ID: 1157211007

View in Genome Browser
Species Human (GRCh38)
Location 18:45742004-45742026
Sequence CACTCTGTGCAGGAACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157211007_1157211015 22 Left 1157211007 18:45742004-45742026 CCATGCAGTTCCTGCACAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1157211015 18:45742049-45742071 GGCAAGGGAGTGAGCCCAAGAGG 0: 1
1: 0
2: 2
3: 17
4: 288
1157211007_1157211012 6 Left 1157211007 18:45742004-45742026 CCATGCAGTTCCTGCACAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1157211012 18:45742033-45742055 TAGAGGGCAGAAGCCAGGCAAGG 0: 1
1: 0
2: 3
3: 77
4: 660
1157211007_1157211010 -10 Left 1157211007 18:45742004-45742026 CCATGCAGTTCCTGCACAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1157211010 18:45742017-45742039 GCACAGAGTGTTACAATAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1157211007_1157211011 1 Left 1157211007 18:45742004-45742026 CCATGCAGTTCCTGCACAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1157211011 18:45742028-45742050 TACAATAGAGGGCAGAAGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 208
1157211007_1157211013 7 Left 1157211007 18:45742004-45742026 CCATGCAGTTCCTGCACAGAGTG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1157211013 18:45742034-45742056 AGAGGGCAGAAGCCAGGCAAGGG 0: 1
1: 0
2: 4
3: 107
4: 804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157211007 Original CRISPR CACTCTGTGCAGGAACTGCA TGG (reversed) Intronic
900371842 1:2335739-2335761 CACACTGTGGAGGAGCTGCTGGG - Intronic
901183551 1:7357818-7357840 CACTCTGCCCAGACACTGCATGG - Intronic
902093856 1:13926219-13926241 CACTCTGGGTAGTAACAGCACGG - Intergenic
902846467 1:19114520-19114542 CAGTCTGTGGAAGAAATGCAGGG + Intronic
906361373 1:45162731-45162753 CACTCTGAGATCGAACTGCAAGG + Intronic
908220233 1:61998688-61998710 AACTCTATGAAGGAACTGAAGGG - Intronic
910740541 1:90511038-90511060 CACTCTGTGTAAAAACGGCATGG + Intergenic
911826298 1:102489271-102489293 CCCTCAGTCCAGCAACTGCAAGG - Intergenic
912109996 1:106329801-106329823 CAGTCTGAGATGGAACTGCAAGG + Intergenic
912649811 1:111427648-111427670 CACTCAGTCCAGGAAGTGCCAGG - Intronic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
916290059 1:163155785-163155807 CGCTCTGTGCAGGCTCAGCAGGG - Intronic
917737028 1:177930640-177930662 CACTCTGTGATGGAAAAGCATGG + Exonic
918073605 1:181152426-181152448 CACTCTGTACAGGGACTCCATGG + Intergenic
923161018 1:231315042-231315064 CACCCTGCCCATGAACTGCAGGG + Intergenic
1063123903 10:3123838-3123860 CGCTCTGTGCAGGCTCTGCCTGG - Intronic
1064246118 10:13668855-13668877 CACCGTAGGCAGGAACTGCAGGG - Intronic
1067035871 10:42916103-42916125 CCCTCTGGGCAGCAACAGCAGGG + Intergenic
1067438710 10:46296319-46296341 CTCTGTGTGCAGAATCTGCAAGG + Intronic
1067996715 10:51281476-51281498 CAGTCTGAGATGGAACTGCAAGG + Intronic
1068576240 10:58687599-58687621 CAGTCTGAGCTCGAACTGCAAGG - Intronic
1069218119 10:65848235-65848257 AACTCTGTGCTGGAAATGCAAGG + Intergenic
1069237400 10:66094308-66094330 CCCTCTGTAAAGGAACTTCAGGG - Intronic
1070090038 10:73275584-73275606 CACTCTGTGCACATACTGCAAGG + Exonic
