTGGGAGGACGTGG - Intergenic
1063410432 10:5832960-5832982 GACCTGACACTGGTGGGATGGGG - Intronic
1067101546 10:43338272-43338294 GCGCTAACCCTGGTGGTGGGTGG - Intergenic
1070586652 10:77771747-77771769 GCCCTGACCCAGGAGGTAACCGG + Intergenic
1072904672 10:99441969-99441991 GCTCTGTCATTGGTGGTACGTGG + Intergenic
1073215344 10:101833166-101833188 TTCCTGTCCCTGGTGGTACTGGG + Intronic
1074521010 10:114223956-114223978 GCCCTGACCCTGTTGTTTCCTGG + Intronic
1074962723 10:118462805-118462827 GCCCAGACCCTGGGGGAATGTGG - Intergenic
1075999635 10:126905052-126905074 GGCCGGAGCCTGGTGGTGCGAGG - Intergenic
1076029986 10:127149283-127149305 GCCCTAACCTTGCAGGTACGCGG + Intronic
1076062920 10:127427620-127427642 GCACAGACCCTGGAGGTACATGG - Intronic
1077335425 11:2001432-2001454 TGCCTGACCCAGGTGATACGGGG + Intergenic
1078455295 11:11470221-11470243 GCCTTGAACCTGGTGGTACAGGG - Intronic
1081483795 11:43512175-43512197 GCCCTGGCCTTGGAGGTACTGGG - Intergenic
1089456425 11:118628339-118628361 TCCCTGACGCTGGGGGCACGGGG + Exonic
1202818408 11_KI270721v1_random:56614-56636 TGCCTGACCCAGGTGATACGGGG + Intergenic
1091696818 12:2633335-2633357 CTCCTGCCCCTGGTGGGACGTGG + Intronic
1097490970 12:60269971-60269993 GCCCTGACCCTGCGGGGAGGCGG - Intergenic
1099455119 12:82853787-82853809 GCCCTGGCCTTGATGGTATGAGG + Intronic
1103324567 12:120111866-120111888 GCCCTGACACTGATGGTGTGGGG - Intronic
1103359954 12:120347627-120347649 GCCTTGACCCTGGGGCTACATGG - Intronic
1103727054 12:123003229-123003251 GCCATGAGCCTGGTGGTCCTGGG - Intronic
1104722424 12:131052269-131052291 GCCCTGACCAGGGTGGGACTCGG - Intronic
1117523485 14:56574735-56574757 GACATGACCCTGGTGGCATGTGG - Intronic
1121100323 14:91245701-91245723 GCCCTCACTCTGTTGGTAGGGGG + Intronic
1121123819 14:91393209-91393231 GCCCTGACACTGGTGTGACCTGG - Intronic
1122703776 14:103607732-103607754 GAGCTGACCCTGGTGGTCTGGGG - Intronic
1123016997 14:105380434-105380456 GCCCTGACCCTGAGGGTGGGGGG - Intronic
1123017009 14:105380466-105380488 GCCCTGACCCTGAGGGTGGGGGG - Intronic
1125723508 15:41856546-41856568 GCTCTGACCCGGGTGGTGCTGGG - Exonic
1127804076 15:62502528-62502550 GCACTGGGCCTGGTGATACGAGG + Intronic
1129760069 15:78124163-78124185 GCCCTGAGCATGGTGCTAGGGGG + Intronic
1136672364 16:31870002-31870024 GCCCTGACCCAGGAGGTACATGG - Intergenic
1138174578 16:54884953-54884975 GCCATGAACCTGGTGATAGGGGG + Intergenic
1140453561 16:75090850-75090872 GCCGTGACTCTGGTGGCCCGGGG - Intronic
1143875026 17:9985036-9985058 GCCCTGTCCCTGGTTGTCCAGGG - Intronic
1144437124 17:15252007-15252029 GCTGAGACCCTGGTGGTACAAGG - Intronic
1154022532 18:10676905-10676927 GCCCTGCCCCCGGGGGTACTGGG - Intronic
1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG + Intronic
1159255544 18:65940077-65940099 TCCCTGAGCCTGGTGGTTCAAGG - Intergenic
1159911803 18:74152623-74152645 ACCCTGTCCCTGGTGGTAGGGGG - Intronic
1160079806 18:75714717-75714739 GCGCTGACCCTGTTGGACCGCGG - Intergenic
1160817472 19:1042812-1042834 GACCTGGCCCAGGAGGTACGAGG + Exonic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1164527296 19:29021733-29021755 GCCCTGTCCCTGGTTGTAGGAGG - Intergenic
1165825784 19:38705043-38705065 GCCCTGACTCAGGTGGGAAGCGG - Intronic
1166645761 19:44530599-44530621 CCCCTGCTCCTGGTGGTACTGGG + Intergenic
1167503262 19:49858835-49858857 GCACTGACCCTGGTTCTGCGGGG + Intronic
