ID: 1157211050

View in Genome Browser
Species Human (GRCh38)
Location 18:45742261-45742283
Sequence GTCCTTCAAGATCAAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157211047_1157211050 1 Left 1157211047 18:45742237-45742259 CCAGCATGGGGACAGCCTGAGCA 0: 1
1: 0
2: 0
3: 21
4: 223
Right 1157211050 18:45742261-45742283 GTCCTTCAAGATCAAGGAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157211050 Original CRISPR GTCCTTCAAGATCAAGGAGA AGG Intronic
900535333 1:3174238-3174260 GTCCTTATAGGACAAGGAGAAGG - Intronic
901093169 1:6657094-6657116 GAGGTTCAGGATCAAGGAGAGGG - Intronic
902612961 1:17607962-17607984 GTCCTTCCAGCCCAAGGTGAGGG + Exonic
904386401 1:30145299-30145321 GACATTCAAGATCAAGGTGCTGG - Intergenic
905217929 1:36422998-36423020 CTCCTTCAAGATAAAGGTGCTGG + Intronic
905994170 1:42366582-42366604 GAAGTTCAAGATCAAGGCGATGG - Intergenic
907598912 1:55747010-55747032 GTGCTTCAAGATCAAGGCAGTGG + Intergenic
908106598 1:60849864-60849886 GTCCTTCAAGTTGAAAGAAAAGG + Intergenic
908553677 1:65235064-65235086 GTCCAACAGGGTCAAGGAGAAGG + Intergenic
909947734 1:81682730-81682752 GACCTTCAAGGTCCAGAAGAGGG - Intronic
913718243 1:121561453-121561475 ATCCTTCAAGGTCAATCAGAAGG + Intergenic
915419627 1:155769517-155769539 TTCCTTCAAGATGAAAGTGACGG + Intronic
917503562 1:175607566-175607588 GTCCTTGAAGAGCAAGCATATGG - Intronic
918268806 1:182874654-182874676 CTCCTTCAAGGTCTAAGAGAGGG + Intronic
918597585 1:186309673-186309695 GTCCTTCAAGATCTTAGAAAAGG + Intronic
918868049 1:189929495-189929517 GGCCATGAAGATCAAGGACATGG + Intergenic
919986209 1:202677299-202677321 ATCCATCAATTTCAAGGAGAGGG - Intronic
922075442 1:222239015-222239037 GTCCTGCATTATCTAGGAGATGG + Intergenic
922602033 1:226863724-226863746 GACCTTCAAAGTGAAGGAGAGGG + Intergenic
923245485 1:232127184-232127206 GTCCTTCAGGATGAAACAGAAGG - Intergenic
923896480 1:238275852-238275874 GTCCTTCAAAATCAAGTACCAGG + Intergenic
1065583703 10:27197158-27197180 GTCCTTCAAGTTCAAGGGCAGGG + Exonic
1066612527 10:37265112-37265134 GTCTTTCTAGTTCAAAGAGACGG - Intronic
1067192539 10:44083322-44083344 CTCCTTCAAGGGCAAGAAGAAGG + Intergenic
1067263042 10:44711606-44711628 ATCCTTCAAAAGCAAGGAGTTGG + Intergenic
1068386462 10:56334504-56334526 GTTCTTCAAGATGAAAGAAAAGG - Intergenic
1069612166 10:69781464-69781486 GTCCTGGAAGATCCAGGAGAGGG + Intergenic
1070021745 10:72593208-72593230 TTCCTTTAAGATCAAGAACAAGG + Intronic
1070807986 10:79281893-79281915 GTCCTTCAGGGTCAACGAGGTGG + Intronic
1070820294 10:79350379-79350401 GACCTTCAAGATCAGGGATTGGG + Intronic
1071404518 10:85317314-85317336 ATCCTACAAGATCAAGGAGGGGG + Intergenic
