ID: 1157203127

View in Genome Browser
Species Human (GRCh38)
Location 18:45676299-45676321
Sequence CAGGTGGCCCGGTGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 658}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157203114_1157203127 25 Left 1157203114 18:45676251-45676273 CCACTCTAGGCTCTCTTAGTGGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG 0: 1
1: 0
2: 4
3: 60
4: 658
1157203117_1157203127 2 Left 1157203117 18:45676274-45676296 CCATGACTTCCACATAGGATCGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG 0: 1
1: 0
2: 4
3: 60
4: 658
1157203120_1157203127 -7 Left 1157203120 18:45676283-45676305 CCACATAGGATCGGAGCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 66
Right 1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG 0: 1
1: 0
2: 4
3: 60
4: 658
1157203116_1157203127 3 Left 1157203116 18:45676273-45676295 CCCATGACTTCCACATAGGATCG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG 0: 1
1: 0
2: 4
3: 60
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157203127 Original CRISPR CAGGTGGCCCGGTGGGGAGG TGG Intronic
900176050 1:1291799-1291821 AAGGAGGCCCGGGGCGGAGGGGG + Exonic
900585883 1:3432163-3432185 GAGGAGGCCAGGTGGGGTGGGGG - Intronic
900931839 1:5742831-5742853 GAGGTGGCGCTGTGGGGAGAAGG - Intergenic
901656289 1:10771689-10771711 CAGTTGGGCTGGTGAGGAGGAGG - Intronic
902388391 1:16088834-16088856 CAGGTGGGCAGGTGGGCAGCGGG + Intergenic
902707968 1:18219472-18219494 CAGGTGGGCCAGTGAGGAGATGG + Intronic
902836805 1:19052817-19052839 AAGGTGACCCGGTGGGGAGGAGG - Intergenic
902993048 1:20203093-20203115 AAGGTGGCCTGATGGGTAGGTGG - Intergenic
904005485 1:27361098-27361120 CAGGATGCCCGGGGGGGAGTGGG - Intronic
904025981 1:27504121-27504143 AAGGTGGCCAAGTGGGCAGGGGG + Intergenic
904034618 1:27551983-27552005 CAGGGGGCCGGGTGGGAAGCAGG + Exonic
904116181 1:28163706-28163728 CAGCTGGGCCAGTGGGGAGAGGG - Intronic
904379261 1:30100347-30100369 GTGGTGGGCCGGTGGGGTGGGGG + Intergenic
905145425 1:35883773-35883795 CAGGTGTCCAGGAGAGGAGGGGG + Intronic
905834559 1:41106355-41106377 CAGATGGCAGTGTGGGGAGGGGG - Intronic
906034272 1:42740878-42740900 CAAGGGGCCTGGTGGGGAGCTGG + Intergenic
906089280 1:43164609-43164631 CAGGTGCCCGGGTGAGGAGCAGG - Intronic
906699402 1:47847041-47847063 CAGATGCTCCAGTGGGGAGGAGG - Intronic
907909151 1:58811840-58811862 CAGGAGGCTGGATGGGGAGGTGG + Intergenic
908420162 1:63951712-63951734 CATGTGGGCTGGTGGTGAGGGGG - Intronic
909086444 1:71174270-71174292 CAGTTGGCAGGGTGGGGAGCTGG + Intergenic
909314406 1:74197794-74197816 CAGATGGCCCGGGGTGGCGGGGG + Intronic
910245334 1:85132697-85132719 CAGGAGGGCAGGTGGGCAGGAGG - Intronic
910665547 1:89722467-89722489 CAGGTGGGGAGATGGGGAGGGGG - Intronic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
914847026 1:151289060-151289082 CAGGAGGCCCTGTGGTGAGGTGG - Intronic
914869089 1:151458699-151458721 GCGGTGGCCCGCTGGGGAAGGGG - Intronic
915319813 1:155050603-155050625 CGGGTGGCGCTGTTGGGAGGTGG - Exonic
915354913 1:155250358-155250380 CCGGTGCCCCGGTGGGGTGAGGG + Exonic
915461714 1:156074658-156074680 CCGGGGGGCAGGTGGGGAGGGGG - Exonic
916246302 1:162691612-162691634 CAACTGGCTCTGTGGGGAGGCGG + Intronic
916651734 1:166839785-166839807 GAGGGGGCCAGGTGGGGAGGCGG + Intronic
916713248 1:167430554-167430576 CAGGTTGCCCTTGGGGGAGGAGG - Intergenic
917217918 1:172697090-172697112 CAGGTGGCCAGAAAGGGAGGTGG + Intergenic
917965869 1:180178195-180178217 TAGGAGGCCGTGTGGGGAGGGGG - Intronic
918144065 1:181740503-181740525 CAAGTGGCCTGGTGGGGGTGGGG + Intronic
919849181 1:201660875-201660897 CAGGTGGCCAGGGTGGCAGGGGG + Intronic
920302402 1:204997068-204997090 CAGGCAGCCCGGTGAGGAGACGG - Intronic
920385492 1:205568342-205568364 CACCTGGCCAGGTGGGGAGGAGG + Intergenic
920434568 1:205939652-205939674 TGGGTGGCATGGTGGGGAGGAGG + Intronic
920685953 1:208109134-208109156 CAGGTGGCAGGGGTGGGAGGTGG + Intronic
922176558 1:223202205-223202227 CAGGTGTGCAGGTGGTGAGGTGG + Intergenic
922201376 1:223404409-223404431 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
922533762 1:226364684-226364706 GAGGTGGCCCGGCTGGGAAGTGG + Intronic
922648867 1:227319017-227319039 CTGGGGGGCCGGTGGGGAGCAGG - Intergenic
922721209 1:227901216-227901238 CAGGAGGGCTGGTGGGGCGGGGG - Intergenic
922740842 1:228013527-228013549 CAGCTGGGCCGGCGGGCAGGAGG + Intronic
922974037 1:229768882-229768904 CAGGTGGCAGGGCTGGGAGGTGG + Intergenic
923020356 1:230158761-230158783 GAGGTGGCGGGGTGGGTAGGGGG - Intronic
923772255 1:236947954-236947976 CAGGAGGCCCTGTGGGGCGCAGG + Intergenic
924561175 1:245156870-245156892 CAGGCCGCCCGGGGGGCAGGAGG + Intronic
924943926 1:248832094-248832116 GTGGTTGCCTGGTGGGGAGGTGG + Intergenic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063432043 10:5999506-5999528 CAGGGAGCCCTGTGGGGAGGGGG + Intergenic
1064086531 10:12349768-12349790 CCGGGGGCGCGCTGGGGAGGGGG - Exonic
1064516467 10:16154583-16154605 CAGTGGGCCGGGTGGGGCGGGGG + Intergenic
1065099658 10:22321029-22321051 CACGTGACCCGCTGGGGGGGCGG + Intronic
1067036619 10:42925691-42925713 GAGGTGGGCTGGTGGGGAGGGGG - Intergenic
1067214765 10:44293020-44293042 GAGGTGGGGAGGTGGGGAGGGGG + Intronic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1070559197 10:77553072-77553094 CGGGTGGCGGGGTGGGGAGGCGG + Intronic
1070722727 10:78768024-78768046 CAGGTGGCCCTGTGGGCAGGAGG + Intergenic
1070772355 10:79089789-79089811 CAGGTGGCCTGAGGGGTAGGGGG - Intronic
1070796756 10:79221439-79221461 GAGGGGGCCTGGTGAGGAGGAGG - Intronic
1070814042 10:79312248-79312270 GAGGTGGGCTGGTGGGAAGGCGG - Intronic
1072615922 10:97048884-97048906 CAAGTAGGCCGGTGGGCAGGTGG + Intronic
1072615933 10:97048916-97048938 TAGGTGGACAGGTGGGCAGGTGG + Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1073265906 10:102228296-102228318 CCTGTGGACAGGTGGGGAGGTGG + Intronic
1073867150 10:107818210-107818232 CTGGGGGCCAGGTGGGGAGCAGG + Intergenic
1075206403 10:120453167-120453189 CAGGTGGCGGGGTGGGGTGGCGG + Intergenic
1075700634 10:124467372-124467394 CAGCTGGCAGGGTGGAGAGGGGG + Intronic
1075704858 10:124494547-124494569 CAGGTGGGCAGGAGGGGACGAGG + Intronic
1075779703 10:125009298-125009320 CAGGTGGCCTGGGAGGCAGGAGG + Intronic
1076723695 10:132403860-132403882 CAGGTGGGCAGATGGGGATGAGG + Intronic