925215043 2:2087106-2087128 GCTCTGACCGTGGTGTCACGGGG - Intronic
927677486 2:25117108-25117130 TTCCTGATCCTGGTGGAACGGGG - Intronic
928839466 2:35587661-35587683 GACCTGACCCTGATAGTAGGAGG - Intergenic
933777430 2:85779503-85779525 GCCCTGGCCCTGGGGGTGCTGGG + Intronic
933834270 2:86232691-86232713 GCCCAGACCCCGGTGGTGGGGGG + Exonic
938229420 2:129645744-129645766 GACCTCACCCTGGTGGTGAGTGG - Intergenic
943482575 2:188439657-188439679 GACATGACTCTGGTGGTAGGAGG + Intronic
1172096774 20:32464258-32464280 GCCCTGAGCCTGGTGCTCCTTGG - Intronic
1172670892 20:36633776-36633798 GCCCTGACTCAGGAGGTACCTGG - Intronic
1178975972 21:37221283-37221305 GCCCTCACCCTGGCGGGAGGTGG - Intergenic
1180198986 21:46213597-46213619 GCCCTGACACTGCTGGTTCCTGG + Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
951717378 3:25664221-25664243 GCACTGACCTGGGTGGTAAGTGG - Exonic
959969330 3:112391516-112391538 GCCCTGCCACTGGTGGTTCCTGG + Intergenic
966886407 3:184380063-184380085 GCGCTGACCCGGGCCGTACGCGG - Exonic
969112197 4:4851127-4851149 TCCCTGACCTTCGTGGTACAGGG + Intergenic
969379259 4:6783212-6783234 GCCCCGATCCTGGTGGTGCCCGG + Intronic
973166177 4:47080151-47080173 GCCCTGGCCTTGATGGTATGAGG - Intronic
977961354 4:103088762-103088784 CCCCTAACCCTGGTGGAACCTGG + Intronic
984241637 4:177226610-177226632 GGCCTGACCCTTTTGGAACGGGG - Intergenic
986559449 5:9046191-9046213 CCCCTCACCCTGGTGGTGTGTGG - Intronic
992780676 5:80124311-80124333 GCCCTGAGACTGTTGGCACGGGG - Intronic
997470722 5:134115429-134115451 GCCCTGGCCTCGGTGGGACGGGG + Intronic
1002444134 5:179278762-179278784 GCCCAGAGCCTGGTAGTACCCGG + Intronic
1016730575 6:147423261-147423283 GCTCAGCCCCTGGTGGTAGGGGG - Intergenic
1018556375 6:165055343-165055365 GCCCTGCCCCTGGTTGTGTGGGG - Intergenic
1018867877 6:167759601-167759623 TCCCTGATGCTGGTGGAACGGGG + Intergenic
1020513076 7:9084027-9084049 GCTCTGTCCCTGGTGGTAGCAGG - Intergenic
1021934363 7:25615272-25615294 GCCCTGGCCCTGGTGTCCCGTGG - Intergenic
1024241313 7:47438639-47438661 GCCCTGGCCCAGGTGCTACCTGG - Intronic
1024294547 7:47831883-47831905 GCCCTGTCCCTTGTGGTGTGTGG - Intronic
1024473772 7:49789892-49789914 GCACTGGCCCTGGTGCTCCGGGG + Intronic
1031145965 7:117996787-117996809 GCCTTGAGCATGGTGGAACGTGG + Intergenic
1032410192 7:131689021-131689043 GCCCTGCCCCTGATGCTACTGGG - Intergenic
1032657171 7:133943641-133943663 GCCCTGAGCCTGATGGTGCCGGG - Intronic
1034958166 7:155348871-155348893 GCCCTGACAGTGGTGCTATGTGG - Intergenic
1037907518 8:22724237-22724259 TCCCTGGCCCTGGTGGCAGGAGG + Intronic
1040323392 8:46329481-46329503 GCCCTTACCCTGGGGGTGCCTGG + Intergenic
1048269803 8:133019527-133019549 GCTCTGACCATGGTGGTGGGTGG + Intronic
1052049106 9:23824953-23824975 GCCCTGTCCTTGGTCCTACGCGG - Intronic
1052498803 9:29261919-29261941 ACCCTGTCACTGGTGGTAGGGGG - Intergenic
1053004408 9:34594436-34594458 GCCCTGACCCTGGGGGGAGGGGG - Intergenic
1057127948 9:92633996-92634018 GCCCTGCCCCTGGCTGTATGCGG - Intronic
1061231225 9:129316949-129316971 GCCCTGACCCTGGAGGTCTATGG + Intergenic
1061790591 9:133057023-133057045 CCCCTGGCCCTGGTGGGAGGAGG + Intronic
1061921180 9:133783424-133783446 GCCCGTACCCAGGTGGTAGGGGG + Intronic
1062702187 9:137913092-137913114 GACATGACCCTGGTGGTGGGAGG + Intronic
1190223388 X:48527561-48527583 GCCCTGATCCTGGAGGTTCCAGG - Intronic
1196786443 X:119425264-119425286 GCCCTGCCCCCTGTGGTAGGCGG - Intronic