ID: 1157204851

View in Genome Browser
Species Human (GRCh38)
Location 18:45689206-45689228
Sequence GATACATATTTACTGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157204846_1157204851 -1 Left 1157204846 18:45689184-45689206 CCCATTCCAGGCCTGGCACGTGG No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data
1157204848_1157204851 -2 Left 1157204848 18:45689185-45689207 CCATTCCAGGCCTGGCACGTGGA No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data
1157204845_1157204851 0 Left 1157204845 18:45689183-45689205 CCCCATTCCAGGCCTGGCACGTG No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data
1157204844_1157204851 1 Left 1157204844 18:45689182-45689204 CCCCCATTCCAGGCCTGGCACGT No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data
1157204841_1157204851 22 Left 1157204841 18:45689161-45689183 CCAGATTATGTATTTTCATGGCC No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data
1157204849_1157204851 -7 Left 1157204849 18:45689190-45689212 CCAGGCCTGGCACGTGGATACAT No data
Right 1157204851 18:45689206-45689228 GATACATATTTACTGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157204851 Original CRISPR GATACATATTTACTGACAGA TGG Intergenic