ID: 1157202290

View in Genome Browser
Species Human (GRCh38)
Location 18:45669232-45669254
Sequence ACTAGACTGTGCTGCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157202290_1157202295 -8 Left 1157202290 18:45669232-45669254 CCCCCACTGCAGCACAGTCTAGT 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1157202295 18:45669247-45669269 AGTCTAGTGTTATGACCAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157202290 Original CRISPR ACTAGACTGTGCTGCAGTGG GGG (reversed) Intronic
903211507 1:21821854-21821876 TACAGGCTGTGCTGCAGTGGAGG - Intronic
903273648 1:22207667-22207689 ACTAGACTGGACAGGAGTGGAGG - Intergenic
904047577 1:27617781-27617803 AGGAGACTGTGCTGCTCTGGAGG - Intronic
905579249 1:39071081-39071103 ACCAGGCTGGGGTGCAGTGGTGG + Intergenic
907405843 1:54252935-54252957 CCCAGGCTGTGCTGCTGTGGGGG + Intronic
911633968 1:100213300-100213322 ACAAGACTCTGCTGCAGGAGCGG + Intronic
911999422 1:104812271-104812293 CCTGGCCTGTGCTGGAGTGGGGG - Intergenic
912432866 1:109638629-109638651 ACTACACAGTGCTGCTGTGAGGG - Intergenic
913101732 1:115573804-115573826 GCAAGAGTTTGCTGCAGTGGTGG + Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
915647892 1:157286921-157286943 TGTTGACTGTGCTGCAGAGGAGG - Intergenic
916405429 1:164493360-164493382 GCTAGACTGTTCTGCAGGAGAGG + Intergenic
919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG + Intergenic
920020191 1:202949886-202949908 ACTATATTCAGCTGCAGTGGAGG - Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923262892 1:232284260-232284282 ACTAGACTGTGCAGAACTGATGG - Intergenic
1065162183 10:22933840-22933862 CCTAGACTGAAGTGCAGTGGTGG - Intronic
1067202688 10:44186951-44186973 AGTGGACTGTTCTGCAGTCGAGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069041747 10:63703157-63703179 ACTAGACTGTGAAGCCATGGGGG + Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1070678318 10:78430904-78430926 ACTTGAATGTGCTCCACTGGCGG - Intergenic
1073342659 10:102757477-102757499 ACAGTACTGTGCTGCAGTGAGGG + Intronic
1073375644 10:103032016-103032038 ACTAGTCACTGCGGCAGTGGAGG + Intronic
1079040262 11:17052966-17052988 ATTAGACTGTTCTGCCGTGCAGG - Intergenic
1079106334 11:17574708-17574730 ACAGGACAGTGCTGCAGTGAGGG - Exonic
1079405344 11:20140417-20140439 ACTACACAGAGCTGCAGGGGAGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1087832009 11:102829698-102829720 ACTAGACTGGGGGGCAGGGGAGG - Intergenic
1087966180 11:104418836-104418858 ACCACACTGTGCTACTGTGGTGG - Intergenic
1088035925 11:105315644-105315666 CCTATACTGTGCTGCAGAGAAGG - Intergenic
1088858785 11:113780410-113780432 CCTATCCTGTGCTCCAGTGGAGG + Exonic
1093838821 12:23870593-23870615 AGTAGACTCAGCTGCAGTGTTGG - Intronic
1096305121 12:50468021-50468043 CCTAGACTGGAATGCAGTGGTGG + Intronic
1098071492 12:66680819-66680841 AATAGACTGGGCTGGGGTGGTGG - Intronic
1099067816 12:78006055-78006077 ACTAGCATGGGCTACAGTGGTGG + Intronic
1099658711 12:85527835-85527857 ACTAGACAATGCTCCAGTGAGGG - Intergenic
1102964017 12:117112451-117112473 CCCAGACTGGACTGCAGTGGTGG + Intergenic
1103913871 12:124366139-124366161 GCTGGGCGGTGCTGCAGTGGTGG - Intronic
1104866557 12:131959368-131959390 AACAGACGGGGCTGCAGTGGTGG + Intronic
