ID: 1157197637

View in Genome Browser
Species Human (GRCh38)
Location 18:45632364-45632386
Sequence CAGGACTCCATGGGTACAAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157197627_1157197637 29 Left 1157197627 18:45632312-45632334 CCAACTTCAAATGCAAAATCAGT 0: 1
1: 0
2: 1
3: 29
4: 314
Right 1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG 0: 1
1: 0
2: 0
3: 10
4: 96
1157197631_1157197637 -5 Left 1157197631 18:45632346-45632368 CCAGGTCTGCCATTGCCTCAGGA 0: 1
1: 0
2: 0
3: 15
4: 188
Right 1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG 0: 1
1: 0
2: 0
3: 10
4: 96
1157197629_1157197637 -2 Left 1157197629 18:45632343-45632365 CCGCCAGGTCTGCCATTGCCTCA 0: 1
1: 0
2: 0
3: 28
4: 246
Right 1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157197637 Original CRISPR CAGGACTCCATGGGTACAAC GGG Exonic
900933368 1:5750639-5750661 CAGGGCTCCATGGGGACGAGGGG - Intergenic
901433659 1:9233561-9233583 CAGGACTGAATGGGGCCAACAGG - Intergenic
901774440 1:11550417-11550439 CAGGAGTCCATGTGTCCAATGGG - Intergenic
901866404 1:12109724-12109746 CAGGACGCCCATGGTACAACTGG + Intronic
902243294 1:15102699-15102721 CAGGCCTCCCTGGGTCCCACAGG - Intronic
905631018 1:39518626-39518648 CAGGACTCCCTGGCTCCAGCTGG - Intronic
905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909892243 1:81022003-81022025 CAGGATTCCATGGCTAAGACAGG - Intergenic
912243818 1:107939936-107939958 AAGAACTTCATGGGTACATCTGG - Intronic
1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG + Intergenic
1067942549 10:50668872-50668894 CAGGAATCCATTTGTACCACAGG + Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070863793 10:79693830-79693852 CAGGAATCCATTTGTACCACAGG + Intergenic
1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG + Intronic
1075734738 10:124657393-124657415 CAGGAGTCCATGGATTCCACAGG - Intronic
1075918249 10:126188293-126188315 CTAGACTCCATGTGTACCACTGG + Intronic
1076607769 10:131700622-131700644 CAGGACTGCCTGGGTGCAACTGG - Intergenic
1080057600 11:27923275-27923297 CAGGATTCCATGGGTTCTATAGG + Intergenic
1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG + Intergenic
1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1095053522 12:37575339-37575361 CAGTATTCCATGGTTACAGCTGG - Intergenic
1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101140551 12:101791318-101791340 CAGGAGTTCATGTGTACATCTGG + Intronic
1103134774 12:118498028-118498050 GAGGAATCCATGGGTCCAATGGG + Intergenic
1113321228 13:109234525-109234547 CAGCACTCCATGGACACAAAGGG + Intergenic
1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG + Intronic
1114610300 14:24036003-24036025 GTGGACTCCATGGGGACCACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1121275436 14:92664179-92664201 CAGAACCCCATGTGTAAAACAGG - Intronic
1124601595 15:31137011-31137033 CAGGACTCCATGAGGAAGACAGG - Intronic
1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG + Intronic
1129184471 15:73897603-73897625 CAGGACTCCATGGGGAGGCCTGG + Intergenic
1133726037 16:8538421-8538443 CAAAATTCCATGGGTACAATAGG - Intergenic
1136428992 16:30186261-30186283 GAGGCTTCCATGGGCACAACTGG - Intronic
1143309789 17:5978720-5978742 CCAGAGTCCATGGGGACAACAGG + Intronic
1143393296 17:6573107-6573129 CAGCACTGCATGGGCACAGCCGG + Intergenic
1145347288 17:22049079-22049101 CTGGACTCCAGGTGTACATCAGG - Intergenic
1149017640 17:51926726-51926748 AAGGACTCTATGGTTACAAGGGG + Intronic
1149552629 17:57551566-57551588 CATGACCCCATGGGTGCACCTGG - Intronic
1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG + Intergenic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157427591 18:47597263-47597285 CAAGAATCCATGGGTACCAATGG + Intergenic
