ID: 1157199044

View in Genome Browser
Species Human (GRCh38)
Location 18:45643358-45643380
Sequence ATGTACCTCTAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157199039_1157199044 3 Left 1157199039 18:45643332-45643354 CCGGAGGAGGATTGACAATTGCA 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157199044 Original CRISPR ATGTACCTCTAGGAGAGGGA GGG Intronic
900217657 1:1490240-1490262 ATGAATCTGTAGGACAGGGATGG - Exonic
904042800 1:27593979-27594001 AGGGACCTCTAGGAAAGAGAAGG + Intronic
904228075 1:29041305-29041327 TTGTACCTTTAGTAGAGGCAGGG - Intronic
904839078 1:33359445-33359467 ATGTGCCTGTGGGAGAGGAATGG + Intronic
906574235 1:46873518-46873540 AAGTACCTGTAGGTCAGGGATGG - Intergenic
909759767 1:79272162-79272184 ATGTACCTGTAGGAGATGGCTGG - Intergenic
910258826 1:85276601-85276623 CTGAGCCTCTACGAGAGGGAAGG - Exonic
910289225 1:85583581-85583603 ATGTAGCTTTTGGGGAGGGAGGG + Exonic
910449986 1:87335005-87335027 ATTGGCCTCTAAGAGAGGGAGGG + Intronic
910519024 1:88096795-88096817 AGGTAAGGCTAGGAGAGGGAAGG - Intergenic
910821810 1:91358833-91358855 ATGTACCTTTAGGAGGTGGCTGG - Intronic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
915721563 1:157989640-157989662 AGGTACCTCTCTGATAGGGAGGG + Intergenic
916776040 1:167965495-167965517 TTGTACATCCAGCAGAGGGAGGG - Intronic
917352190 1:174089923-174089945 ATGCACCTGTAGGAGATGGCTGG + Intergenic
918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918776542 1:188638936-188638958 AGGTACCTCTTGCTGAGGGAGGG + Intergenic
919824946 1:201496836-201496858 AGTTACCTCTAAGAGAGGGAAGG + Intronic
920788618 1:209066856-209066878 TTGTATTTCAAGGAGAGGGAAGG - Intergenic
921880897 1:220253225-220253247 ATGTACCTGTAGGAGGTGGCTGG - Intronic
923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG + Intronic
1065736904 10:28761756-28761778 ATTTACCTCTAGCAGTGGGGAGG + Intergenic
1065922896 10:30408934-30408956 GTGTAAGTCTTGGAGAGGGATGG + Intergenic
1068953989 10:62805321-62805343 ATGCACATCTACGAGACGGACGG + Exonic
1069864627 10:71494352-71494374 ATGTGACTCCAGCAGAGGGAAGG + Intronic
1074553322 10:114465571-114465593 ATTTTGCTCTGGGAGAGGGATGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078329161 11:10405124-10405146 ATGGAACTCTTGGAGATGGAGGG + Intronic
1079086864 11:17452411-17452433 ATGGACCTGGGGGAGAGGGATGG + Intronic
1080774049 11:35369273-35369295 ATGTAACTCGAGGTGAGGGAAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084665037 11:70571764-70571786 ATGAACCCTGAGGAGAGGGAGGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090007267 11:123013820-123013842 AGGTAACTCTAGGAAAGGGGAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG + Intronic
1092108821 12:5944950-5944972 TTTTAACTCAAGGAGAGGGAAGG - Intronic
1092286988 12:7134289-7134311 ATATAGCTCTAGGTGAGGGTGGG + Intronic
1092704641 12:11268982-11269004 ATGTATTTATAGGAGATGGAGGG - Intronic
1092716554 12:11394842-11394864 ATGTATTTATAGGAGATGGAGGG - Intronic
1094267769 12:28578066-28578088 ATGTACCTGTAGGATATAGAAGG + Intronic
1095374633 12:41511972-41511994 CTATAGCTCTAGGAGCGGGATGG + Intronic
1095688604 12:45063285-45063307 ATGTGACTCGAGGAGAAGGAAGG + Intergenic
1095947837 12:47763863-47763885 ATGTGCCTCCAGGAGAGTGTGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098138622 12:67429095-67429117 ATGTACCCCTAGGGAAGGAATGG + Intergenic
1100314792 12:93435072-93435094 ATGTACCTCCAGGTGGGGGCAGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG + Intronic
1104655852 12:130573606-130573628 ATGTGACTCTAGGACAGGGCAGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105834746 13:24199632-24199654 GTGTAGGTTTAGGAGAGGGATGG + Intronic
1109688999 13:65861374-65861396 ATGTATTTCAAGTAGAGGGAAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116491029 14:45503356-45503378 ATGTGACTCAAGGAGAAGGAAGG - Intergenic
1118538899 14:66801635-66801657 AGGTAGCTCAAGGAGAGAGAGGG - Intronic
1121027647 14:90628342-90628364 AAGGTCCTCTAGGAGAGGAAGGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1127698648 15:61475570-61475592 AAGTACCTGTGGGTGAGGGAGGG + Intergenic
