ID: 1157200494

View in Genome Browser
Species Human (GRCh38)
Location 18:45655123-45655145
Sequence CCTAACAACCTGTCTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157200487_1157200494 27 Left 1157200487 18:45655073-45655095 CCAATAGAACTGGGTTCTCCAGT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 112
1157200488_1157200494 9 Left 1157200488 18:45655091-45655113 CCAGTGTCCACAAATGTCTTAAC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 112
1157200489_1157200494 2 Left 1157200489 18:45655098-45655120 CCACAAATGTCTTAACATCCCAG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157200494 Original CRISPR CCTAACAACCTGTCTCCTCA GGG Intronic
901213102 1:7537468-7537490 CCTAACAACCCTTCTCCAAAAGG + Intronic
905930677 1:41784916-41784938 CCTAAATGCCTGTCTCCACATGG + Intronic
907637162 1:56146910-56146932 CCTACCTGCCTGGCTCCTCAAGG - Intergenic
911460343 1:98181503-98181525 CCTCACTACCTGTCTGCTGATGG + Intergenic
913191404 1:116416265-116416287 GCAAACTCCCTGTCTCCTCAAGG + Intergenic
918456100 1:184716854-184716876 GCTAACATCCTCTTTCCTCAGGG - Intronic
920204039 1:204278599-204278621 CCTACCAACTTGTCTCATTATGG - Intronic
1063601743 10:7488061-7488083 CCTAAGGTCCTGTCTGCTCAGGG - Intergenic
1063667995 10:8077176-8077198 CATCACAACCTGTCTGCTTAGGG - Intergenic
1067031312 10:42880081-42880103 CCTCACAACCGCTCCCCTCAGGG + Intergenic
1074657653 10:115612600-115612622 CCTGACATACTGTCTCCACAAGG - Intronic
1074825915 10:117215911-117215933 CCTCACAAACTGTCCCCACAGGG - Intergenic
1081076508 11:38680770-38680792 TCTCATTACCTGTCTCCTCAGGG + Intergenic
1081197727 11:40181725-40181747 CCTATTAAGCTCTCTCCTCATGG - Intronic
1081999837 11:47388193-47388215 CCTAGCAACCTGTCCCCATAGGG + Intergenic
1085464861 11:76716537-76716559 CCTACCCACCTGTCTGTTCAGGG + Intergenic
1086746028 11:90427785-90427807 CATGACAACCTGTCTGCTCATGG - Intergenic
1087168449 11:95026702-95026724 CCACACAGCCTGTGTCCTCAGGG + Exonic
1092817953 12:12327414-12327436 CCCTACAACCTATATCCTCACGG + Exonic
1094153262 12:27310168-27310190 CCTATAACCCTGTCTCCTGATGG - Intronic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1101913175 12:108876095-108876117 CCTGACCTCCTGTCTCATCATGG - Intronic
1103885747 12:124198916-124198938 CCTGAAACCCTGTCTCCCCAGGG + Intronic
1108044983 13:46374962-46374984 CCTAACCACCTTTCTGCTTAAGG + Intronic
1114136012 14:19851895-19851917 CCTCTCTACCTTTCTCCTCATGG + Intergenic
1117885966 14:60363499-60363521 ACTAGTAACCTGTCACCTCAAGG - Intergenic
1118965910 14:70585110-70585132 CCTAACAACCTGAAAACTCAAGG + Intronic
1124422062 15:29531203-29531225 CCTACCTCCCTGTCTTCTCAAGG - Intronic
1125398092 15:39271461-39271483 TCAAAAAACCTGTCTCCTCAGGG - Intergenic
1126361117 15:47846909-47846931 CCTCACAACCTGCCTACTCTTGG + Intergenic
1128102902 15:65019071-65019093 CCTAACAACCTTTCACATGATGG - Intronic
1128361835 15:66967544-66967566 CTTATCAACATTTCTCCTCATGG + Intergenic
1129242526 15:74260005-74260027 CCTCACAGCCTCCCTCCTCAGGG - Intronic