1070930939 10:80260160-80260182 CACTGGTTGCAGGAACGGCATGG + Intergenic
1071824982 10:89316478-89316500 CAGTCTGAGATGGAACTGCAAGG + Intronic
1074742482 10:116498904-116498926 CACTGTGTGCAATAACTCCATGG + Intergenic
1076424727 10:130359372-130359394 CACACTGGGCAGGAACAGAACGG + Intergenic
1080150907 11:29051128-29051150 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1081797600 11:45832106-45832128 CACTGTGTGCAGGCCCTGCTGGG - Intergenic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1082136898 11:48559335-48559357 CACTCTGAGATTGAACTGCAAGG - Intergenic
1084350997 11:68599267-68599289 CACTCTGTGAAGGAAAAGCATGG + Intronic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1084857064 11:71996149-71996171 GACTCTGTGCAAGAGCTGCCAGG - Intronic
1085723497 11:78933674-78933696 CACTCTGGGGAGGCAGTGCAAGG + Intronic
1086884844 11:92193470-92193492 AACTCTGTGCAGGAAAAGCAAGG + Intergenic
1087068816 11:94054556-94054578 TCATCTGTGCAGGAACTGCTGGG + Intronic
1087458822 11:98421478-98421500 CACTGTGTGCAATAACTCCATGG + Intergenic
1089372410 11:117970840-117970862 CACACTGAGCAGGAAGTGGAGGG + Intergenic
1089466691 11:118690309-118690331 GACCCTGAGCAGGACCTGCAGGG - Intergenic
1089747503 11:120627570-120627592 CACTGTCTCCAGGAACTGCCGGG - Intronic
1090109612 11:123892054-123892076 CACTCTGAGCAGAAAATGAAAGG - Intergenic
1090590240 11:128259508-128259530 CAGTGTGTGTGGGAACTGCAGGG + Intergenic
1093626952 12:21360798-21360820 CAGTCTGAGATGGAACTGCAAGG + Intronic
1093687543 12:22073841-22073863 AATCCTGTGCAGGGACTGCATGG + Intronic
1094452385 12:30596535-30596557 CACTCTCTGCAGCATCTACAAGG + Intergenic
1097791619 12:63821544-63821566 CACTCTGAGCACTAACTGCCGGG - Intergenic
1099538835 12:83879374-83879396 CACTCCATCAAGGAACTGCATGG + Intergenic
1099576689 12:84392102-84392124 CACTGTGTGCAATAACTCCATGG + Intergenic
1100924886 12:99533803-99533825 TACTCTGTGTAGGAATTGTATGG - Intronic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1104434419 12:128744270-128744292 CACTTTGGCCAGGAAATGCAGGG - Intergenic
1109573018 13:64216766-64216788 CAGTCTGAGATGGAACTGCAAGG - Intergenic
1110454064 13:75670067-75670089 AACTTTGTGCAGGAGTTGCAGGG + Intronic
1113996814 14:16091298-16091320 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1113996825 14:16091469-16091491 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1113996838 14:16091640-16091662 CACTTTTTGCAGTATCTGCAAGG - Intergenic
1113999938 14:18225132-18225154 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1114386549 14:22261296-22261318 CAGTCTGAGATGGAACTGCAAGG - Intergenic
1115018123 14:28641387-28641409 CAGTCTGAGATGGAACTGCAAGG - Intergenic
1118146664 14:63144712-63144734 CACTCTGAGATCGAACTGCAAGG - Intergenic
1118984319 14:70740587-70740609 CACTAAGTGCAGGCACAGCAGGG + Intronic
1119323886 14:73747192-73747214 GGCTCTGTGCAGGAACAGAAGGG - Intronic
1119437311 14:74605791-74605813 TACTCTGTGCAGGCAAAGCAAGG - Intronic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1122146370 14:99691281-99691303 CACTCAGGGGAGGAACTGCTGGG - Intronic
1122774616 14:104111728-104111750 CAGTCTGTGCGGGTCCTGCATGG - Intronic
1124874779 15:33581566-33581588 CACACTTTGCAGGGATTGCAAGG + Exonic