929584468 2:43105171-43105193 CAGGTCTCCATGGTAGCAACAGG - Intergenic
937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG + Intergenic
946143257 2:217709777-217709799 CAGAACACCATGGGTACAGCAGG - Intronic
948973296 2:241445980-241446002 GTGGACTTCATGGGTCCAACAGG - Intronic
1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG + Intronic
1171556648 20:26086059-26086081 CCGGACTCCAGGTGTACATCAGG - Intergenic
1174087244 20:48018164-48018186 CAGGAGGCCATGGGTACAGAGGG - Intergenic
1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG + Intergenic
1179025371 21:37675024-37675046 CAGGACTGCATGAGTCCACCTGG - Intronic
1179584755 21:42367447-42367469 CAGGAGTCCAGGGGACCAACTGG - Intergenic
1179711687 21:43267262-43267284 CAGGAGGCCAGGGGTACAGCTGG - Intergenic
1180070368 21:45432833-45432855 CAGGCCTCCCTCGGTACAGCCGG + Intronic
1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
956042224 3:65156478-65156500 CAGGACTCTATTGGTCAAACAGG + Intergenic
958021070 3:87996308-87996330 CAGGACTCTCTGGGTACAGAGGG - Intergenic
961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG + Intronic
961823236 3:129585942-129585964 CAGGACTCACTGGGTACTCCTGG + Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967102739 3:186229674-186229696 CAGGAGTTCGTGGGTATAACTGG - Intronic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
974508512 4:62807555-62807577 CAGGTCTCCATTGTTACAGCTGG - Intergenic
975964064 4:79948101-79948123 CAGGATTCCATGAGTACATTAGG + Intronic
978086501 4:104662165-104662187 CAGGAGTCCATGGATCCAAGAGG - Intergenic
979785338 4:124710787-124710809 CATAACTCCATGGTTATAACTGG + Exonic
981809775 4:148760604-148760626 CAGAACACCATGAGTTCAACAGG - Intergenic
985962329 5:3312007-3312029 CAGGGCTGCATGGGTACAAATGG + Intergenic
992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG + Intronic
994064341 5:95519378-95519400 CTGGACTCCATGAGTAGAAAAGG - Intronic
996204137 5:120710253-120710275 CATAGCTCCAGGGGTACAACCGG + Intergenic
1006556725 6:34873268-34873290 CAGGACTCCAGGCGGACAACAGG - Exonic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1008062625 6:47014518-47014540 CACGACTCCACGGGTTCACCAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017050128 6:150383290-150383312 CAAGTCTCCATGGGTAGACCTGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1025280765 7:57625389-57625411 CTGGACTCCAGGTGTACATCAGG + Intergenic
1025303965 7:57840118-57840140 CTGGACTCCAGGTGTACATCAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027515215 7:79133865-79133887 TAGTACTCCAGGGGTACCACTGG + Intronic
1028943152 7:96547919-96547941 CAGGATTCCAGTGGTACAAATGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1033650465 7:143338901-143338923 CTGGACTAAATGGGTACAATGGG + Intronic
1040758244 8:50807114-50807136 CAGGACTCAATTGGTAAAACTGG + Intergenic
1043654234 8:82641582-82641604 CAGAACACAAGGGGTACAACTGG + Intergenic
1049243406 8:141549930-141549952 GAGGACTCCTTGGGGACAGCTGG - Intergenic
1049422630 8:142523714-142523736 CAGGTTTCCATGGGCACCACAGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052874951 9:33551800-33551822 AAGGACAGCATGGGTAAAACTGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057680471 9:97177023-97177045 AAGGACAGCATGGGTAAAACTGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1060878457 9:127100581-127100603 CAGGAAGCCTTGGGTACAACTGG - Intronic
1203632127 Un_KI270750v1:80179-80201 CTGGACTCCAGGTGTACATCAGG + Intergenic
1190937148 X:55007428-55007450 CAGGCCTCCATTGGTTCAGCTGG - Exonic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic