ID: 1157209038

View in Genome Browser
Species Human (GRCh38)
Location 18:45725574-45725596
Sequence AGGGCTAGGACTTAGCGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157209038 Original CRISPR AGGGCTAGGACTTAGCGATG CGG (reversed) Intronic
902859927 1:19237930-19237952 AGGGCCAGGTCTTAGCCATGGGG - Intronic
907835775 1:58107132-58107154 AGTGCTAGGACATAGAGATATGG + Intronic
912740229 1:112187818-112187840 AGGGATAGGAGTTAGAGAAGGGG + Intergenic
920032849 1:203047992-203048014 AAGGCTAGGCCTGAGCGAGGAGG + Intronic
922765731 1:228155706-228155728 AGGGCTGGCACTTAGCTCTGGGG - Intronic
1067821213 10:49532373-49532395 AGGGCTGGGACTCAAAGATGAGG + Intronic
1076796903 10:132802864-132802886 AGGGCTGGGGCTCAGCGATGCGG + Intergenic
1080161731 11:29184659-29184681 AGGGCTAGGACAGAGCAATAGGG - Intergenic
1081588934 11:44407541-44407563 GGGGCTAGGACTGGGAGATGGGG - Intergenic
1083662129 11:64256304-64256326 AGGGCAAGGGCTTGGCGACGGGG + Intronic
1083999983 11:66290842-66290864 AGGGCTAGGAGGTAGCACTGGGG + Intergenic
1085900440 11:80693324-80693346 AGGGCTTGCACTTAGAAATGGGG - Intergenic
1087273962 11:96141679-96141701 AGGACCAGGCCTTAGCAATGGGG + Intronic
1094752737 12:33431240-33431262 AGGGTCAGGACTTAGTCATGTGG + Intronic
1098925261 12:76342269-76342291 AGGGCCAGGACTATGCCATGGGG + Intergenic
1100522204 12:95385854-95385876 AGGGGCAGGACTTAGCGTTTTGG + Intergenic
1100935624 12:99661827-99661849 ATGGTTATGACTTAGCCATGTGG - Intronic
1101341566 12:103846703-103846725 AGGGCACGGACTTGGGGATGAGG - Intergenic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1102953881 12:117047098-117047120 AGGGCTGGGAGCTAGCGCTGTGG + Intronic
1106412089 13:29517558-29517580 AGGGCTAGCTCTTACCTATGAGG + Exonic
1106964162 13:35038923-35038945 AGCACTAGGACTTACCTATGAGG + Intronic
1111231383 13:85348154-85348176 TGGGCTAGGACTTAGGGCTCTGG - Intergenic
1113469633 13:110535233-110535255 GTGGCTTGGACTTAGAGATGTGG - Intronic
1114580075 14:23749184-23749206 AGGGCCAGGACCTGGCGAGGGGG + Intergenic
1117101734 14:52355650-52355672 AGGGCTGGGAGTTTCCGATGAGG - Intergenic
1117881003 14:60313488-60313510 TGGGCTAGGACTTAAAGGTGTGG - Intergenic
1121896958 14:97657567-97657589 AGTGCCAGGACTCAGTGATGAGG + Intergenic
1122859385 14:104575718-104575740 AGGGCTCTGACTTGGCGACGGGG + Intronic
1127726454 15:61754749-61754771 AGGCCTAGGACTTAATGAGGTGG - Intergenic
1128800325 15:70492966-70492988 AGGGCTTGGGCTGTGCGATGTGG - Intergenic
1141204483 16:81923198-81923220 GGGGCTAGGGTTTAGCGCTGGGG - Intronic
1144025946 17:11275810-11275832 AGGGCTAGAAGTCAGAGATGAGG + Intronic
1148694183 17:49549246-49549268 AGGGCTGGGGTTTAGAGATGGGG + Intergenic
1157147290 18:45176778-45176800 TGGGTTAGGACTGAGCCATGTGG - Intergenic
1157209038 18:45725574-45725596 AGGGCTAGGACTTAGCGATGCGG - Intronic
1157241583 18:46014958-46014980 AGGGCTAGGACCAAGCTCTGAGG + Intronic
1163109976 19:15153898-15153920 AGGTCTAGGACTGAGCCCTGGGG - Intergenic