1071836457 10:89423019-89423041 GAAGTTCAAGATCAAGGAGCTGG + Intergenic
1072111941 10:92330499-92330521 TTCCTTAAAGATCCAGGACAAGG - Intronic
1072260478 10:93665795-93665817 GAAGTTCAAGATCAAGGAGTTGG + Exonic
1072270149 10:93768491-93768513 GTCCTGGAACATCAAGGAGAAGG - Intronic
1073117844 10:101102145-101102167 GTCACTCAAAGTCAAGGAGAAGG - Intronic
1074066337 10:110018006-110018028 TTCCTTACAGATAAAGGAGAAGG - Intronic
1075574530 10:123569263-123569285 GTCCTTTAAGAGAAAGGAGAGGG + Intergenic
1075846176 10:125546444-125546466 GTCCTTCAAGATGAGGTACAGGG - Intergenic
1077484479 11:2832506-2832528 CTACTGCAAGATCAGGGAGATGG + Intronic
1078156477 11:8804186-8804208 GTCCTTTAAGAGGAAGGAGTAGG - Intronic
1078584875 11:12575400-12575422 GTGATTCAAGATCAAGGAGCTGG + Intergenic
1080859133 11:36138067-36138089 GTGCTTGAAGATCAGGGAGTTGG + Intronic
1080880977 11:36320201-36320223 GTTCTTCAAGAACAAAAAGAAGG + Intronic
1082294246 11:50418695-50418717 TTCCTTCAAGGTCTAAGAGAGGG + Intergenic
1083952279 11:65963415-65963437 AGCCTTTAAGATAAAGGAGAAGG + Intronic
1089346211 11:117793337-117793359 CTCCTCCAAGATCACGGAGGAGG + Intronic
1090393804 11:126406283-126406305 GTCCTTCAAGATGAAGAGAAGGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1094285923 12:28793496-28793518 GTCCTTGAAGATAAATGTGAAGG - Intergenic
1095671343 12:44863663-44863685 GTTCTTCAAGCTCAAAGAAAAGG + Intronic
1097066431 12:56323976-56323998 GTCCTGTAATATCAGGGAGAGGG - Intronic
1098549442 12:71747071-71747093 GTCCTTCAACATTAAAAAGAAGG - Intergenic
1099322453 12:81167491-81167513 GACATTCAAGATCAAGGTGCTGG + Intronic
1100066588 12:90653420-90653442 ATTCTTCAAAATCAAAGAGAAGG + Intergenic
1101043780 12:100783868-100783890 GTCCATAAAGATCAGGAAGATGG + Intronic
1101712948 12:107285757-107285779 GCCCTGCATAATCAAGGAGATGG + Intergenic
1102053174 12:109878105-109878127 GTCCTTTGAGACCAAGGAAAGGG + Intronic
1102632119 12:114290273-114290295 CTCCTGAAAGATCAAGGAAAGGG + Intergenic
1102815458 12:115861785-115861807 GTCCTTGCAGAGAAAGGAGAGGG + Intergenic
1103566226 12:121817197-121817219 CTCCTTCAAGGTCAAGAGGAAGG + Exonic
1104917025 12:132271011-132271033 GTCCTTAAAAATCAAGCAGAGGG + Intronic
1106468503 13:30033965-30033987 GGCCTTCAAGAGGAAGGAGAGGG + Intergenic
1106652884 13:31710820-31710842 ATCCTTCAAAGTAAAGGAGAAGG - Intergenic
1107793788 13:44029510-44029532 GACCTCCAAGATCAAGGTGCAGG - Intergenic
1108190920 13:47938347-47938369 GTCCTACAAGTGCAAGGAGCTGG - Intronic
1114839929 14:26251589-26251611 GTGCTTCAATATCTAGGTGATGG + Intergenic
1118326615 14:64785768-64785790 CTCAGACAAGATCAAGGAGAAGG - Exonic