1076829908 10:132988984-132989006 CCTGAGGCCCGGTGGGGGGGGGG + Intergenic
1076889664 10:133277340-133277362 CAGGCGTCCAAGTGGGGAGGGGG + Intergenic
1076994278 11:290590-290612 CAGGGAGCCCGGTAAGGAGGGGG + Exonic
1077023440 11:429831-429853 TAGGTGGGCCGGAGAGGAGGTGG + Intronic
1077076490 11:704722-704744 CAGGTGACCCGGAGTGGATGGGG + Intronic
1077114577 11:877745-877767 AAGGCGGCACTGTGGGGAGGCGG + Intronic
1077114587 11:877777-877799 AAGGCGGCACTGTGGGGAGGCGG + Intronic
1077114606 11:877841-877863 AAGGCGGCACTGTGGGGAGGCGG + Intronic
1077184557 11:1230380-1230402 GATGTGGCTCTGTGGGGAGGTGG - Intronic
1077186687 11:1238629-1238651 CAGGTGGGCAGATGGGCAGGTGG + Intronic
1077299378 11:1840116-1840138 CAGGTCGGCCGGTGAGGTGGGGG - Intronic
1077486086 11:2839009-2839031 TAGGTGGGCAGGTGGGCAGGTGG + Intronic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1078012829 11:7586700-7586722 AAGGTGGTCCCTTGGGGAGGAGG + Intronic
1078266450 11:9758890-9758912 CAGGCGGCCTGGTTGGGATGAGG + Intergenic
1078507013 11:11959769-11959791 CAGGTGAGCTGGTGAGGAGGTGG - Intergenic
1079093588 11:17496924-17496946 CAGGTGGGCCCGTGGGAAGAAGG - Intronic
1080659600 11:34285181-34285203 CGAGGGGACCGGTGGGGAGGGGG + Intronic
1082807250 11:57458971-57458993 CAGGGAGCCCCGCGGGGAGGAGG + Intergenic
1083302027 11:61744527-61744549 CAGGTGGCCCTGTGGGCACCTGG + Exonic
1083431675 11:62616575-62616597 CAGGTGGCCCCGGGGAGCGGTGG + Exonic
1083596220 11:63919308-63919330 GAGGGGGCCAGCTGGGGAGGGGG - Intergenic
1083615015 11:64021925-64021947 CAGGGGGCCGGGGGGGGGGGGGG + Intronic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083697181 11:64450592-64450614 CTGGTGGTCAGGAGGGGAGGTGG - Exonic
1083765353 11:64838894-64838916 CAGGTGGTCCTGTGGGTCGGGGG + Exonic
1083882388 11:65555027-65555049 CTGGTGGCCAGGTGAAGAGGAGG - Intronic
1084008830 11:66336631-66336653 CAGGAGGCCGTGTGTGGAGGTGG - Intronic
1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG + Intronic
1084438658 11:69158186-69158208 CAGCTGGCCATGTGGGGAGATGG + Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084711952 11:70849112-70849134 CTTGTGTCCTGGTGGGGAGGGGG - Intronic
1085390916 11:76181753-76181775 CGGGTGGCCTGGCGGGCAGGCGG + Intergenic
1085405123 11:76257138-76257160 CACGAGCCCCGGCGGGGAGGAGG - Intergenic
1085455025 11:76660740-76660762 GGGGTGGCCCTGTGGGGAGCCGG + Exonic
1085524688 11:77157401-77157423 CAGGTGGGCCCCTGGGTAGGGGG + Intronic
1085909955 11:80811479-80811501 CAGGTGGGCCTGGTGGGAGGTGG - Intergenic
1086942348 11:92811577-92811599 CAGATGGCCAGGTTGGGAGTTGG + Intronic
1087258096 11:95979445-95979467 CAGGTGTACCTGTGGGGAAGCGG + Exonic
1088522273 11:110712485-110712507 CAGGGCGCCCGGAGCGGAGGGGG - Intronic
1088544497 11:110946028-110946050 CAGGTGGCAGGTTGGGGTGGAGG + Intergenic
1088994641 11:114985853-114985875 CAGGTGCCCAGGAGGGCAGGAGG + Intergenic
1089359489 11:117876572-117876594 CAGGTAGGCGGCTGGGGAGGTGG - Exonic
1089624252 11:119741381-119741403 CTGGAGGCGAGGTGGGGAGGCGG - Intergenic
1089641898 11:119853311-119853333 GAGGTGGCCCTGGGAGGAGGGGG - Intergenic
1089662168 11:119992841-119992863 GAGAGGGCCCTGTGGGGAGGAGG - Intergenic
1089690618 11:120184745-120184767 CACGTGTCCGGGTGGGGAGGAGG + Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090407256 11:126484167-126484189 GAGGTGCTCAGGTGGGGAGGGGG - Intronic
1090807092 11:130209576-130209598 CAGGTGGCCCCCGGGGCAGGAGG + Exonic
1091252350 11:134154479-134154501 CAGATGGGGCGGTGGGGGGGGGG - Intronic
1091390005 12:120374-120396 CAGGTCACTCGGTGGGGATGAGG + Intronic
1091610590 12:2004393-2004415 CAGGCGGCCTGGTGGGAAAGGGG - Exonic
1091659232 12:2370866-2370888 GCGGTGTCCAGGTGGGGAGGGGG + Intronic
1091779180 12:3203144-3203166 CAGGTGGCAGGGTGGGGGTGGGG - Intronic
1092747436 12:11687180-11687202 AAGGTGGGGCGGTGGGGTGGGGG - Intronic
1094219029 12:27973919-27973941 CAGGAGGCCCAGAGAGGAGGCGG + Intergenic
1095752766 12:45729593-45729615 CAGGAGGCCAGGGGGAGAGGAGG - Intergenic
1095960700 12:47832792-47832814 CAAGAGGCCAAGTGGGGAGGAGG - Intronic
1096863408 12:54546642-54546664 CAGGAGGCCCTGTGGGGAGGAGG - Exonic
1097120426 12:56727208-56727230 CAGGAGTCCGGGCGGGGAGGCGG - Intronic
1097980022 12:65729080-65729102 CAGGTGGCGCGGAGCGAAGGGGG - Intergenic
1099590048 12:84575330-84575352 ATGGTGCCCCTGTGGGGAGGGGG + Intergenic
1102028518 12:109726996-109727018 AAGGTGGCCGGGCTGGGAGGTGG + Intronic
1102193710 12:111009003-111009025 CAAGTGACTTGGTGGGGAGGGGG - Intergenic
1102244719 12:111348063-111348085 CATGAGGCCTGGTGAGGAGGCGG - Exonic
1102433115 12:112898921-112898943 CATATGTCCTGGTGGGGAGGAGG - Intergenic
1102851230 12:116246881-116246903 GAGGTGGGGAGGTGGGGAGGCGG + Intronic
1103080096 12:118016932-118016954 CAGGCGGCCGCGCGGGGAGGAGG + Intronic
1104826293 12:131711594-131711616 CTGGTGTTCTGGTGGGGAGGGGG + Intronic
1104935382 12:132361502-132361524 CAGGTCTCCCCGTGGGGCGGAGG - Intergenic
1105016327 12:132788133-132788155 CTGGTGCCGGGGTGGGGAGGTGG - Intronic
1106108965 13:26760538-26760560 CAGGCGGCCCGCGGGGGCGGGGG + Intronic
1106141041 13:27011961-27011983 CAGTTTCCCCGGTGGAGAGGAGG + Intergenic
1106766497 13:32918726-32918748 CTGAGGGCCCTGTGGGGAGGAGG + Intergenic
1106792329 13:33168374-33168396 CAGGTGGTCCGGTGGGCTGTTGG - Intronic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1110486618 13:76051978-76052000 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
1113179480 13:107609117-107609139 GAGGTGGCCAGGGAGGGAGGTGG - Intronic
1113566186 13:111320966-111320988 CAGGGGGGCGGGTGGGGTGGGGG + Intronic
1113835590 13:113326365-113326387 AGGGTGGCGCGGTGGGGGGGGGG + Intronic
1113939443 13:114010745-114010767 GAGGGGGCCGCGTGGGGAGGTGG + Intronic
1113939456 13:114010772-114010794 GAGGGGGCCGCGTGGGGAGGAGG + Intronic
1114474170 14:22982290-22982312 CAGGGTGCCAGGCGGGGAGGGGG - Exonic
1114664182 14:24368669-24368691 CAGGCGGCCCAGCCGGGAGGCGG - Intronic
1115850180 14:37584453-37584475 CCCAGGGCCCGGTGGGGAGGGGG + Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117949402 14:61066424-61066446 CTGATGGCCAGGTGGGCAGGTGG + Intronic
1121226034 14:92322785-92322807 TGGGTGGCGGGGTGGGGAGGGGG + Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121523138 14:94599878-94599900 CTGGGGGCCCTGAGGGGAGGTGG + Intronic