1163484849 19:17579653-17579675 AAGGCCAGGACTTAGAGGTGGGG + Intronic
1163560612 19:18017234-18017256 AGGGCTAGGAGCCAGGGATGAGG + Intergenic
1163789180 19:19296381-19296403 AGTGCTGGGACGTAGAGATGGGG - Intronic
1166804322 19:45476227-45476249 ACGGCTAGGATTTTGCAATGGGG - Intronic
927029716 2:19108103-19108125 AGAGCTAGGACTCAGACATGTGG + Intergenic
938026270 2:127951582-127951604 AGGGTTCAGACCTAGCGATGGGG - Intronic
941911914 2:170771586-170771608 AGGGCAAGGACTGAGGGAAGGGG - Intergenic
944463156 2:199973466-199973488 AGGGTTAGGGCATAGTGATGGGG - Intronic
948765620 2:240217264-240217286 AGGGCTAGGGCTTAGCTTTAAGG + Intergenic
1174520198 20:51123439-51123461 GGGGCTAGGACTTGAGGATGGGG + Intergenic
1176182855 20:63759561-63759583 AGGGGTAGGACTCAGGGAGGAGG + Intronic
1176278516 20:64287426-64287448 AGGGTTAGGAGTTAGGGTTGGGG + Intronic
1181163515 22:20971413-20971435 AGGGCTGGGACTTGGGGCTGGGG + Intronic
1182336834 22:29589226-29589248 AAGGCTGGGACTTAGCTCTGTGG - Intergenic
1182717396 22:32368617-32368639 AGGGCTAGAACTTATGGATGTGG + Intronic
1182856766 22:33524346-33524368 AGTGCCAGGAGTTAGAGATGTGG - Intronic
1184373999 22:44100159-44100181 AGGGCGAGGACTTGGCTTTGGGG + Intronic
949387407 3:3518486-3518508 AGGTCTAGGATCTAGCAATGTGG + Intergenic
949545803 3:5071201-5071223 AATGCCAGCACTTAGCGATGGGG - Intergenic
951902954 3:27674920-27674942 AGGGCTGGGAGTTAGGGGTGGGG + Intergenic
953718323 3:45334487-45334509 TGGGCTGGGACTTGGGGATGGGG - Intergenic
954648221 3:52144251-52144273 AGGGCTGGGGCTTGGGGATGGGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
983987593 4:174078983-174079005 AGAGCGAGGACTTTGAGATGTGG - Intergenic
988798926 5:34678387-34678409 GGGGTTAGGACTTAGAAATGGGG - Intronic
992995038 5:82324224-82324246 AGGGTAAGGCATTAGCGATGAGG + Intronic
993041098 5:82815748-82815770 AGGCCGAAGACTTAGCAATGGGG - Intergenic
1002458687 5:179361506-179361528 AGGGCACGGACATAGGGATGGGG + Intergenic
1006900724 6:37499410-37499432 AGGGCTAGGACTCAAAGATGAGG - Intronic
1007461108 6:42019689-42019711 AGGGATAGGACTTAATGATTGGG + Intronic
1011346908 6:86380199-86380221 AGGGCTAGGAATGAGGGAGGTGG + Intergenic
1023155283 7:37245118-37245140 GGGGGTAGGACTTAGCGAGTTGG - Intronic
1029273996 7:99393471-99393493 ATTGCTAGCACTTAGCGAGGTGG + Intronic
1035168827 7:157006728-157006750 AGGGCCAGGCCTTGGCGCTGGGG - Intronic
1041703439 8:60817908-60817930 AGGACCAGGATTTAGGGATGGGG - Intronic
1044802203 8:95968759-95968781 AGGGAGAGGACTTAAAGATGAGG + Intergenic
1053727774 9:41021877-41021899 TCGGCCAGGACTTAGTGATGTGG - Intergenic
1057844903 9:98515708-98515730 AGGGCTTGGAGTGAGGGATGGGG - Intronic
1187834402 X:23416547-23416569 AGGGCTAGGACATAGAAATACGG - Intergenic
1188695846 X:33189663-33189685 AGGGTTAGGAGTAAGAGATGAGG + Intronic
1189746272 X:44171951-44171973 AGGGCAAGGGCTGAGCCATGTGG - Intronic
1190329001 X:49224314-49224336 GGGGCTGGGAGTTAGGGATGAGG + Intronic
1193545678 X:82825269-82825291 ATGGCCAGAACTTAGCCATGTGG - Intergenic