1129768987 15:78191676-78191698 CCCATCAACCTTTCTCCTGATGG - Intronic
1130063067 15:80583302-80583324 CCTGCCCACCTGTCTCGTCACGG - Intronic
1130917513 15:88317613-88317635 CTCAACAACCTTTCTCCTTATGG - Intergenic
1134244446 16:12529565-12529587 CCTAACTTTCTCTCTCCTCAAGG - Intronic
1136629513 16:31481431-31481453 CCCAACCACCTGGCCCCTCAAGG + Intergenic
1137029496 16:35508169-35508191 CCTAAAGCCCTGTGTCCTCAGGG + Intergenic
1138877396 16:60968932-60968954 CCTAACTAGCTGTGTGCTCAGGG + Intergenic
1139558086 16:67725274-67725296 CCCAAGAACCTGCCTCCACAAGG + Exonic
1140395414 16:74622141-74622163 CCTGACCACCTGTATCCTCTTGG + Exonic
1146629860 17:34462126-34462148 CCTACCCACATGTCACCTCAAGG + Intergenic
1148323460 17:46770913-46770935 CCCAACCATCTCTCTCCTCATGG + Intronic
1148795087 17:50193046-50193068 CCTAACTCCCTTTCTCCACAGGG - Exonic
1149686472 17:58538457-58538479 CCCAAGATCCTGTGTCCTCAAGG - Intronic
1150229898 17:63544135-63544157 CCTCACACCCTGTGTCCCCAGGG + Intronic
1151918470 17:77136446-77136468 ACTAACAATCTCTCTCATCAAGG - Intronic
1152786280 17:82249601-82249623 CCTCACCTCCTGCCTCCTCAGGG - Exonic
1156756362 18:40531565-40531587 CCTAACAACCTGTCTCTGCTTGG + Intergenic
1157200494 18:45655123-45655145 CCTAACAACCTGTCTCCTCAGGG + Intronic
1157511530 18:48278859-48278881 CCTCACAGGCTGTCCCCTCAGGG + Intronic
1163933828 19:20423999-20424021 CCTAACAACCCTTTACCTCAAGG + Intergenic
924998631 2:386498-386520 CATTAGAACATGTCTCCTCATGG + Intergenic
927419447 2:22914999-22915021 CCTCCTAACCTATCTCCTCAAGG + Intergenic
928980128 2:37128845-37128867 CATGATTACCTGTCTCCTCACGG + Intronic
936634168 2:114236350-114236372 ACTAACCACTTGTCTCCTGAGGG + Intergenic
938381589 2:130839225-130839247 CCCCACAACCTGTGTCCTCACGG - Intronic
938473269 2:131585728-131585750 CCTGCCAACCAGTCTCCTGAAGG - Intergenic
939808276 2:146802181-146802203 CCCACAAACCTGTCTTCTCAAGG + Intergenic
940526420 2:154820552-154820574 CCTATCAACTTTTCTCCTGATGG + Intronic
942357597 2:175135206-175135228 CCTATCAACTTTTCTCCTAATGG - Intronic
944827501 2:203500105-203500127 CATGACAACCTCTGTCCTCAAGG + Intronic
945683773 2:212944377-212944399 CTTAACAAACTGTTTCTTCATGG - Intergenic
948035448 2:234854664-234854686 CCTCACACCCTGATTCCTCACGG + Intergenic
1170074936 20:12409282-12409304 TCTAGCATCCTCTCTCCTCAGGG + Intergenic
950825014 3:15809443-15809465 CCTAACAACATGTCTCGTTCAGG + Intronic
951710333 3:25580424-25580446 ACCAACAACCTGCCTGCTCAAGG + Intronic
952868857 3:37879326-37879348 CCTATCTGCCTGTCTCATCAGGG + Intronic
954225282 3:49177214-49177236 CCCCACAACCTTTCTCCTCTGGG - Intergenic
954313846 3:49790310-49790332 CCAATCAGCATGTCTCCTCAGGG - Intergenic
957973972 3:87419774-87419796 TCTTACAAACAGTCTCCTCAAGG + Intergenic
958863049 3:99467882-99467904 CCTATGAACCTGACTCCTCAAGG - Intergenic
960294875 3:115930800-115930822 CCTAACACCCTGACACCACAGGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967700875 3:192590993-192591015 CCAAACTGTCTGTCTCCTCAAGG + Intronic