1121525351 14:94615540-94615562 GAGGTGGCCAGGTGGGGCTGGGG + Intronic
1121733776 14:96204400-96204422 AGGGTGGCCAGGTGGGCAGGCGG - Intergenic
1122141994 14:99668140-99668162 CAGGGAGCCGGGTGGTGAGGCGG + Intronic
1122216491 14:100208248-100208270 CAGGAGCCCCGGTGGGGAGCGGG + Intergenic
1122328679 14:100898650-100898672 CAGGTAGCCCCGTGGGGGTGAGG - Intergenic
1122546310 14:102524631-102524653 CTGGTGGTCCGGGGCGGAGGCGG - Intergenic
1122785449 14:104161287-104161309 CAGGTGCCCCTGGGGTGAGGTGG + Intronic
1122848027 14:104511308-104511330 CAGGTCCCCGGGTGGCGAGGGGG - Intronic
1122922556 14:104886026-104886048 CGGGAGGCCCTGTGGAGAGGAGG - Exonic
1123044653 14:105505382-105505404 CCGGGGGCCAGGTGGGCAGGCGG + Intergenic
1123145278 14:106123871-106123893 CAGGTGCACAGCTGGGGAGGAGG - Intergenic
1123197044 14:106627113-106627135 CAGGAGGCCCGGTCAGGAGCAGG - Intergenic
1123706817 15:22956646-22956668 CAGGTGGCCAGGAAGGGTGGGGG + Intronic
1124999477 15:34755145-34755167 CTGGAGGCCCGGCGGGGAGCGGG + Intergenic
1125476075 15:40048832-40048854 CAGGGGGCCAGGGGGTGAGGAGG - Intergenic
1125675407 15:41499702-41499724 CAAGTGCCTCTGTGGGGAGGCGG + Intronic
1125681219 15:41531401-41531423 AAGGTGGGCAGGTGGGCAGGTGG - Intronic
1126065706 15:44824793-44824815 CAGGAGGCCTGTTGGGGAGTTGG + Intergenic
1126094129 15:45075774-45075796 CAGGAGGCCTGTTGGGGAGTTGG - Exonic
1126376326 15:48000543-48000565 CAGGAAGCCTGCTGGGGAGGAGG - Intergenic
1128443230 15:67732942-67732964 CAGATAGCTCTGTGGGGAGGGGG + Intronic
1128451147 15:67806632-67806654 CGGGTGGCCCTGCGGGGAAGAGG - Exonic
1129005053 15:72365964-72365986 CAGGTGGTCTGGTGGAGAAGAGG - Intronic
1129217022 15:74106431-74106453 CAGGGGTCCCTTTGGGGAGGTGG - Intronic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1129470823 15:75752424-75752446 CAGGGGTCCCCTTGGGGAGGTGG + Intergenic
1129992652 15:79978272-79978294 CAGGTGTGCCGGAGGGGATGAGG - Intergenic
1131063994 15:89421645-89421667 CCGGTGGCCTTGTGGGGAGTGGG + Intergenic
1131065185 15:89430148-89430170 GACCTGGCCTGGTGGGGAGGTGG - Intergenic
1131111471 15:89767490-89767512 ACAGTGGCCCGGTGGGGGGGAGG + Intronic
1131259685 15:90882015-90882037 CAGGTGGCCAGGTGGGCCCGAGG - Exonic
1131455318 15:92578913-92578935 CAGGAGGGCTAGTGGGGAGGAGG - Intergenic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132394187 15:101460062-101460084 CATGTGGCTGTGTGGGGAGGAGG - Intronic
1132589987 16:722377-722399 CAGGCTGCCAGGTGGGGAGTGGG - Exonic
1132626466 16:894013-894035 CAGACGGCCCGGTGGACAGGGGG - Intronic
1132686767 16:1165537-1165559 CCGGAGGCCAGGTGGGGAGGGGG - Intronic
1132870197 16:2112454-2112476 CAGGTGGACCTTTGGGGATGGGG - Exonic
1132931855 16:2462739-2462761 CAGGTGGCAGGGTGGGGGCGGGG - Intronic
1133118414 16:3591362-3591384 TGGGTGCCCCGGTGGGGTGGCGG + Intronic
1133219890 16:4315600-4315622 GAGGTGGCCTGGGGGGGCGGGGG - Intronic
1134044130 16:11088989-11089011 CAGGTGGCCTGGGGGGAAAGGGG - Intronic
1134123960 16:11603653-11603675 GAGGTGGCCGGGTTGGGATGGGG - Intronic
1134522346 16:14924502-14924524 CAGGTGGACCTTTGGGGATGGGG + Intronic
1134626576 16:15726820-15726842 GAGGTGGCGCGGTGGTGTGGTGG - Intronic
1134710016 16:16323153-16323175 CAGGTGGACCTTTGGGGATGGGG + Intergenic
1134717231 16:16363153-16363175 CAGGTGGACCTTTGGGGATGGGG + Intergenic
1134949587 16:18345492-18345514 CAGGTGGACCTTTGGGGATGGGG - Intergenic
1134957520 16:18389006-18389028 CAGGTGGACCTTTGGGGATGGGG - Intergenic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1136129549 16:28211489-28211511 CTCGGGGCCCGGTGGGGAAGGGG - Exonic
1136348438 16:29691857-29691879 CTTGTGGCTCGGAGGGGAGGTGG + Intronic
1136540760 16:30926584-30926606 GAGGTGGCAGAGTGGGGAGGGGG - Intronic
1137286205 16:47017782-47017804 CAGATGGCCCAGGTGGGAGGCGG + Intergenic
1138417042 16:56877658-56877680 CAGGCGGCCAGCTGGGCAGGGGG - Intronic
1138602305 16:58063365-58063387 CTGGTGGCCCTGTGGTGAGATGG + Intergenic
1139515839 16:67451909-67451931 CAGGTGGGCCAGTGGGCAGTGGG + Intronic
1139534431 16:67562727-67562749 AAGGGGGCCCGGGGTGGAGGAGG + Intronic
1139545958 16:67649652-67649674 CAGGGGGCGCGGTGGAGAGGAGG + Intronic
1139924144 16:70476547-70476569 CAGGGGGCTCGGTGGCCAGGAGG - Intronic
1140190464 16:72811603-72811625 CAGGTGCCACGCTGTGGAGGTGG + Exonic
1141472229 16:84246877-84246899 CAGATGGCGGGGTGGGGCGGTGG + Intergenic
1141650636 16:85391085-85391107 CAGCTGGGGCGGTGGGGGGGCGG - Intergenic
1142222254 16:88861322-88861344 CAGGTGGGCTGGTCTGGAGGGGG + Exonic
1142697818 17:1643399-1643421 CAGGTGGGCTGGCGGGGCGGGGG - Intronic
1143550924 17:7630062-7630084 AAGGTTGCCCGGGGAGGAGGGGG - Intronic
1143719459 17:8799408-8799430 CAGGTGGCCCGCGGAGGCGGTGG - Intergenic
1143780532 17:9226497-9226519 GAGGTGGTCTCGTGGGGAGGTGG + Intronic
1143780537 17:9226513-9226535 GAGGTGGTCTCGTGGGGAGGCGG + Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144502655 17:15802688-15802710 AAGAAGGCCTGGTGGGGAGGAGG + Intergenic
1144788425 17:17844421-17844443 CAGGTGGCATGGTGGGGTGGTGG + Intronic
1144854978 17:18262654-18262676 CAGGTGGCCAGGCTGGGAGAGGG - Intronic
1144956108 17:19019701-19019723 CAGAAGGCCCCCTGGGGAGGAGG - Exonic
1145164835 17:20605342-20605364 AAGGCGGCCTGGTGGGGAGGAGG + Intergenic
1146022517 17:29292601-29292623 CAGGAGGCCTGGGGGGGCGGCGG - Intronic
1146127592 17:30241075-30241097 TAGGTGGGTCGGAGGGGAGGAGG + Intergenic
1146263824 17:31438187-31438209 TAGGGGCCCCCGTGGGGAGGGGG + Intronic
1146763256 17:35496506-35496528 CCGGAGGGACGGTGGGGAGGGGG - Intronic
1147324399 17:39663409-39663431 CAGGAGGCCCTGGGAGGAGGGGG - Exonic
1147846442 17:43407242-43407264 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846446 17:43407250-43407272 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846450 17:43407258-43407280 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1148447083 17:47744364-47744386 CCTGAGCCCCGGTGGGGAGGAGG + Intronic
1148578022 17:48724991-48725013 CAGATGGGCCTGTGGGGAGGGGG - Exonic
1148908194 17:50924984-50925006 CAGGTGGCCAGGTGGCCAGCTGG - Intergenic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149677227 17:58476948-58476970 CATGTGGCACGGTTGGGAGACGG + Intronic
1150641203 17:66950971-66950993 CAGGTGGCCTGGCCAGGAGGCGG + Intergenic
1151403908 17:73874555-73874577 CAGGAGCCCAGGTGGGGATGTGG - Intergenic