1128059943 15:64728944-64728966 CACTCTGTGCAGTAACTATAGGG - Intergenic
1129239888 15:74244948-74244970 GACTCTTGGCAGGAACTGAATGG - Intronic
1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG + Intronic
1133154327 16:3862032-3862054 CACTCGGTGCAGGACCGGCTGGG + Intronic
1133647862 16:7781196-7781218 CATTCTGTGGAGGATGTGCATGG + Intergenic
1134467689 16:14493992-14494014 CAATCTGTGTTTGAACTGCATGG + Intronic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1137418095 16:48304220-48304242 CATGCTGTTCAGGTACTGCAAGG + Intronic
1138007315 16:53350119-53350141 CAGTCTGAGATGGAACTGCAAGG - Intergenic
1138029321 16:53547276-53547298 CACTCTGCGCAGTTACTGCCAGG + Intergenic
1139504195 16:67390982-67391004 CAAGCTGTGCAAGGACTGCAAGG - Exonic
1139916257 16:70430210-70430232 CAGGCTGGGCAGGAACTGCCAGG + Intronic
1141687261 16:85577512-85577534 TACTCTATGCAGTACCTGCATGG + Intergenic
1142093443 16:88227136-88227158 CACACTTTGCAGCCACTGCAGGG + Intergenic
1142782036 17:2188777-2188799 CAGTCTGAGCTGGAGCTGCATGG + Intronic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143783048 17:9239523-9239545 CACTCTGTGCAGTCACTTCCTGG + Intronic
1143784145 17:9244323-9244345 CACTCTGTCTTGGAACTCCAGGG - Intergenic
1145449977 17:23232117-23232139 CTCTTTTTGTAGGAACTGCAAGG + Intergenic
1145452401 17:23267573-23267595 CACTTTCTGCAGAATCTGCAAGG + Intergenic
1145501494 17:23981637-23981659 CTCTTTTTGTAGGAACTGCAAGG + Intergenic
1145531398 17:24416621-24416643 CTCTTTTTGCAGAAACTGCAAGG + Intergenic
1145638925 17:25980538-25980560 CTCTTTTTGTAGGAACTGCAAGG + Intergenic
1145836107 17:27955415-27955437 CTCTCAGAGCAGGAACTGTAAGG - Intergenic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1150726826 17:67658086-67658108 CCCACTGTGCAGGACCTGAAGGG + Intronic
1151194788 17:72423797-72423819 CACCGTGTGCATGAACAGCAAGG + Intergenic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1153438224 18:5088974-5088996 CACTGTGTGCAATAACTCCATGG - Intergenic
1155043660 18:22085622-22085644 CACTGTGGGCAGCAACTGCACGG + Intergenic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156376506 18:36519586-36519608 CACTGTGTGCAGGAGCACCATGG + Intronic
1156839376 18:41593501-41593523 CACTCTGAGCAGCAGCTACAGGG + Intergenic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1157393078 18:47319144-47319166 CACTCACAGCAGGAACTGCTAGG - Intergenic
1160800279 19:964469-964491 CACTCTGAGCAGCCAGTGCAAGG + Intronic
1161431142 19:4233117-4233139 CACCCTGTGCAGGCTCGGCATGG + Exonic
1162096327 19:8312001-8312023 CAGACTGGGCAAGAACTGCATGG + Intronic
1162108330 19:8384770-8384792 CACTGTGTGCAATAACTCCATGG - Intronic
1163489639 19:17609635-17609657 AAGTCTGGGCAGGAAGTGCATGG - Intronic
1163612820 19:18309932-18309954 CAGGCTGGGCAGGATCTGCAGGG - Intronic
1163795374 19:19334845-19334867 CACTCTGTGGGAGGACTGCATGG - Intronic
1164347950 19:27291032-27291054 CTCTCTTTGCAGTATCTGCAAGG + Intergenic
1166240277 19:41486737-41486759 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1167050479 19:47075016-47075038 CCCTCTGCCCAGGAACAGCAAGG + Intronic
928773331 2:34728711-34728733 GACTCTGTGTGGGAACTGGAGGG - Intergenic