967745467 3:193050060-193050082 CCTCACCACCTCTCACCTCATGG + Intergenic
969628747 4:8322978-8323000 CCTAACAACCTCCCTCCACCTGG - Intergenic
970476510 4:16429210-16429232 CCAGACAACCTCTGTCCTCAGGG + Intergenic
972560656 4:40225511-40225533 TCTATCAACCTCTCTCCTCTAGG - Intronic
975648269 4:76566823-76566845 TTTTACCACCTGTCTCCTCATGG + Intronic
975838489 4:78449659-78449681 CCTAACATCCTCTGTCCTGAAGG + Intronic
977393224 4:96439982-96440004 TCTAACAATCTCTCTCCTCTAGG - Intergenic
989510997 5:42287492-42287514 CCTGACAACATGTTTCCTAACGG - Intergenic
997175931 5:131777952-131777974 CCTATCAACCATTCACCTCATGG - Intronic
997479624 5:134175206-134175228 CCTAACAACCTGTTTGCTTTGGG - Intronic
998542776 5:142998606-142998628 ACTAACAACCTGTTTCATCCAGG + Intronic
998727898 5:145039592-145039614 ATAAACAACATGTCTCCTCAGGG + Intergenic
1002277094 5:178110998-178111020 CCTACCAGACTGGCTCCTCAAGG + Intergenic
1005434599 6:25795025-25795047 TTCAACAACCTGTATCCTCAGGG - Intronic
1005851665 6:29827742-29827764 TCTAAAAACCTGTCACCTAATGG - Exonic
1011743498 6:90387075-90387097 CCTCACAACTTCTCTCCTCGTGG - Intergenic
1017862714 6:158413875-158413897 CTTAAGAACCTGAATCCTCAGGG + Intronic
1022645941 7:32228731-32228753 CATAACAGCCTGTGTCCTCCTGG + Intronic
1023422236 7:39993079-39993101 CCCAACAACCTATCACCTAATGG + Intronic
1024044607 7:45578244-45578266 CCTAAAGACCTCTCTGCTCAGGG - Intronic
1029355416 7:100048258-100048280 CCTACCAAGCTGTCTTCTCGTGG + Intergenic
1030834890 7:114270552-114270574 CTTAACAACCTATGTCATCAGGG - Intronic
1031922740 7:127613624-127613646 CCAAACTACCTTCCTCCTCAAGG + Intronic
1033533139 7:142286398-142286420 CCTCTCAACCTGGCTTCTCAAGG + Intergenic
1038623297 8:29165851-29165873 AGTAACAATCTGCCTCCTCATGG + Intronic
1052866117 9:33465650-33465672 CCTAGCCACCTGTCTCTCCAGGG - Intronic
1052972811 9:34387350-34387372 CCTCAAAACCTCTCTGCTCAGGG + Intronic
1058853912 9:109041078-109041100 CCTCACCACATATCTCCTCAAGG + Intronic
1059819322 9:117954677-117954699 CCAGACAGCCTGTGTCCTCAAGG + Intergenic
1059926578 9:119215687-119215709 CCTTTCAACCTGTCTTCACATGG + Intronic
1061290641 9:129648838-129648860 CCTAAGAGTCTGTCTGCTCAGGG + Intergenic
1061399456 9:130360446-130360468 GCCACCAACCTGTCTCTTCATGG + Intronic
1186966750 X:14795496-14795518 CATCACACCCTCTCTCCTCAAGG - Intergenic
1187757291 X:22541934-22541956 CCTTACAACCTTCCTCTTCATGG + Intergenic
1189613774 X:42764379-42764401 CATGATTACCTGTCTCCTCACGG + Intergenic
1192234154 X:69285539-69285561 CCTAACATCCCGACTCCTCCAGG + Intergenic
1192430855 X:71110688-71110710 CCTTCCAACCTTTCTCCTCTAGG - Exonic
1192573136 X:72222493-72222515 CATGATTACCTGTCTCCTCACGG + Intronic
1195171467 X:102272664-102272686 ACTAACAATCTGTCTCTCCAAGG + Intergenic
1195187393 X:102414435-102414457 ACTAACAATCTGTCTCTCCAAGG - Intronic
1196936422 X:120735237-120735259 CCTCACAGGCTGTCTCCTCAGGG + Intergenic
1198407011 X:136323152-136323174 CCACACAACCTGACACCTCATGG + Exonic
1201473113 Y:14354805-14354827 CCTAAGAACCTTTGTCCTCTGGG + Intergenic