1151535467 17:74736841-74736863 CAGGTGGCGAGGCGGGGAGCTGG - Intronic
1151850340 17:76686115-76686137 GATGTGGACCGATGGGGAGGCGG + Intronic
1151969770 17:77451583-77451605 CAGGTGGCGCGGCCGCGAGGCGG + Intronic
1152643845 17:81459964-81459986 CAAGTGGCCAGGTGGGCGGGAGG + Intronic
1152794563 17:82300821-82300843 GAGGTGCCCTGGCGGGGAGGGGG + Intergenic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1152965734 18:112090-112112 CAGGCGGCGGGGTGGGGCGGTGG + Intergenic
1153733113 18:8035390-8035412 TTGGTGTCCTGGTGGGGAGGAGG - Intronic
1153972490 18:10239158-10239180 CAGGAAGGGCGGTGGGGAGGAGG + Intergenic
1154201746 18:12305289-12305311 CCAGTGGCCCTGTAGGGAGGGGG - Intergenic
1155198095 18:23493826-23493848 GAGGAGGCCTGGTGTGGAGGAGG - Intergenic
1156845923 18:41665191-41665213 CAGGTGGCCGTGTGGTGAGCTGG - Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1157455940 18:47828292-47828314 CAGCTGCCCCGTTCGGGAGGTGG + Exonic
1157622943 18:49026630-49026652 AGGGTAGCCAGGTGGGGAGGTGG + Intergenic
1157794096 18:50559614-50559636 CCGGGGGCCCGGTGGGAGGGTGG - Intergenic
1159902426 18:74060163-74060185 AAGGTGGCCCGGAGCTGAGGAGG - Intergenic
1160150209 18:76392583-76392605 CAGGTGGCCGGGTGGGGGAAGGG + Intronic
1160150281 18:76392793-76392815 CAGGTGGCCAGGTGGGGGAAAGG + Intronic
1160150299 18:76392844-76392866 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150308 18:76392867-76392889 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150317 18:76392890-76392912 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150327 18:76392913-76392935 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150336 18:76392936-76392958 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150345 18:76392959-76392981 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150355 18:76392982-76393004 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150364 18:76393005-76393027 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150373 18:76393028-76393050 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150382 18:76393051-76393073 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150392 18:76393074-76393096 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150402 18:76393097-76393119 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150411 18:76393120-76393142 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150420 18:76393143-76393165 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150449 18:76393212-76393234 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150466 18:76393263-76393285 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150475 18:76393286-76393308 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150485 18:76393309-76393331 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150494 18:76393332-76393354 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150504 18:76393355-76393377 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150513 18:76393378-76393400 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150522 18:76393401-76393423 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150528 18:76393424-76393446 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150560 18:76393498-76393520 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150608 18:76393613-76393635 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150636 18:76393682-76393704 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150645 18:76393705-76393727 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150673 18:76393774-76393796 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150682 18:76393797-76393819 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150719 18:76393894-76393916 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150728 18:76393917-76393939 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150738 18:76393940-76393962 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150747 18:76393963-76393985 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150764 18:76394001-76394023 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150773 18:76394024-76394046 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150782 18:76394047-76394069 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150788 18:76394070-76394092 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150820 18:76394144-76394166 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150857 18:76394241-76394263 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150866 18:76394264-76394286 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150876 18:76394287-76394309 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150885 18:76394310-76394332 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150895 18:76394333-76394355 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150904 18:76394356-76394378 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150914 18:76394379-76394401 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150923 18:76394402-76394424 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150932 18:76394425-76394447 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150938 18:76394448-76394470 CAGGTGGTCAGGTGGGAAGCCGG + Intronic
1160150970 18:76394522-76394544 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150998 18:76394591-76394613 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151026 18:76394660-76394682 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151035 18:76394683-76394705 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151064 18:76394752-76394774 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160461494 18:79042099-79042121 CAGGAGGCCCCGTGGGCTGGTGG + Intergenic
1160586380 18:79915641-79915663 CCTGTGGCCCGATGGGGAGATGG + Intronic
1160698821 19:496835-496857 GAGGGGGCGCGGAGGGGAGGGGG + Intronic
1160751405 19:736141-736163 CGGGGGGCCGGGTGGGGCGGGGG + Intronic
1160754624 19:751020-751042 CAGGTGGGGCTGGGGGGAGGGGG + Intergenic
1160923798 19:1533418-1533440 CATGGGGGCCAGTGGGGAGGTGG + Intronic
1160976679 19:1796258-1796280 CAGCTGGTCTGGTAGGGAGGGGG + Exonic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161438807 19:4279323-4279345 GAGGTGGGACGCTGGGGAGGGGG - Exonic