1105458756 13:20565132-20565154 CCTAGACTGGAGTGCAGTGGCGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1117559562 14:56922995-56923017 ACTAGGCATTGCTGTAGTGGGGG - Intergenic
1118820984 14:69345928-69345950 CCTAGACTGACATGCAGTGGTGG + Intronic
1119149460 14:72345030-72345052 ACTACACTGAGCTGCACAGGAGG - Intronic
1120371027 14:83636064-83636086 ACCAGGCTGGGGTGCAGTGGTGG + Intergenic
1122127357 14:99586495-99586517 ACTAGAATATGCTAGAGTGGGGG + Intronic
1123206987 14:106723484-106723506 ACTATCCTGTTCTGCAGAGGTGG + Intergenic
1123212006 14:106770487-106770509 ACTATCCTGTTCTGCAGAGGTGG + Intergenic
1128171547 15:65517767-65517789 ACTAGACTGCGCTGTGGTGTTGG - Intergenic
1129525470 15:76211058-76211080 ACTAGGGTGGGCTGCAGTGCAGG - Intronic
1129816345 15:78557747-78557769 ACTAGAAATTGATGCAGTGGGGG - Intergenic
1136137844 16:28268283-28268305 ACTAGGCTGGAGTGCAGTGGTGG + Intergenic
1142816838 17:2433179-2433201 ACTGGGCTGGGTTGCAGTGGAGG + Intronic
1143854313 17:9837400-9837422 ACTAAATTTGGCTGCAGTGGGGG + Intronic
1144735149 17:17551478-17551500 ACTGGGCTGGGCTGCTGTGGAGG - Intronic
1147216056 17:38899519-38899541 CATAGAGTGGGCTGCAGTGGTGG + Intronic
1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG + Exonic
1149636803 17:58177441-58177463 ACTGGACTGAGCTGCTGTGAAGG + Intergenic
1150251167 17:63705355-63705377 ACTAGAATTTGCTGCAGCGAAGG - Intronic
1152236092 17:79139640-79139662 ACGTGGCTGTGATGCAGTGGGGG + Intronic
1152446960 17:80350754-80350776 CCTAGGCTGGACTGCAGTGGTGG - Intronic
1154043980 18:10887110-10887132 ACCAGACTGGAGTGCAGTGGTGG + Intronic
1154277229 18:12972727-12972749 AGTAGAATGTGCTGCAGTGATGG + Intronic
1156327479 18:36086894-36086916 ACCAGACTGGAGTGCAGTGGTGG - Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1159258924 18:65985848-65985870 ATTAGACTGGGCTACACTGGGGG + Intergenic
1160207669 18:76848706-76848728 CCCAGACTGGGGTGCAGTGGTGG + Intronic
1162247999 19:9418855-9418877 TCAAGAGTGTGCTGCAGTGGAGG - Exonic
1162693302 19:12451233-12451255 ACTAGAGTGTGCGGAAGCGGAGG + Intronic
1165230658 19:34384530-34384552 ATTAAACTGTCCTGCAGTTGAGG + Intronic
1166633721 19:44431011-44431033 ACCATACTGTGAGGCAGTGGTGG + Intronic
1168661976 19:58174328-58174350 GCCAGACTGTGCTGCAATGAAGG - Intergenic
926252201 2:11161319-11161341 CCTAGGCTGGGTTGCAGTGGTGG + Intronic
926428963 2:12766794-12766816 AATAGACTGTGCTGCAGCCAGGG + Intergenic
927347217 2:22059035-22059057 ACTAGACTGTGCTTAAGGTGAGG - Intergenic
929130696 2:38566920-38566942 ACCAGACTGTTCATCAGTGGGGG + Intronic
929153253 2:38767329-38767351 ACTACATTGTTCTGCAGTGGAGG + Intronic
929613896 2:43293067-43293089 ACTAGCCATTGCTGCAGTGTGGG - Exonic
929855912 2:45638598-45638620 ACTACACTGTGCTGTAGGGACGG + Intergenic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931154137 2:59608378-59608400 ACTAGGCAGTGCTTTAGTGGGGG - Intergenic
931877430 2:66528960-66528982 ACAAGACTGTGCAGCACTGATGG - Intronic
932469179 2:71942822-71942844 CCTAGCCTGTTCTCCAGTGGTGG + Intergenic
932852246 2:75198975-75198997 ACAGGACTCTGCTGCAGAGGGGG - Exonic
933462175 2:82602069-82602091 ACACCACTGTGCTGCGGTGGAGG + Intergenic