1128448578 15:67786690-67786712 ATGGACAGCTAGGAGAGGAAGGG - Intronic
1129506996 15:76089711-76089733 ATGTACCGACAGGAGAGGCAAGG + Intronic
1129971460 15:79781070-79781092 ATGCACCTGTAGGAGATGGCTGG - Intergenic
1130967957 15:88711079-88711101 TTGTACCTTTAGTAGAGGTAGGG + Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132384302 15:101389300-101389322 ACGAAGCTCTGGGAGAGGGATGG + Intronic
1132888688 16:2193998-2194020 AGGGACCTCGTGGAGAGGGAGGG - Intronic
1135623281 16:23974428-23974450 AACTTCCTCTAGGATAGGGAAGG + Intronic
1137848847 16:51718439-51718461 ATTTACCTCTAGAAGAAGCATGG - Intergenic
1138418568 16:56885250-56885272 ATTTACCTCTGGGAGAGCAAGGG - Exonic
1138855276 16:60683503-60683525 ATGAAGCTCTTAGAGAGGGAGGG + Intergenic
1139802793 16:69537639-69537661 AGGTTCCTTTAGGAGAGGTAAGG - Intergenic
1140244289 16:73234107-73234129 ATGTGTCTCTCCGAGAGGGAGGG + Intergenic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1144409033 17:14981990-14982012 ATGATCATCTAAGAGAGGGAAGG + Intergenic
1146061027 17:29607487-29607509 AAGTAACTCTGGAAGAGGGAGGG - Intronic
1148834307 17:50457608-50457630 ATGTACCCCTAGGAGAGAGTAGG + Intronic
1151333327 17:73424072-73424094 AGGTACATCTGGGAGAAGGACGG - Exonic
1151349930 17:73525683-73525705 AATTACTTCTAGGATAGGGATGG - Intronic
1152494771 17:80663191-80663213 GTGAACCTGTGGGAGAGGGAGGG - Intronic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1156023564 18:32626733-32626755 TTTAACCTCTAGGAAAGGGAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157518947 18:48331566-48331588 CTGTACCTCTTGGACGGGGATGG - Intronic
1157897918 18:51486132-51486154 ATGGAACTCTAGAGGAGGGATGG + Intergenic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1160108936 18:76006769-76006791 ATGTACCTCTCAGGGAAGGATGG + Intergenic
925617044 2:5753700-5753722 AGGTACATCTAGGTGAAGGAAGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
929993496 2:46810242-46810264 TGTTACCTCTAGGAGAAGGAAGG + Intergenic
932069803 2:68608079-68608101 ATGGACTACTAGCAGAGGGAGGG - Intronic
932551586 2:72775300-72775322 AGATAGCTTTAGGAGAGGGAGGG - Intronic
933332046 2:80905053-80905075 ATGTACCTGTAGAAGAAGTATGG + Intergenic
936065048 2:109324829-109324851 ACACACCTCAAGGAGAGGGACGG - Intronic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
946974858 2:225137032-225137054 ATATTCCTCAAGGAGACGGAGGG + Intergenic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
947947039 2:234113672-234113694 ATGGAGTTCTAGGAGAGGAAGGG - Intergenic
948759066 2:240179385-240179407 ATGGAGCTCTAGGAGAAGGCTGG + Intergenic
1169947492 20:11004790-11004812 ATGAAGTTCTAGGAGAAGGAGGG - Intergenic
1170744364 20:19085752-19085774 AAGTACCTCTGGGAAAAGGATGG - Intergenic
1170941160 20:20849008-20849030 CTGTAACACTAGGAGAGTGAGGG + Intergenic
1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG + Intronic
1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG + Intronic
1182270368 22:29149517-29149539 AAGAGCCTCTAGGAGAGAGAAGG - Intronic
1183224931 22:36543178-36543200 ATGTACCACTTCGGGAGGGAGGG + Intergenic
1184796436 22:46736069-46736091 TGGTCCCTCTTGGAGAGGGAGGG - Intronic
1184873215 22:47254718-47254740 ATATTCCTCTAGGAGAGCAAGGG + Intergenic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
951235008 3:20224138-20224160 ATGTAGCTCTAGGAATGAGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953028316 3:39158532-39158554 ATCAACCTCCAGGAGGGGGAAGG - Intergenic
954279446 3:49565672-49565694 ATGTACCTCTAGTAGTTAGAGGG + Intronic
959882230 3:111456925-111456947 ATGTCCCTATAGGAAAGGGTTGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970171520 4:13295481-13295503 GCGTACCTCTAGGAAAGGGCAGG + Intergenic
972871769 4:43309231-43309253 CTGTACCTCTAGGACAAGGAAGG - Intergenic
982457066 4:155622986-155623008 ATGTACATGTATGAGAGGTAGGG - Intergenic
985831602 5:2237954-2237976 AGGTATCTGTATGAGAGGGATGG + Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993598483 5:89889613-89889635 ATTTACATTAAGGAGAGGGAAGG + Intergenic