1161442983 19:4302988-4303010 CAGGTGGCTCCGTGGGGGAGGGG + Intergenic
1161509429 19:4662416-4662438 CAGGCCCCCCGGTGGGGAGGGGG - Intronic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1161579564 19:5073369-5073391 CAGCAGCCCCGGTGGGGAGCAGG + Intronic
1161630938 19:5355089-5355111 CAGGCGGCCCGGTCTGGGGGTGG - Intergenic
1161872158 19:6878465-6878487 CAGGTGGGCAGATAGGGAGGAGG - Intergenic
1162029800 19:7912482-7912504 TGGGTGGCCAAGTGGGGAGGGGG - Exonic
1162480142 19:10922941-10922963 CAGGTGGCCCGGGGGGGATATGG + Exonic
1162794019 19:13077494-13077516 TAGCTGGCACAGTGGGGAGGGGG - Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1162918032 19:13884721-13884743 CAGGTGGCCAGGCGGGTAAGTGG + Intronic
1163597016 19:18226215-18226237 CGGGACGCCCGGTGTGGAGGTGG - Intronic
1163722374 19:18904468-18904490 CAGGAAGCCCTGAGGGGAGGAGG + Intronic
1164799262 19:31062477-31062499 GAGGTGGGATGGTGGGGAGGGGG + Intergenic
1165343305 19:35227539-35227561 CAGGTGGACTGGGGGAGAGGAGG + Intronic
1165361743 19:35341170-35341192 GAGGTGGCCCGGCTGGGATGAGG + Intronic
1165784038 19:38450590-38450612 CAGATGAGCTGGTGGGGAGGTGG + Intronic
1166343273 19:42151050-42151072 CAGGGGGCCAGGTAGGGGGGAGG - Intronic
1166361405 19:42254268-42254290 CCGGTGGCCCGGGGTTGAGGAGG - Intronic
1166781516 19:45345804-45345826 GAGGGGGCCAGGTGGGGAGCTGG + Intronic
1167272015 19:48511299-48511321 CTGGGGGCTGGGTGGGGAGGGGG - Intronic
1167303966 19:48696356-48696378 CTGGTGGCCCGGGGTGGAGAAGG - Intronic
1167606243 19:50482369-50482391 CAGGTGGCCTCGTGGGACGGGGG - Exonic
1167792108 19:51689304-51689326 CGGGGGGCCCCCTGGGGAGGGGG + Intergenic
1168326372 19:55540778-55540800 CAGGTGGCCCTGGGGGCTGGGGG + Exonic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925188455 2:1865050-1865072 CAGGTGCTCTTGTGGGGAGGCGG + Intronic
925447754 2:3942653-3942675 CAGGTGGGCAGGTGGGCAAGTGG + Intergenic
925548709 2:5045274-5045296 AAGGTGGGAGGGTGGGGAGGGGG - Intergenic
926718113 2:15940673-15940695 CGGGTGGGCCGGGGGGGCGGGGG - Exonic
927156647 2:20224769-20224791 CCGGCGGCCAGGCGGGGAGGCGG - Intronic
928359893 2:30654644-30654666 AAGGAGGCAGGGTGGGGAGGGGG - Intergenic
929576954 2:43057925-43057947 CAGGTGGCCAGGTGGTGCTGCGG + Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
930052290 2:47225816-47225838 CAGGTGGACAGGTGTGGAAGTGG - Intergenic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
933660815 2:84925888-84925910 CTGGTGGCCAGCTGTGGAGGTGG + Intergenic
933770591 2:85741690-85741712 GAGGTGGCAGGGTGAGGAGGAGG - Intergenic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
935704847 2:105847485-105847507 CCTGTGTCCCGGTGGGCAGGTGG + Intronic
936493464 2:112996173-112996195 GAGGTGGCTCGGGTGGGAGGGGG + Intergenic
937255973 2:120555790-120555812 CAGGTGGCCCAGGGGCAAGGAGG + Intergenic
937895998 2:126977140-126977162 CAGGTGACCCGGGGGAGCGGTGG - Intergenic
937988981 2:127651835-127651857 CAGGTTGCTTGCTGGGGAGGTGG - Exonic
938074357 2:128323755-128323777 CCTGTGGCACTGTGGGGAGGGGG + Intergenic
938210806 2:129464609-129464631 CATGTGGACTGGTGGGGTGGGGG - Intergenic
938451461 2:131425046-131425068 CAGGTGGGCCGGGGGCGCGGTGG + Intergenic
939200876 2:139031954-139031976 CAGGTTGCATGGTGGGTAGGTGG + Intergenic
940517576 2:154699492-154699514 CAGGTCTCCCGGTGGGGAAGGGG - Intronic
940790099 2:158023101-158023123 CAGGAGGCCTGATTGGGAGGTGG + Intronic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
942428771 2:175887108-175887130 TAGGTGGGAGGGTGGGGAGGGGG + Intergenic
944495888 2:200306935-200306957 CAGCCGGCCCGGCGTGGAGGGGG - Intronic
944964546 2:204915030-204915052 CTGGTGGATCGGCGGGGAGGAGG + Intronic
945807000 2:214501930-214501952 CAGGTGAGTCGGTGGGGAGGTGG - Intronic
946166839 2:217869587-217869609 CAGGCGGCCACATGGGGAGGAGG + Intronic
946193909 2:218022105-218022127 CAGGTGGCCTGGTGAGAAAGAGG + Intergenic
947669317 2:231926449-231926471 CGGGCGGCCCGGTGGGCGGGAGG - Intergenic
947742176 2:232489665-232489687 CAGGTCGCCCGGCAGGGAGTCGG - Intergenic
947911680 2:233804754-233804776 CAGGTGGCCAGGAGGGCAGCAGG + Intronic
948066931 2:235087890-235087912 CGGGAGGACCCGTGGGGAGGAGG - Intergenic
948190040 2:236051489-236051511 CAGGGGACCAGGTGGGAAGGCGG + Intronic
948574991 2:238944138-238944160 CTGGTGACCAGGAGGGGAGGTGG - Intergenic
948699374 2:239750682-239750704 GAGGTGTCCAGGTGGGGAGGTGG - Intergenic
948806027 2:240453687-240453709 CCGGCGGCCCGGCGAGGAGGGGG - Intronic
948915718 2:241034297-241034319 CAGGTGGCCAGGAGGTGAGTGGG - Intronic
949043546 2:241860089-241860111 TGGGTGGCTTGGTGGGGAGGTGG + Intergenic
949046424 2:241874519-241874541 CAGGGCCCCTGGTGGGGAGGGGG + Intergenic
1169205504 20:3738032-3738054 GAGGTGGCAGGGTGGGGTGGGGG - Intronic
1169756275 20:9046395-9046417 AAGGTGGCAGGGCGGGGAGGGGG + Intergenic
1170561652 20:17563629-17563651 CTGGTGGGGTGGTGGGGAGGAGG - Intronic
1171112322 20:22495439-22495461 CAGGTGGCCTGGTGAGTTGGAGG - Intergenic
1171201425 20:23245124-23245146 GAGGTGGCCAGGTGGGGACCCGG - Intergenic
1171495494 20:25552132-25552154 CAGTTGGCGGGGTGGGGATGGGG + Intronic
1171958412 20:31476510-31476532 CTGGTGGCCCCGTGGGGACAGGG - Exonic
1172032210 20:31990076-31990098 GAGGTTGCCTGGTGGTGAGGAGG + Intronic
1172162802 20:32880057-32880079 CAGGTGGCCAGGCAGGGAGCTGG + Intronic
1172665487 20:36596485-36596507 AAGGTGGCCGGGTGGCGTGGTGG + Intronic
1172845417 20:37927468-37927490 CTGGTGTCCCGGTGGAGAAGTGG + Intronic
1172995137 20:39064826-39064848 GGGGAGGCCAGGTGGGGAGGTGG - Intergenic
1173521810 20:43705431-43705453 CTGGTGGAACAGTGGGGAGGGGG + Intronic
1173656897 20:44705658-44705680 CAGGTGGGTCGATGGGCAGGTGG + Intergenic
1173831229 20:46089870-46089892 CAGGTGGGCCGACGCGGAGGCGG - Exonic
1173840666 20:46154698-46154720 CAGTTGGGCCTGTGGGGAGGAGG + Intergenic
1174042849 20:47712359-47712381 GAGGTGCCACGGTGAGGAGGAGG - Intronic
1174198420 20:48789862-48789884 CAGGTGGGTGGGTGGGGAGATGG + Intronic
1174275512 20:49400994-49401016 CAGGTGGATAGGTGGGTAGGTGG - Intronic
1175139777 20:56852420-56852442 CAGGTGGCAAGGTGAGGTGGGGG - Intergenic
1175179128 20:57132620-57132642 CGGGTGGCAGGTTGGGGAGGTGG + Intergenic
1175727791 20:61331590-61331612 CAGGTGGCCGGGGCAGGAGGTGG - Intronic
1175727811 20:61331639-61331661 CAGGTGGCTGGGGCGGGAGGTGG - Intronic