935934040 2:108162782-108162804 AGTAGAATGAGCTGCAGAGGAGG - Intergenic
939128963 2:138211650-138211672 ACTTGACTGTGCTTCTCTGGGGG + Intergenic
939302413 2:140361893-140361915 ACTGGACTGTGATGCATTTGAGG - Intronic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
942469657 2:176246497-176246519 GCCACACTGTGCTCCAGTGGAGG + Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
947468776 2:230381085-230381107 ACAAGTGTGTGCTGCAGTGGAGG + Intronic
1169198810 20:3697690-3697712 ACCACTCTGTGCAGCAGTGGGGG - Intronic
1171284360 20:23924948-23924970 ACTAGCATGTGCTGCAGGGAGGG + Intergenic
1172669013 20:36621136-36621158 AGTAGACGGGGCTGCTGTGGTGG + Intronic
1173896068 20:46551701-46551723 ACTGGGCTCTGCTGCTGTGGAGG + Intergenic
1181629489 22:24143123-24143145 ACTAGTCTGTGCTGGAGGAGGGG + Intronic
1182902240 22:33908084-33908106 GTCATACTGTGCTGCAGTGGTGG - Intronic
1183745996 22:39691961-39691983 ACTGAACTGAGCTGCAGAGGTGG - Intergenic
1184386429 22:44178352-44178374 CCTGGACTGTGCTGTAGTGAGGG + Intronic
950836612 3:15925628-15925650 ACTAGAGTGAGCAGCAGAGGTGG + Intergenic
952891929 3:38048869-38048891 GCTACACTGTGCTGTGGTGGAGG - Intronic
954837047 3:53479026-53479048 ACAAGACTGTGCCGCATAGGTGG - Intergenic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
960003255 3:112754881-112754903 TTTAGGCTCTGCTGCAGTGGAGG - Intronic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
964954460 3:162335065-162335087 ACTAGACAGTGCTGCAAGTGGGG - Intergenic
965332482 3:167393160-167393182 GCTAGACTTTGCTGCAAGGGAGG - Intergenic
965814907 3:172626265-172626287 TCTATACTCTGCTGAAGTGGAGG + Intergenic
966082800 3:176025706-176025728 ACTGGGCTGTGCTGCAGAGGTGG - Intergenic
966284485 3:178277869-178277891 ATTAGACTGTGCTTCTCTGGAGG + Intergenic
966948066 3:184791401-184791423 GCCAGGCTGTGCTGGAGTGGGGG - Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971169343 4:24217386-24217408 ACTAGAATGTGGTGAATTGGAGG + Intergenic
972439081 4:39067721-39067743 GCTAGACTGGAATGCAGTGGCGG + Intronic
972775804 4:42239404-42239426 ACTAGCCTGTGCTGGAGAGAGGG - Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
977489224 4:97691310-97691332 AATAAACTGTGCTGTTGTGGGGG + Intronic
978799752 4:112743871-112743893 CCCAGGCTGTACTGCAGTGGCGG + Intergenic
982342962 4:154323508-154323530 TCTAGGCTGTGCATCAGTGGGGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983194846 4:164795864-164795886 ACTAGACTGTGCTTTCTTGGAGG - Intergenic
983868706 4:172799309-172799331 ACTAATCTATGCTGCAGTGGGGG + Intronic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
987155330 5:15083424-15083446 TCTAGACTGAGCAGCAGAGGTGG - Intergenic
987299523 5:16585139-16585161 ATCAGAGTCTGCTGCAGTGGAGG + Intronic
988481024 5:31630696-31630718 ACTAGAGAGAGCTGCAGGGGAGG + Intergenic
991411570 5:66351360-66351382 AATGGACTGTGCTGCACTGTCGG - Intergenic
992236738 5:74717521-74717543 ACTAGACCGTGCTGCTCTAGAGG + Intronic
992467437 5:77020894-77020916 ACCAGGCTGTAGTGCAGTGGCGG + Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
996183040 5:120443357-120443379 AATAGAATGTTCTGTAGTGGTGG + Intergenic
1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG + Intergenic