931860805 2:66352607-66352629 CAGTCTGAGATGGAACTGCAAGG - Intergenic
932237683 2:70134139-70134161 CAGTCTGCCCAGAAACTGCATGG - Intergenic
937220744 2:120342002-120342024 CACACCTTGCAGGAGCTGCAGGG + Intergenic
937639474 2:124195248-124195270 CGCTCTCTGCAGGAACTGTGGGG - Intronic
938752603 2:134347876-134347898 CACTCTGTGCAGGCAAAGCAGGG - Intronic
941610309 2:167653682-167653704 CACTGGGTGCAGGTACTGCTCGG - Intergenic
942299237 2:174546591-174546613 CAATTTGTGCAGGACCTGGAGGG - Intergenic
944447545 2:199806524-199806546 CACTCTGTGAGAGATCTGCAAGG - Intronic
948565211 2:238881924-238881946 CACTCTGTGAAGGGACTGCCTGG + Intronic
949053527 2:241911072-241911094 GACTCTGTCCGGGACCTGCAGGG + Intergenic
1168763131 20:363288-363310 CACTCTGTGCTGGCCCTGGACGG + Intronic
1169247755 20:4037344-4037366 CACTCTGGGCAGGAAAGGTATGG + Intergenic
1169421406 20:5463635-5463657 CACTTTGCCCAGGAAGTGCAAGG - Intergenic
1170693885 20:18639887-18639909 GGCTCTGTTCAGGAATTGCATGG + Intronic
1170831150 20:19841719-19841741 TACTCTGTGCAGGTCCTGCTGGG + Intergenic
1172340811 20:34155946-34155968 CACTGTGTGCAATAACTCCATGG - Intergenic
1173217616 20:41100728-41100750 CACTCTGTGCAGCTTCTGTATGG + Intronic
1174671867 20:52315716-52315738 CAGTCTTTGCAAGAACTGGAAGG + Intergenic
1176108061 20:63398914-63398936 CACCCTGGGCGGGAACTGCTCGG - Intergenic
1178196492 21:30350726-30350748 CACACTGTGGAGGATTTGCAAGG + Intronic
1179979508 21:44888881-44888903 CACTCGGCGCAGGAGCTGCGGGG + Exonic
1180310086 22:11215636-11215658 CACTTTTTGCAGTATCTGCAAGG + Intergenic
1180310099 22:11215807-11215829 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180310110 22:11215978-11216000 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180424402 22:15154905-15154927 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1182348478 22:29684000-29684022 CTCTATGAGCAGAAACTGCAGGG - Intronic
1183092761 22:35534487-35534509 CACTCTTTGCAGGCACTGGGTGG - Intergenic
1183358486 22:37371664-37371686 CACTCTGGGCACCAACTGCCAGG + Exonic
1183513832 22:38251648-38251670 CACTCTGTACAGGCACTGACCGG + Intronic
1184486844 22:44784967-44784989 CACTCTGTGCAGGAATGGGGCGG - Intronic
1185087695 22:48749602-48749624 CCCTCTGTGCACGACCTGGAGGG - Intronic
949263708 3:2132840-2132862 CCCTCTGTCCAGAAACTACAGGG + Intronic
949288046 3:2429812-2429834 CAGTCTGAGATGGAACTGCAAGG - Intronic
949856875 3:8469971-8469993 GCCTTTGTGGAGGAACTGCATGG - Intergenic
953562280 3:44000630-44000652 CACTCAGTGAAGGAGCTGGAGGG + Intergenic
954937953 3:54344236-54344258 CACTCCCTGCTGTAACTGCAGGG - Intronic
956186874 3:66570915-66570937 CACACTGTCCAGGAACAACATGG - Intergenic
956842673 3:73155099-73155121 CACTGTGTGCAATAACTCCATGG + Intergenic
957541704 3:81579559-81579581 CACTATGTGCTGCAACTTCAAGG + Intronic
957780810 3:84815494-84815516 CAGTCTGAGATGGAACTGCAAGG - Intergenic
960063848 3:113350039-113350061 CACTGTGTGCAATAACTCCATGG - Intronic
960813970 3:121654537-121654559 CATTCTGTAAAGGAACTGCCTGG - Intronic
961625826 3:128262862-128262884 CACTCTGTGGAGGAACTCTGTGG - Intronic
961667238 3:128500203-128500225 CACTGTGTGCAGGCACCTCACGG + Intergenic