1175914946 20:62421986-62422008 CAGGAGGCCAGGCAGGGAGGAGG - Intronic
1175960095 20:62631526-62631548 CAGCCGGCTCGGTGGGGTGGGGG + Intergenic
1176138600 20:63535789-63535811 CGGGAGGCCAGGTGAGGAGGGGG - Intronic
1176138610 20:63535812-63535834 CGGGAGGCCAGGTGAGGAGGGGG - Intronic
1176138633 20:63535859-63535881 CGGGAGGCCAGGTGAGGAGGGGG - Intronic
1176138643 20:63535882-63535904 CGGGAGGCCAGGTGAGGAGGGGG - Intronic
1176138696 20:63535997-63536019 CGGGAGGCCAGGTGAGGAGGGGG - Intronic
1176138780 20:63536177-63536199 GAGGAGGCCAGGTGAGGAGGGGG - Intronic
1177948266 21:27500569-27500591 GTGGTGGCAGGGTGGGGAGGGGG + Intergenic
1179028995 21:37703666-37703688 GTGGTGGCCCAGTGGAGAGGGGG - Intronic
1179504074 21:41828584-41828606 AGGGTGGCCCGGGAGGGAGGCGG - Intronic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714686 21:43280766-43280788 GAGGTGGCGGGGAGGGGAGGTGG + Intergenic
1179717705 21:43298236-43298258 CCGGTGGTCAGGTGTGGAGGAGG + Intergenic
1179816560 21:43909876-43909898 ACGCTAGCCCGGTGGGGAGGGGG + Intronic
1179910296 21:44443943-44443965 CAGGGGGCACGGTGGTGATGGGG - Intergenic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180246107 21:46548354-46548376 CAGGTGGCCCTGCGAGGGGGTGG - Intronic
1180834392 22:18922655-18922677 GGGTTGGCCTGGTGGGGAGGAGG - Intronic
1181065418 22:20303448-20303470 GGGTTGGCCTGGTGGGGAGGAGG + Intergenic
1181278555 22:21702705-21702727 CAGGTGGCCTGGGGGAGGGGAGG + Intronic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182380437 22:29883291-29883313 CAGGGAGCCTGGTGGGGTGGCGG + Exonic
1182558399 22:31141188-31141210 CAGGTGGCCAGGGATGGAGGTGG - Intergenic
1182577487 22:31282915-31282937 CAGGTGGCCCTGTGGGCTGAGGG - Exonic
1182696742 22:32203575-32203597 CCAGTGGCTGGGTGGGGAGGCGG - Intergenic
1183310735 22:37108265-37108287 GAGCTGGCCAGGTTGGGAGGTGG - Intronic
1183379355 22:37483236-37483258 TAGGTGGCCGGGTGGGCCGGAGG - Intronic
1183423692 22:37726233-37726255 TGGGTGGCGGGGTGGGGAGGAGG - Exonic
1183483807 22:38078697-38078719 CAGGCGGCCTGGGGAGGAGGAGG + Exonic
1183933636 22:41249690-41249712 CAGCAGGCCCGGGAGGGAGGTGG - Intronic
1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG + Intergenic
1184100329 22:42338548-42338570 GAGGAGGCCCGGGAGGGAGGCGG + Intronic
1185180508 22:49358171-49358193 CAGGTGGCCCGGGGGAGTTGGGG - Intergenic
1185223852 22:49642214-49642236 CAGGTGGCCCTGTGTGTGGGGGG + Intronic
1203284481 22_KI270734v1_random:147954-147976 GGGTTGGCCTGGTGGGGAGGAGG - Intergenic
949513172 3:4784098-4784120 CTTGTGGTCCGGTGGGGAAGAGG + Intronic
949608265 3:5677569-5677591 CAGGAGGTGCGCTGGGGAGGTGG - Intergenic
950163081 3:10774500-10774522 CACGTGACCCTGTGGGTAGGTGG + Intergenic
950520501 3:13495140-13495162 CAGGAGGCCAGGTGGAGAGAGGG - Intronic
950941892 3:16901314-16901336 CATGTGACCCAGTGGGGAGCTGG + Intronic
952080222 3:29748855-29748877 CAGGTGGGCGTGTGGGGAAGGGG + Intronic
952449393 3:33417290-33417312 CAGTTGGCCAGGTGGGGGGTGGG - Intronic
952708599 3:36406149-36406171 CAGGCTGCTGGGTGGGGAGGGGG - Intronic
952753335 3:36843575-36843597 CAGGTGGCAGGGTGGGGGTGGGG - Intronic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953228657 3:41044077-41044099 CAGGTGGAGCTGTGGGGATGGGG - Intergenic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954397293 3:50299509-50299531 TATGGGGCCGGGTGGGGAGGAGG - Intergenic
955776312 3:62437521-62437543 CAGCTGGCTGGGTGGGCAGGGGG + Intronic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961135907 3:124511082-124511104 TAGGTGGCTCTGTGGGGATGAGG - Intronic
961443389 3:126966087-126966109 CAGGTGGCTAGGAGGGGAGTGGG + Intergenic
961479451 3:127170757-127170779 CAGGTGGGCTTGGGGGGAGGTGG + Intergenic
961661315 3:128470116-128470138 CATGTGGCTGGGTGGGGGGGTGG - Intergenic
961670434 3:128524485-128524507 CAGGGAACCCGGTGAGGAGGAGG + Intergenic
962243878 3:133775369-133775391 AAGGTGCCCCGCTGGGGAGATGG - Intronic
962816717 3:139006649-139006671 GAGGTGGGGAGGTGGGGAGGTGG + Intronic
963252634 3:143117177-143117199 CTGGTGGGCAGGTGTGGAGGGGG + Intergenic
967207583 3:187138229-187138251 GAGGTGGCGGGGAGGGGAGGCGG + Intronic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
968084772 3:195869391-195869413 CGGCTGGGCCGGAGGGGAGGTGG - Intronic
968482065 4:837675-837697 CAGAAGGTCAGGTGGGGAGGAGG - Intergenic
968593955 4:1473009-1473031 GAGGTGGGCAGGTGGGGAGTGGG - Intergenic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968647820 4:1749051-1749073 GAGGGGGCGTGGTGGGGAGGGGG - Intergenic
968647828 4:1749067-1749089 GAGGGGGCACGGTGGGGAGGGGG - Intergenic
968647906 4:1749236-1749258 GAGGGGGCGCAGTGGGGAGGGGG - Intergenic
968647951 4:1749332-1749354 GAGGGGGCACAGTGGGGAGGGGG - Intergenic
968647958 4:1749348-1749370 GAGGGGGCATGGTGGGGAGGGGG - Intergenic
968691317 4:1991869-1991891 AAGGTGGCCCTGGGGTGAGGCGG - Intronic
968876374 4:3269845-3269867 CAGGCGGCCGGGCGGGGAGCAGG - Intronic
968884805 4:3322198-3322220 CACGTGGCTCGGTGTGCAGGGGG - Intronic
968948091 4:3676040-3676062 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948095 4:3676048-3676070 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948099 4:3676056-3676078 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
969384741 4:6837141-6837163 CAGCCGGCCCGTTCGGGAGGTGG - Intronic
971073161 4:23117950-23117972 CAGGTGGACTGGTGTGGAGCAGG - Intergenic
973737348 4:53885679-53885701 CAGGAGGCCAGGTTGGTAGGAGG + Intronic
974314505 4:60260937-60260959 CCTGTGGGCCGGTGAGGAGGAGG - Intergenic
977570706 4:98626575-98626597 CAGGTGGGCCAGGGGTGAGGAGG - Intronic
977895845 4:102364023-102364045 CAGGTTGCCGGGTGGTGGGGAGG + Intronic
978130918 4:105196305-105196327 CAAGTGGTGAGGTGGGGAGGGGG - Intronic
978940875 4:114434789-114434811 ATGGTGGCACAGTGGGGAGGAGG + Intergenic
979524066 4:121698613-121698635 CAGCTGGGCTGGTGGAGAGGAGG - Intergenic
980129160 4:128802846-128802868 GAGCTGGCTTGGTGGGGAGGCGG - Intergenic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
985130600 4:186734872-186734894 AAGGTGGCCGTGTTGGGAGGTGG - Intergenic
985536080 5:466368-466390 GAGGTGGCCCCTTGGGGAAGTGG - Intronic
985688195 5:1293301-1293323 CAGGAGCCCAGGTGAGGAGGTGG - Exonic
985837432 5:2281226-2281248 CAGGTGGATGGGTGGGTAGGTGG + Intergenic