1118747693 14:68785882-68785904 GTCCTTAAAGTTAGAGGAGATGG - Intergenic
1120913181 14:89686526-89686548 GTATTTCAAGTTCTAGGAGAAGG + Intergenic
1121852910 14:97238815-97238837 TTCCTCCAGGCTCAAGGAGATGG + Intergenic
1121884690 14:97532734-97532756 GAAGTTCAAGATCAAGGAGCTGG + Intergenic
1122502544 14:102210900-102210922 GCCATCCAAGAACAAGGAGAGGG - Intronic
1124707971 15:31981290-31981312 TTCCTTATTGATCAAGGAGAGGG + Intergenic
1126454164 15:48843101-48843123 GTCCTGTAAGAGGAAGGAGAGGG + Intronic
1128033336 15:64500901-64500923 GTCCTTCCAAGTCAAGCAGAAGG - Intronic
1128125063 15:65185939-65185961 GGCCTGAAAGAACAAGGAGACGG - Intergenic
1128878653 15:71223210-71223232 CTCCTTCAAGGTCACGCAGAAGG + Intronic
1131432822 15:92400458-92400480 GGGCTTCCAGATCAAGCAGAGGG - Intronic
1132504523 16:300740-300762 GTCCTACAAAACCAAGGAAAGGG - Intronic
1134084042 16:11344398-11344420 GTCATTCAAGAGGAAGCAGATGG + Intronic
1135414344 16:22257488-22257510 CTTTTTCAAGATCATGGAGATGG + Intronic
1137369583 16:47892522-47892544 GTCCTACAAGATCAAAGTGAGGG + Intergenic
1137482440 16:48863843-48863865 GTGCATAAAGATCAAGGAGGAGG - Intergenic
1137484353 16:48879255-48879277 TTCTTTCAAGGTCGAGGAGAAGG + Intergenic
1140190065 16:72807916-72807938 GTCATTCATGCTCCAGGAGAAGG - Intronic
1140340229 16:74151369-74151391 TTCCTTCAAGATCCAGAATATGG + Intergenic
1142809365 17:2388028-2388050 GTCCCTGAAGAGGAAGGAGAAGG - Exonic
1145784873 17:27587300-27587322 GTCCTCCCACATCAAGGAGAGGG - Intronic
1145893646 17:28437563-28437585 GTCCTTCAAGTTCAAGCTGAAGG - Intergenic
1148236977 17:45975496-45975518 GTCCTTCACGTTCAAGGATGAGG - Intronic
1149152178 17:53580266-53580288 GTCTTTGAAGATAAAGGAAAGGG + Intergenic
1149228181 17:54499768-54499790 TTCCTTTAAAATCAAGTAGATGG - Intergenic
1149338639 17:55663818-55663840 GCCTTTAAAGATCAAGGACAAGG - Intergenic
1151412249 17:73938824-73938846 AGCCTCCAAGGTCAAGGAGATGG + Intergenic
1151572256 17:74932687-74932709 GTCCTATAAAATGAAGGAGATGG - Intronic
1152362954 17:79840747-79840769 GTCCTTCAAGAGCCCGGAGCCGG - Intergenic
1153249089 18:3102628-3102650 TTCCTACAAGATCAAAAAGAAGG + Exonic
1153355427 18:4129448-4129470 TTCCTTCATCATGAAGGAGAGGG + Intronic
1155512763 18:26594084-26594106 CTCCTTCAAGCTCAACAAGATGG - Intronic
1157211050 18:45742261-45742283 GTCCTTCAAGATCAAGGAGAAGG + Intronic
1158111443 18:53944487-53944509 GTCCTCCACGAGCATGGAGAAGG - Intergenic
1163739089 19:18999732-18999754 GTCCTTCATGGTCAGGGAGGAGG - Intronic
1163849673 19:19655981-19656003 CTCCCTCATGATCAAGCAGACGG + Intronic
1165882797 19:39055480-39055502 GACATTCAAGATCAAGGTGCTGG + Intergenic