1003036848 6:2647602-2647624 AGTAGTCTGTGCTACAGTTGGGG - Intergenic
1008517722 6:52334019-52334041 ACTAGATTGTGCTACAGAGTTGG + Intergenic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1013510093 6:110837112-110837134 ATCAGACTGTAGTGCAGTGGTGG - Intronic
1013510095 6:110837136-110837158 CTCAGACTGTACTGCAGTGGTGG - Intronic
1013613398 6:111817884-111817906 ACCAGACAGTGCCCCAGTGGAGG - Intronic
1014479265 6:121915633-121915655 ACCAGGCTGGACTGCAGTGGTGG + Intergenic
1015344714 6:132142576-132142598 ACTAGAATGTGCTGAAGGGATGG - Intergenic
1017432554 6:154385351-154385373 TCCAGGCTGTGCTGCAGTGTAGG - Intronic
1017886234 6:158601714-158601736 CCCAGGCTGGGCTGCAGTGGCGG - Intronic
1019471181 7:1221999-1222021 ATTAGACTGGAGTGCAGTGGCGG - Intergenic
1021506059 7:21386275-21386297 ACTAGGCTGGAGTGCAGTGGTGG - Intergenic
1021714318 7:23447579-23447601 TCTAGGCTGGACTGCAGTGGTGG - Intronic
1022330127 7:29370810-29370832 AGTAGACTTTGCTGCAGAGCTGG + Intronic
1022369371 7:29756580-29756602 TACAGACAGTGCTGCAGTGGGGG - Intergenic
1023370451 7:39507780-39507802 ACTACAGTGTGCTGATGTGGTGG + Intergenic
1024179859 7:46881217-46881239 ACTTGCCTGTCCTGCATTGGCGG - Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1031675851 7:124610866-124610888 ACCAGCATCTGCTGCAGTGGAGG - Intergenic
1034032593 7:147784809-147784831 GCTGGACTGTGCTGCAGTGGTGG + Intronic
1036106937 8:5851327-5851349 TGTAAACTGTGCTGCAGTAGAGG - Intergenic
1042320618 8:67471285-67471307 GCTAGACAGTGCAGCAGTGAGGG - Intronic
1043678981 8:82997400-82997422 ACTAGAACCTGCTGCAGTGGAGG - Intergenic
1043787037 8:84416354-84416376 ACTAGTCTGTGCAGGAGTGGAGG + Intronic
1043820910 8:84862617-84862639 ACCATACTGTGTTGCAGTAGGGG + Intronic
1045100762 8:98841637-98841659 CCCAGACTGGGGTGCAGTGGAGG - Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1046809770 8:118520044-118520066 ACTAGACAATGCTACAGTGAAGG + Intronic
1050146802 9:2576826-2576848 ACTTGGCTGTGCTCCAGAGGTGG - Intergenic
1056832776 9:89930243-89930265 CCTAGACTGTGCAGCAGTAGGGG - Intergenic
1057501937 9:95603056-95603078 CCTAGACTGCCATGCAGTGGAGG - Intergenic
1059923956 9:119187395-119187417 ACAAGACTTTGTGGCAGTGGTGG - Intronic
1060834210 9:126742774-126742796 ACCAGACTGGAGTGCAGTGGCGG - Intergenic
1061075055 9:128336109-128336131 ACTTTAGTGAGCTGCAGTGGGGG - Intergenic
1061246834 9:129404901-129404923 ACCAGACTCTGCTGCAGGGGAGG - Intergenic
1061485795 9:130919951-130919973 ACAAGACTGTGCGGCAGGGCAGG + Intronic
1062202836 9:135315494-135315516 CCTAGACTGGAGTGCAGTGGTGG + Intergenic
1062291990 9:135799794-135799816 CCCAGACTGTAGTGCAGTGGTGG + Intergenic
1186272646 X:7905873-7905895 ACTCAACTGTGCTGTAGTAGAGG - Intronic
1187568238 X:20474354-20474376 ACTTGACTTTGCTTCAGTGGAGG - Intergenic
1188114979 X:26231861-26231883 ACAAGAATTTGCTGCAGGGGTGG - Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1189980189 X:46502261-46502283 CCTAGGCTGGGGTGCAGTGGTGG - Intronic
1190755740 X:53400285-53400307 ACTACATTATGTTGCAGTGGTGG - Intronic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1200137530 X:153882298-153882320 CCCAGGCTGTGCTTCAGTGGAGG - Intronic
1201112951 Y:10813745-10813767 ACCAGACTGAAGTGCAGTGGCGG + Intergenic