985895717 5:2749160-2749182 CACGTGGCCGGGTGGGGGCGAGG - Intronic
985901848 5:2802494-2802516 CTGTCAGCCCGGTGGGGAGGAGG - Intergenic
986314695 5:6578766-6578788 CAGATGCCACGGTGGGGAGGTGG + Intergenic
986710628 5:10485855-10485877 CAGGTCGCGGGGTGGGGGGGGGG + Intergenic
988452370 5:31356266-31356288 CTGGTGGCCCATTGTGGAGGGGG - Intergenic
991189530 5:63853270-63853292 CAAGTGGGCGGGTGGGGAGGAGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
994710295 5:103258253-103258275 AAGGTGGCGGGGTGGGGCGGGGG - Intergenic
997209266 5:132067997-132068019 CACTTGTCCTGGTGGGGAGGAGG - Intergenic
997425640 5:133800935-133800957 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
998446946 5:142205872-142205894 CTAGTGGCCAGGAGGGGAGGTGG - Intergenic
1000397194 5:160788268-160788290 CTGTTGGCCAAGTGGGGAGGAGG - Intronic
1001381305 5:171308454-171308476 GGGGTCGCCCGGTGGGGAGCGGG - Exonic
1001853334 5:174988889-174988911 CAGGAGGTTCGGCGGGGAGGAGG + Intergenic
1002342220 5:178524609-178524631 CAGGTGGTCCATGGGGGAGGAGG - Intronic
1002461751 5:179377313-179377335 CACGTGACCTGGTGGGGAGAGGG + Intergenic
1002495105 5:179606413-179606435 CAGGTGGCCCGGTGTGGGTGCGG + Intronic
1002591591 5:180294441-180294463 GAGGTGACAGGGTGGGGAGGGGG + Intergenic
1002653659 5:180724104-180724126 GAGGTGGCCAGGTGTGGAGAAGG + Intergenic
1002854673 6:1026409-1026431 CAGGTGTCCCGCTGAGGAAGTGG - Intergenic
1003837239 6:10084857-10084879 CAGGTGGCCCAGTGAGCAGGAGG - Intronic
1003873754 6:10420008-10420030 CTCGTGGGCGGGTGGGGAGGCGG - Intergenic
1004562059 6:16760820-16760842 CGGGTGGCGCAGGGGGGAGGCGG - Intronic
1005682338 6:28218965-28218987 AAGGTGGCCCGTGGGGGGGGCGG + Intergenic
1006346261 6:33485676-33485698 CAGCTGGCCGGGTGGGGGGCCGG + Intergenic
1006513548 6:34534082-34534104 CAGGAGGCCAGGTGTGCAGGAGG - Exonic
1006517817 6:34554579-34554601 CAGGTGGGGCTGTGTGGAGGAGG - Intronic
1007075326 6:39062533-39062555 CAGTTGGGAGGGTGGGGAGGTGG - Intronic
1007091218 6:39185943-39185965 GAGGTGGGGCGGGGGGGAGGGGG + Intergenic
1007390482 6:41547252-41547274 CCAGAGGCCCGGCGGGGAGGGGG - Intronic
1007400024 6:41598146-41598168 AAGGTGGGAAGGTGGGGAGGTGG - Intronic
1007608198 6:43131319-43131341 AACGTGGCCCTGTGGGAAGGTGG + Intronic
1007615893 6:43179662-43179684 CAGGGGGCCAGCTGGGGAGATGG + Exonic
1007634095 6:43287620-43287642 AAAGTGGGCCAGTGGGGAGGGGG + Exonic
1007702205 6:43771867-43771889 CAGGTGGCCCAGCAGGGAGGGGG - Intronic
1011654194 6:89534924-89534946 CAGGTGGGAGGGTGGGGATGAGG - Intronic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1014308630 6:119771373-119771395 ATGGTGGCCCGGGGGTGAGGGGG - Intergenic
1015626364 6:135183158-135183180 CAGGTAGCCCAGAGGGGAGGCGG + Intronic
1015935613 6:138404119-138404141 CAGGTGGCCCCGCGGGCAGTAGG - Intronic
1016212928 6:141562323-141562345 CAGGCAGCCTGGTGAGGAGGTGG - Intergenic
1017842259 6:158231961-158231983 CAGGTGGCCCGGGCAGGCGGCGG + Intergenic
1018452201 6:163919500-163919522 CACGTGGCAGGGAGGGGAGGAGG + Intergenic
1019038033 6:169078500-169078522 CAAGTGGCCCCGTGGGATGGTGG - Intergenic
1019117151 6:169774424-169774446 GAGGTGGGCAGGTAGGGAGGAGG + Intronic
1019340306 7:505803-505825 CAGGTGGGGCTGTGGGGCGGTGG - Intronic
1019660429 7:2220920-2220942 CGGGTGACCCTGTGGGCAGGTGG - Intronic
1019718795 7:2555531-2555553 CAGGTGGCACTGTCCGGAGGCGG - Exonic
1019740567 7:2670966-2670988 CAGGAGGCCAGGTGGGCAGCAGG + Intergenic
1020131694 7:5562527-5562549 CAGGTGCCCCGGCGGGAAGGAGG + Intronic
1020695294 7:11406455-11406477 CAGGAGGCCCAGTGTGGAGAAGG - Exonic
1022282763 7:28927556-28927578 CCGGGGGCCGGGAGGGGAGGAGG + Intergenic
1023355027 7:39357794-39357816 CAGGTGGCACGGAGGGGAAGGGG + Intronic
1023658612 7:42451014-42451036 CAAGTTGCCAGGTGGTGAGGAGG + Intergenic
1023855455 7:44180605-44180627 CTTGTGGCCAGGAGGGGAGGTGG + Intronic
1024246614 7:47475582-47475604 CAGGAGGCCGGGCGGGGAAGTGG + Intronic
1024305159 7:47922732-47922754 CAGCCGCCCCGTTGGGGAGGTGG + Intronic
1026466814 7:70661431-70661453 CAGGTGACCAGGGTGGGAGGAGG + Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1027266865 7:76499363-76499385 GAGGTGGCGTGGTGGGGTGGAGG - Intronic
1027318681 7:76999223-76999245 GAGGTGGCGTGGTGGGGCGGAGG - Intergenic
1028207503 7:88033819-88033841 CACGTGGGCCTGTGGGGTGGTGG - Intronic
1029158657 7:98535344-98535366 CAGGTTGCCCAGTTAGGAGGTGG + Intergenic
1029364553 7:100108343-100108365 TCCGTGGCCGGGTGGGGAGGAGG - Intronic
1029654012 7:101912577-101912599 CAGAGGGGCCGGTGGGGAGAGGG - Intronic
1030077850 7:105751803-105751825 CAGGTGTCCCCCTGGGGATGTGG + Intronic
1030143733 7:106331764-106331786 CAGGTTGCCCTGGGGGGAAGGGG + Intergenic
1030656510 7:112174014-112174036 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1030656514 7:112174022-112174044 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1030673431 7:112362117-112362139 GTGGTGGCCAGGTGGGCAGGGGG - Intergenic
1032442072 7:131949725-131949747 CAGGTGTCTCTGTGGGGATGGGG - Intergenic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1034627339 7:152503628-152503650 CAGGTGGCCAGGTGGGAGTGGGG + Intergenic
1034911525 7:155002548-155002570 GAGGCGGCCCGGTGGGTCGGGGG + Intronic
1035112902 7:156498056-156498078 CAGATTGCCCGGTGGGAAGGGGG + Intergenic
1035251390 7:157599841-157599863 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251395 7:157599857-157599879 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251400 7:157599873-157599895 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251415 7:157599919-157599941 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251433 7:157599983-157600005 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251438 7:157599999-157600021 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251443 7:157600015-157600037 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251448 7:157600031-157600053 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251471 7:157600109-157600131 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251489 7:157600173-157600195 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251494 7:157600189-157600211 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251499 7:157600205-157600227 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035299992 7:157890989-157891011 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1035637286 8:1156336-1156358 CTGGTGGCCCGGAGGAGAGTTGG + Intergenic