1167413370 19:49357759-49357781 GTCACTCATCATCAAGGAGATGG - Intronic
925564524 2:5235821-5235843 GTCCTACAGGATCCAGGAGGGGG - Intergenic
926058376 2:9789913-9789935 GGCCTTCAGGAACAAGGACAGGG - Intergenic
926377622 2:12249150-12249172 GACATCCAAGATCAAGGAGCTGG - Intergenic
926957082 2:18313349-18313371 GTCCTTCAGGAGCAAGAGGAAGG - Intronic
927010240 2:18896618-18896640 AGCCTTCAGAATCAAGGAGATGG + Intergenic
929488835 2:42378671-42378693 GGCCTTGAAGGTGAAGGAGAGGG - Intronic
930878483 2:56245869-56245891 GAAGTTCAAGATCAAGGAGATGG - Intronic
931468389 2:62512980-62513002 GTGCTTGCAGAGCAAGGAGAGGG + Intergenic
932750073 2:74365886-74365908 GTCACTCAAGATTAAGGTGAGGG - Exonic
932764779 2:74462645-74462667 GACCTTCCAGCTGAAGGAGAAGG - Exonic
937756569 2:125546260-125546282 GTGCATCAAGATAAAAGAGAAGG + Intergenic
938257764 2:129873249-129873271 GGTGTTCAAGATGAAGGAGAAGG - Intergenic
938657007 2:133444746-133444768 GGCCATCAAGTTCATGGAGAGGG - Intronic
938692552 2:133805578-133805600 CTCCTTCAATACAAAGGAGAGGG - Intergenic
938811961 2:134862038-134862060 AACCTTCAACACCAAGGAGATGG - Intronic
940139049 2:150473187-150473209 GTCCTTCACTATCAAAGAGGAGG - Intronic
943084266 2:183293819-183293841 GTCCTACAAAATCAAGGAACTGG + Intergenic
943319632 2:186431876-186431898 GTCCCTCATGAGCATGGAGAAGG + Intergenic
944419229 2:199510986-199511008 GTCCTTTAAGGTCAAGAACATGG + Intergenic
944963147 2:204899746-204899768 GTTCTTCAAGCTGAAAGAGAAGG - Intronic
945807819 2:214511599-214511621 GAAGTTCAAGATCAAGGTGATGG - Intronic
946491174 2:220150722-220150744 CTCCTTCAAGGTTAAGTAGATGG - Intergenic
1169594899 20:7187390-7187412 TGCCTTCAAGAGCAAGAAGATGG - Intergenic
1170184543 20:13573387-13573409 GAAGTTCAAGATCAAGGAGCTGG - Intronic
1170419796 20:16181287-16181309 GTCCTTCAAGAACAGGGAAGAGG - Intergenic
1171043088 20:21784224-21784246 GTCCTTCAATAAAAAAGAGAGGG - Intergenic
1176211948 20:63928818-63928840 GTTCTTCAAGCTCAATCAGAAGG - Intronic
1179553257 21:42156676-42156698 GTCCTTCCAGATCAAAGATTTGG - Intergenic
1179812796 21:43883220-43883242 GCCCTTGAGGCTCAAGGAGAAGG - Intronic
1180152441 21:45957240-45957262 GTCCTTCCAGATCAAAGGGCAGG + Intergenic
1180158757 21:45989914-45989936 GTCCTTCCAGATGGAGGGGACGG - Intronic
1180247587 21:46558302-46558324 GTCCTTGAAGAGCTTGGAGAAGG - Exonic
1181421643 22:22803402-22803424 GTCCTTGAAGAGGAAGGGGAGGG - Intronic
1184891737 22:47383759-47383781 GTCCTTCAAGGACAAGGATGCGG - Intergenic
949257877 3:2071001-2071023 TTCCATCAATATTAAGGAGAAGG + Intergenic
949545581 3:5069351-5069373 GTCCTTCAGGGGCGAGGAGATGG - Intergenic