993932260 5:93954535-93954557 AAGCACCTCAAGCAGAGGGAAGG + Intronic
996397578 5:123028638-123028660 CTGTACCTCTTTGAGAAGGATGG - Intronic
997028725 5:130097441-130097463 ATGAACCTCCAGGAGAGGCTGGG + Intronic
998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG + Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
999666177 5:153916295-153916317 ATGTACCTGTAGGAGGTGGCTGG + Intergenic
1003902497 6:10668128-10668150 ATGCACCTGTAGGAGATGGCTGG + Intergenic
1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG + Intergenic
1005685275 6:28247955-28247977 ATGTAGATCTAGGATAGGGGTGG + Intronic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1008324168 6:50156733-50156755 TGGTACCTCTGTGAGAGGGAAGG + Intergenic
1009202363 6:60761461-60761483 CTGTAACTTTTGGAGAGGGATGG + Intergenic
1012003301 6:93681358-93681380 ATGTACCTACAGGCAAGGGAGGG + Intergenic
1016838369 6:148502201-148502223 CTGTACCTCTGGGAGAAGAATGG + Intronic
1017018481 6:150120557-150120579 ATGTATACCTAGAAGAGGGACGG + Intergenic
1018442590 6:163826552-163826574 ATGAACCTCTAGGGGAGGTGAGG - Intergenic
1018647937 6:165965215-165965237 AGGTGCCCCGAGGAGAGGGATGG + Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1021082022 7:16375851-16375873 ATGATCCTTCAGGAGAGGGAGGG + Intronic
1021899398 7:25268571-25268593 ATAGACCTCTAGGAGAGGGGAGG + Intergenic
1022287229 7:28965190-28965212 CTGCAGCTCTAGGGGAGGGAAGG - Intergenic
1023270997 7:38462621-38462643 CTAAACCACTAGGAGAGGGAAGG + Intronic
1024800383 7:53071005-53071027 ATGTGCCTTTAGGAGAGACATGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029868916 7:103667071-103667093 ATGTAGCCCTAGGATAGGGGAGG - Intronic
1029970036 7:104779956-104779978 ATGTGCCTGTAAGTGAGGGAAGG + Intronic
1032418058 7:131753985-131754007 AGGTACCCCTAGGAGAGTCAGGG + Intergenic
1032915823 7:136488684-136488706 AGGAAGCTCTAGGAGAGAGATGG + Intergenic
1034677504 7:152902514-152902536 ATGTACCTCATGGTGAGGAAGGG - Intergenic
1037101787 8:15055785-15055807 ATGCACCTCAAGGACAGTGATGG - Intronic
1043324656 8:79034641-79034663 ATGCACCTGTAGGAGATGGCTGG - Intergenic
1043811612 8:84749647-84749669 ATGTAGCATTGGGAGAGGGAAGG + Intronic
1046222827 8:111237736-111237758 ATGCACCCCTATAAGAGGGAGGG - Intergenic
1048412140 8:134186138-134186160 ATATCCCCCAAGGAGAGGGAGGG - Intergenic
1050244989 9:3680032-3680054 ATCTACCTTTAGGTGAGGGTTGG - Intergenic
1050510917 9:6394462-6394484 ATGTACATCTAGGCCAGGCATGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1059509925 9:114835847-114835869 ATGTACCTGTAGGAGGTGGCTGG + Intergenic
1060773790 9:126353333-126353355 AATTACCTCTGGGAAAGGGAAGG - Intronic
1061748332 9:132756355-132756377 AGGTGCCTCTAGGAGAGAGTTGG - Intronic
1186410397 X:9341131-9341153 ATGTGTCTGTAGGAGGGGGAAGG - Intergenic
1186692872 X:11997807-11997829 ATGTACCTCAAGGAGAAGAGAGG + Intergenic
1187639514 X:21273247-21273269 ATGTACCCATTAGAGAGGGAAGG + Intergenic
1190549721 X:51566811-51566833 AAGTACCTGTATCAGAGGGAAGG + Intergenic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1192952531 X:76032350-76032372 CTGTATCTCTAGGAGAAGGGGGG - Intergenic
1193127830 X:77888254-77888276 ATGTACGCCAAGGAGAAGGAGGG - Intronic
1193238982 X:79143934-79143956 ATCTACCTTTAGGAGTGGGGAGG + Intergenic
1193961196 X:87926356-87926378 ATATACCTAAAAGAGAGGGAGGG + Intergenic
1194041806 X:88950736-88950758 TGGTACCTCTAGGAGGGGGAAGG + Intergenic
1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG + Intronic
1197328539 X:125124388-125124410 CTGTACATCTAGTAGAAGGATGG + Intergenic
1198213200 X:134533983-134534005 ATGCACCTCCAGGACTGGGAAGG - Intergenic
1199952125 X:152715156-152715178 ATGTACGGCTAAGGGAGGGAAGG + Intronic
1199957558 X:152753292-152753314 ATGTACGGCTAAGGGAGGGAAGG - Exonic
1200075978 X:153551096-153551118 GTGGACATCTAGGAGAGGAATGG + Intronic
1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG + Intergenic
1202388971 Y:24350679-24350701 ATGTACCACTAGCCGAGGGCAGG + Intergenic
1202481816 Y:25319445-25319467 ATGTACCACTAGCCGAGGGCAGG - Intergenic