1036473372 8:9070911-9070933 CAGGTGGCAGGGTTGGGAGCTGG + Intronic
1036781606 8:11651651-11651673 CACGTGGCGGGGTGTGGAGGCGG - Intergenic
1036960223 8:13237607-13237629 CAGGTGGGGAGGTAGGGAGGGGG - Intronic
1037411375 8:18601882-18601904 CAGGTGGCACAGTGTGCAGGAGG + Intronic
1037753902 8:21699401-21699423 CAGGTGGGCAGGTGGAGATGGGG + Intronic
1037804005 8:22049372-22049394 CGGATGGCCCGGGGGGTAGGGGG + Intronic
1037820085 8:22131179-22131201 CGGGTGCCGCGGGGGGGAGGGGG - Exonic
1037967282 8:23144800-23144822 CAGCTGGCCCCATGGGGATGGGG - Intronic
1037991701 8:23325989-23326011 CAGGTGGCTGGGCAGGGAGGAGG + Intronic
1038296191 8:26292159-26292181 CGGGGGGCAAGGTGGGGAGGTGG - Intronic
1038820007 8:30943493-30943515 CTAGTGGCCAGGAGGGGAGGGGG + Intergenic
1041375023 8:57204140-57204162 GAGATTGCCCGGTGGGGTGGTGG + Intergenic
1041375533 8:57207052-57207074 CAGGTCGCACGGTGGGCAGAAGG + Intergenic
1041376296 8:57211431-57211453 CAGGTCGCACGGTGGGCAGAAGG + Intergenic
1041658005 8:60373798-60373820 CAGGTGGCCTAGTGGGAGGGTGG - Intergenic
1043566781 8:81558004-81558026 CAGGAGGCCAGCTGGGGAAGAGG + Intergenic
1045377028 8:101584780-101584802 CAGGTAGCCAGGTGGCTAGGTGG + Intronic
1045377031 8:101584788-101584810 CAGGTGGCTAGGTGGTCAGGTGG + Intronic
1045377035 8:101584804-101584826 CAGGTGGCTAGGTGGTCAGGTGG + Intronic
1045377048 8:101584860-101584882 CAGGTGGTCAGGTGGCTAGGTGG + Intronic
1045377076 8:101585004-101585026 CAGGTAGCCAGGTGGTCAGGTGG + Intronic
1047188302 8:122655440-122655462 CTGGTGGCCAGGAGAGGAGGTGG - Intergenic
1047189753 8:122667350-122667372 CAGGTGGCCAGGTGGGAAGAGGG - Intergenic
1047202950 8:122781826-122781848 CCGGGCGCCCGGTGGGGAGTGGG + Exonic
1047237827 8:123057843-123057865 CACGTGGCCAGGAGAGGAGGTGG - Intronic
1049313876 8:141948500-141948522 CAGAGGGCCCGGTTTGGAGGAGG - Intergenic
1049440156 8:142606002-142606024 CAGGTGGTGGGGTTGGGAGGGGG - Intergenic
1049508763 8:143017678-143017700 CAGGTGGCCATGTGGTCAGGAGG - Intergenic
1049822299 8:144643121-144643143 CAGGAAGGCTGGTGGGGAGGGGG - Intergenic
1051094306 9:13448158-13448180 AAGGTCTCCCGGTGGGAAGGAGG - Intergenic
1051553775 9:18359813-18359835 CGGGGGGGCGGGTGGGGAGGTGG - Intergenic
1052651697 9:31311674-31311696 TGGGAGGCCCGGTGGGCAGGGGG - Intergenic
1052824289 9:33163935-33163957 CAGGGTGCCCGGTGTGGGGGCGG + Intronic
1052856171 9:33407999-33408021 CAGGTGAGCCAGTGGGAAGGTGG + Intergenic
1053458439 9:38250018-38250040 CTGGTGTCGGGGTGGGGAGGGGG + Intergenic
1055513390 9:77016145-77016167 CTGGGGCCGCGGTGGGGAGGGGG - Intergenic
1055611731 9:78031414-78031436 CAGGTGGGCCGGGGGCGCGGTGG + Exonic
1055945490 9:81688557-81688579 CAGCTGCCCGGGCGGGGAGGCGG + Exonic
1057123036 9:92594333-92594355 TAGGTGGCCCCGTGAGCAGGTGG + Intronic
1057757201 9:97848060-97848082 GCGGTGGCACGGTGAGGAGGGGG - Intergenic
1057881487 9:98796121-98796143 CAGGCGGCCAGGTGAGGCGGCGG - Exonic
1059245330 9:112844841-112844863 CTTGTGGCCCTGTGGGGAAGGGG - Intronic
1060187813 9:121574722-121574744 CAGGAGACCCAGTGGGGTGGTGG - Intronic
1060207048 9:121688280-121688302 CAGGAGGCCCTCTGTGGAGGTGG + Intronic
1060402321 9:123356097-123356119 CAGGAGGCCTGGGTGGGAGGAGG + Intergenic
1060481192 9:124017725-124017747 CTGGGGGCCGAGTGGGGAGGGGG + Intronic
1060951728 9:127608325-127608347 CAGGAGGTCCGGTGGAGGGGTGG + Intergenic
1060971903 9:127743050-127743072 TAGGTAGCCTGGTTGGGAGGCGG + Intronic
1060981366 9:127794314-127794336 CAGGTGGGTGGGAGGGGAGGGGG - Intergenic
1061054541 9:128215463-128215485 CTGGTGCCCAGATGGGGAGGTGG - Intronic
1061430334 9:130526806-130526828 CAGGTGGCCCGGTTTGCAGGTGG - Intergenic
1061483512 9:130908843-130908865 CATGGGCCCCGGTGAGGAGGGGG + Intronic
1061721062 9:132551741-132551763 CATGTGGCCAGGTGGGGACTTGG + Intronic
1061861964 9:133472789-133472811 GATGAGGCACGGTGGGGAGGTGG + Intronic
1061872358 9:133527773-133527795 GAGGTGGGCCGGCGGGGAGCGGG + Intronic
1062128483 9:134879838-134879860 CAGGTGGCAGGGTGCGGTGGTGG + Intergenic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245348 9:135563219-135563241 CAGGTGGGCAGGTGGGTAGGTGG + Intronic
1062245351 9:135563227-135563249 CAGGTGGGTAGGTGGGTAGGTGG + Intronic
1062245366 9:135563283-135563305 CAGGTGGGTAGGTGGGCAGGTGG + Intronic
1062245375 9:135563331-135563353 CAGGTGGGCAGGTGAGCAGGTGG + Intronic
1062245384 9:135563363-135563385 CAGGTGGGCAGGTGGGTAGGTGG + Intronic
1062245393 9:135563395-135563417 CAGGTGGACAGGTGGGTAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245431 9:135563531-135563553 CAGGTGGGCAGGTGGGCAAGTGG + Intronic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380744 9:136285460-136285482 CAGGCGGGCAGGTGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062672489 9:137719823-137719845 CATGTGTCCTGGTGTGGAGGGGG - Intronic
1187428820 X:19203264-19203286 CAGGTAGCATTGTGGGGAGGGGG + Intergenic
1190024800 X:46912973-46912995 CTGGTGGCCCGGGCGGGGGGCGG + Intronic
1190152069 X:47957205-47957227 GAGGTGGCCCGCTTGGGAGGAGG - Intronic
1190160591 X:48028944-48028966 GAGGTGGCCCGCTTGGGAAGAGG + Intronic
1191866296 X:65706455-65706477 GGGGTGGCCCCCTGGGGAGGTGG + Intronic
1192169332 X:68844592-68844614 CAGGAGGCCAGGTAGGCAGGTGG - Intergenic
1192230933 X:69264508-69264530 CATGGGGGCAGGTGGGGAGGGGG + Intergenic
1192892733 X:75407571-75407593 CAGCTGCCCCGTTTGGGAGGTGG + Intronic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193698782 X:84739681-84739703 CAGCTGGGGCTGTGGGGAGGGGG - Intergenic
1196913299 X:120506207-120506229 GCGGGGGCCTGGTGGGGAGGTGG - Intergenic
1198806761 X:140501815-140501837 CTGGTGGGGGGGTGGGGAGGGGG - Intergenic
1199086501 X:143635021-143635043 CAGGCGGGCCGGCGGGCAGGCGG + Intronic
1199388025 X:147246025-147246047 GTGGTGGCCCTGTGGGGAGGTGG - Intergenic
1199772581 X:150983991-150984013 CCGGTGGCCCGGGGGGGCGCGGG + Intronic
1200068063 X:153514414-153514436 GAGGCGGCCAGGTGGGGCGGTGG + Intergenic
1200097680 X:153671833-153671855 CAGGTGGGCAGGTGGGAGGGTGG + Intronic
1200144858 X:153921269-153921291 CTGGAGGCCAGGTGGGGAGCAGG - Intronic
1200219309 X:154383327-154383349 AAGGTGGACCTGTGAGGAGGTGG - Intergenic
1202575279 Y:26317492-26317514 CAGGTGTCCTGAGGGGGAGGGGG + Intergenic