951750173 3:26026256-26026278 GTTCTTCAAGCTGAAGGAAAAGG - Intergenic
953217427 3:40932608-40932630 GTTCTTCAAGTTGAAGGAAAAGG + Intergenic
953314296 3:41911850-41911872 GTCCCTCAAGATCCAGGCTAAGG + Intronic
956020131 3:64925368-64925390 GTTTTTTAAGATCAAGGAAATGG - Intergenic
957031946 3:75252333-75252355 GACCTTGAAAATCATGGAGAAGG - Intergenic
959799712 3:110477795-110477817 TTCCTTCAATGTCATGGAGAAGG - Intergenic
960070165 3:113420689-113420711 GTCTTTCAACATCAAGGAAAAGG - Intronic
961337213 3:126187768-126187790 GCCCTTTAAGACCAATGAGAGGG + Intronic
962197825 3:133379142-133379164 GTCCTCCAGGGTCAGGGAGAGGG + Intronic
962584190 3:136825161-136825183 TTCCTTCAAGATCTAGAAAAAGG - Intronic
963412011 3:144940612-144940634 GGCTTTGAAGATGAAGGAGAGGG - Intergenic
964416807 3:156456194-156456216 GTCCTTCAAGTTCAATGATTGGG + Intronic
965138429 3:164804469-164804491 GAAATTCAAGATCAAGGAGCTGG - Intergenic
965635015 3:170771957-170771979 GTCCATCAAGTTTAAGGAAAAGG + Intronic
966839423 3:184076680-184076702 CTCCTTCAAGCTCAAGGAGCTGG + Intergenic
967124266 3:186410240-186410262 GTTCCTCAAGATCATGGAAAAGG + Intergenic
967975131 3:195030260-195030282 GTCCTCCAACATCCAGCAGAAGG + Intergenic
970284380 4:14493640-14493662 GACGTTCAAGATCAAGGTGCTGG - Intergenic
970507186 4:16743417-16743439 GCCACTCATGATCAAGGAGAGGG - Intronic
971666479 4:29493391-29493413 TTCCTTTAAGATCAGGGACAAGG - Intergenic
973800477 4:54472766-54472788 GTTATTGAAGGTCAAGGAGAAGG - Intergenic
975763370 4:77640487-77640509 TTCCTTCAAGATGAAGGAAAAGG - Intergenic
976377781 4:84364663-84364685 GTCGTTAAATGTCAAGGAGAAGG + Intergenic
977295759 4:95206972-95206994 GTCCTGCAAGATCAAGGTCTTGG - Intronic
978293899 4:107180616-107180638 GAGCTTCAAGATCAAGGGGCAGG + Intronic
978318056 4:107462255-107462277 GCCCTTCTAGACCAGGGAGAAGG + Intergenic
978644148 4:110908666-110908688 GAGCTTCAAGAGCAAAGAGATGG + Intergenic
979745676 4:124209905-124209927 ATCAATCAAGACCAAGGAGAAGG + Intergenic
979984376 4:127295910-127295932 GTCCTTTCAAATCTAGGAGAAGG + Intergenic
982419505 4:155177695-155177717 ATCCTTCAAAATCTAGGTGAAGG + Intergenic
983465833 4:168088302-168088324 TTCCTTCAACATAAAGGAAAAGG + Intergenic
986678832 5:10215253-10215275 CTCATTCAAGAGCAAGGAAAGGG + Intergenic
986984481 5:13484762-13484784 GAAGTTCAAGATCAAGGTGAAGG + Intergenic
987390161 5:17368047-17368069 GTCTATCAAGATCAAGAAAATGG - Intergenic
988388640 5:30598808-30598830 GTCCTTAAAGTCAAAGGAGATGG + Intergenic
990506794 5:56453373-56453395 GTCCTACAACCCCAAGGAGATGG - Intergenic
990516692 5:56536914-56536936 GTACTTGAAGATAAAGGATAAGG + Intronic