963514702 3:146293655-146293677 CAGTCTGAGATGGAACTGCAAGG - Intergenic
964564466 3:158034541-158034563 CACTCTGAGATTGAACTGCAAGG + Intergenic
964588120 3:158329963-158329985 CACTCTGAGATCGAACTGCAAGG - Intronic
965222198 3:165940437-165940459 CCCTGTGAGCAGGAACTGGATGG - Intergenic
966141819 3:176766247-176766269 CACCCTGTGTAGCAGCTGCATGG + Intergenic
967889838 3:194357156-194357178 CTTTTTGTGCAGGAACTGGAAGG + Intronic
972917349 4:43897231-43897253 CAGTCTGAGATGGAACTGCAAGG - Intergenic
973542958 4:51952957-51952979 CAGTCTGAGATGGAACTGCAAGG - Intergenic
973626070 4:52773893-52773915 CAGTCTGAGATGGAACTGCAAGG - Intergenic
975443823 4:74440139-74440161 CACTCTGTGGTGAAACTGAAAGG - Intergenic
978484052 4:109229895-109229917 CAGGCTGTACAGGAAGTGCAGGG + Intronic
979236290 4:118404090-118404112 CAGTCTGAGCTCGAACTGCAAGG + Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
979879661 4:125939674-125939696 TACACTGTGTAGGAAATGCAAGG + Intergenic
979997607 4:127450902-127450924 TATTCTCTGCAGGCACTGCATGG - Intergenic
982406065 4:155021502-155021524 CAGTCTGAGATGGAACTGCAAGG - Intergenic
982793053 4:159615141-159615163 CAGTCTGAGAACGAACTGCAAGG - Intergenic
983183549 4:164676287-164676309 CAGTCTGAGATGGAACTGCAAGG + Intergenic
987474678 5:18375892-18375914 CAATCTTTGCAGAGACTGCAGGG + Intergenic
988558665 5:32260706-32260728 CACACTGTGAAGGCACTGCAGGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995749844 5:115442289-115442311 CAGTCTGAGATGGAACTGCAAGG + Intergenic
996699383 5:126435109-126435131 TACTCTGTGCAGGGAATACAAGG + Intronic
997317981 5:132954063-132954085 CACTGTGTTCAAGAACTGGAAGG - Intronic
998469388 5:142371595-142371617 CAATCTGTTGAGGACCTGCATGG - Intergenic
1002103479 5:176868728-176868750 CACTCTGGGCAGGGCCAGCATGG + Intronic
1002571746 5:180143496-180143518 CACGCTGAGGAGGAACAGCAGGG - Intronic
1005051837 6:21691580-21691602 CCCCCTGTGCAGGAACTACCTGG - Intergenic
1006010994 6:31042861-31042883 CATTCTGTGAAGGAACATCAAGG + Intergenic
1007977863 6:46119845-46119867 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1008633163 6:53383108-53383130 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1009825877 6:68865590-68865612 CACTCCATGCTGTAACTGCAGGG + Intronic
1011847995 6:91590341-91590363 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1013103822 6:107009789-107009811 CACTCTCTGCAGGAAACGCCTGG - Intergenic
1013418980 6:109949207-109949229 CAATCCCTCCAGGAACTGCAAGG + Intergenic
1014881223 6:126726659-126726681 CAGTCTGAGATGGAACTGCAAGG + Intergenic
1016999332 6:149985015-149985037 GCATCTGTGCAGGAACTGCTGGG + Intergenic
1019408740 7:897614-897636 GACTCTGCCCAGGAACTGCCTGG + Intergenic
1019598167 7:1868078-1868100 CACTCTGAGCGGGCACGGCAGGG - Intronic
1019708813 7:2509144-2509166 CAGTCAGTGCACGACCTGCACGG - Intergenic
1019917484 7:4143177-4143199 CACCCTGTCCTGGAGCTGCAGGG + Intronic
1020720805 7:11742711-11742733 CACTGAGTGCAGCAACAGCAGGG - Intronic
1022041718 7:26587972-26587994 CACTCTGCAAAGGAACTGCAGGG - Intergenic
1025314590 7:58003743-58003765 CACTCTTTGTAGAATCTGCAAGG + Intergenic
1027871829 7:83717116-83717138 CAGTCTGAGAACGAACTGCAAGG - Intergenic
