ID: 1157204844

View in Genome Browser
Species Human (GRCh38)
Location 18:45689182-45689204
Sequence ACGTGCCAGGCCTGGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157204844_1157204851 1 Left 1157204844 18:45689182-45689204 CCCCCATTCCAGGCCTGGCACGT No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157204844 Original CRISPR ACGTGCCAGGCCTGGAATGG GGG (reversed) Intergenic