1029281301 7:99437658-99437680 CAGTTTGTGCAGCAACTACAAGG - Intronic
1030213981 7:107024427-107024449 CAGTCTTTGCAGGAAGTTCAGGG + Intergenic
1030949278 7:115768915-115768937 CAATCTGTACAGGAAAAGCAAGG - Intergenic
1031435254 7:121725064-121725086 CACTCTGAGACAGAACTGCAAGG - Intergenic
1033490508 7:141838679-141838701 CACTCTGTGACAAAACTGCAGGG - Intronic
1037084276 8:14827565-14827587 CAATGTGGGAAGGAACTGCACGG + Intronic
1039639632 8:39205356-39205378 CAGTCTGAGATGGAACTGCAAGG - Intronic
1040276455 8:46016446-46016468 GACCCTGTGCAGGAGCTGCCAGG + Intergenic
1040276701 8:46017529-46017551 CACCCTGTGCAGGTGCTGCTGGG + Intergenic
1040988950 8:53328362-53328384 CACTGTGGGGAGTAACTGCAGGG - Intergenic
1041027378 8:53700885-53700907 CATTCTGAGATGGAACTGCAAGG - Intergenic
1041843024 8:62293966-62293988 CAGTCTGAGATGGAACTGCAAGG - Intronic
1042227846 8:66528544-66528566 CACTCTGAGCTAGAACTGCTTGG + Intergenic
1044440842 8:92221794-92221816 CACTCTGAGATTGAACTGCAAGG - Intergenic
1044620500 8:94186741-94186763 CACTCAGAGCATGAGCTGCAAGG - Intronic
1045709289 8:104964422-104964444 CAGTCTGAGATGGAACTGCAAGG - Intronic
1046073559 8:109288268-109288290 CAATCTGTCTTGGAACTGCATGG + Intronic
1046946906 8:119982725-119982747 CACTCTGGGCAGGAAGAACAGGG + Intronic
1048982424 8:139709941-139709963 CACACTGTGCAGGAACAGGATGG + Intergenic
1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG + Intronic
1049204451 8:141357186-141357208 CACCGTGAGCAGGAGCTGCATGG + Exonic
1050598967 9:7231599-7231621 CACTCTGTGCAGGTAAACCAGGG + Intergenic
1050598974 9:7231630-7231652 CACTCTGTGCAGGTAAGCCAAGG + Intergenic
1050598995 9:7231723-7231745 CACTCTGTGCAGGTAAGCCAGGG + Intergenic
1051886190 9:21895721-21895743 CAGTCTGAGATGGAACTGCAAGG + Intronic
1052996491 9:34554027-34554049 CAGGCTGAGCAGGAACTGGAGGG - Intronic
1053438797 9:38096354-38096376 CACACTGGGCAGGTACTACAGGG - Intergenic
1053713977 9:40862731-40862753 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1054424364 9:64993079-64993101 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1059847223 9:118293773-118293795 CACAATTTGCAGGAACTGCAGGG - Intergenic
1060922713 9:127433620-127433642 GACTCTGGGCAGGAGCTGTAAGG - Intronic
1061010805 9:127953594-127953616 CTCCCTGTGCAGGAGCTGAAAGG - Exonic
1203401379 Un_KI270519v1:103740-103762 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG + Intergenic
1189225861 X:39412676-39412698 CTCTCTGGGGAGAAACTGCAAGG + Intergenic
1189874475 X:45421221-45421243 CACACTGTGCAGCCACTGCTGGG + Intergenic
1190136375 X:47803186-47803208 CACTCTGTGCAGAGACTGGGCGG + Intergenic
1190540799 X:51476062-51476084 AACCCTGTACAGGGACTGCATGG + Intergenic
1191726150 X:64283236-64283258 CAGTCTGAGATGGAACTGCAAGG + Intronic
1193265295 X:79462258-79462280 AACCCTGTACAGGGACTGCAAGG - Intergenic
1195538379 X:106034716-106034738 CACTCTGTACTGGAAGTGCAAGG - Intronic
1200119303 X:153782941-153782963 GACTCTCTGCAGGTGCTGCACGG + Exonic
1200945455 Y:8830860-8830882 CACTGTGTGCAATAACTCCATGG - Intergenic
1201725192 Y:17142855-17142877 CACTCTGTGCTGGAAGTGTCAGG - Intergenic
1201992440 Y:20042585-20042607 CAGTCTGAGATGGAACTGCAAGG - Intergenic