995735066 5:115291656-115291678 GTCCTTCAAGCTAAAATAGAAGG - Intronic
995984532 5:118153498-118153520 GTCGGTAAATATCAAGGAGATGG + Intergenic
998944578 5:147324072-147324094 GTCAGTCAAGTCCAAGGAGATGG + Intronic
998967005 5:147551897-147551919 GTGCTTCAACATTAAGTAGAGGG + Intergenic
999658382 5:153832956-153832978 GTCCTTCAAGAATGAGGAGTAGG + Intergenic
1003884008 6:10504470-10504492 TTCTTTCCAGATCCAGGAGAGGG - Intronic
1004834299 6:19514033-19514055 GTCCTTCAAGTTGAAAGGGAAGG - Intergenic
1005455642 6:26017393-26017415 TTCCTTCAAGCTCAACAAGAAGG - Exonic
1005670932 6:28105374-28105396 ATCATTCAAGATAAAGGACATGG - Intergenic
1007283264 6:40728483-40728505 GAAGTTCAAGATCAAGGAGCTGG + Intergenic
1008797191 6:55318426-55318448 GTTCTTCAAGCTGAAGGAAAAGG - Intergenic
1009651423 6:66481350-66481372 GTCCCTCATGAGCATGGAGAAGG - Intergenic
1010342010 6:74764946-74764968 GTCCTTAAAGACCAAGGAATTGG + Intergenic
1010811267 6:80301609-80301631 CTGCTTAAAAATCAAGGAGAAGG + Intronic
1011695461 6:89908436-89908458 ATCCTTCAAAGTGAAGGAGAAGG - Intergenic
1015596971 6:134875217-134875239 GTCCCTCATGAGCATGGAGAAGG - Intergenic
1015935349 6:138402838-138402860 GTCCTTCAAGAGAAATGGGAAGG - Intergenic
1016297969 6:142596451-142596473 GACTTTGAAGATGAAGGAGAGGG - Intergenic
1017064380 6:150516077-150516099 TTCCTTCCAGAGCAAAGAGAGGG - Intergenic
1018593972 6:165458468-165458490 GAAGTTCAAGATCAAGGTGATGG - Intronic
1019969027 7:4525291-4525313 TTCTTACAAGAGCAAGGAGAGGG + Intergenic
1021468893 7:20978988-20979010 GTCCTTCAAGATCTAAGGCAGGG + Intergenic
1026154768 7:67817376-67817398 GAAGTTCAAGATCAAGGTGATGG + Intergenic
1026178749 7:68020469-68020491 GTCCTTAAAGGCCAAGGAAATGG - Intergenic
1027831766 7:83185743-83185765 GTCATTCTACCTCAAGGAGATGG + Intergenic
1030040436 7:105445282-105445304 GACGTTCAAGATCAAAGAGCTGG + Intronic
1034712902 7:153211042-153211064 TTCCTCCAAGATCAGGGACAAGG - Intergenic
1035305048 7:157926775-157926797 GTCCAGCAAGATCAGGGTGAAGG - Intronic
1035566204 8:643093-643115 GCCCTTCAAGGTCCAGGGGAAGG + Intronic
1036645430 8:10609193-10609215 GTCCTCCAGGGTGAAGGAGAGGG + Exonic
1036750092 8:11438242-11438264 GTCTTGCAGGGTCAAGGAGAAGG - Intronic
1037610346 8:20470825-20470847 GAAATTCAAGATCAAGGTGAAGG + Intergenic
1038769900 8:30467735-30467757 GTCCCTGAGGATCAAGGACAGGG + Intronic
1039715831 8:40107735-40107757 GTCCTTCAAGATTGAGAAGATGG - Intergenic
1039940889 8:42089939-42089961 GTCCTACAAGTTCTCGGAGAAGG + Intergenic
1040981064 8:53246608-53246630 GAGCTTCAAAACCAAGGAGAAGG + Intronic
1042201195 8:66280702-66280724 GACGTTCAAGATCAAGGAGCTGG + Intergenic
1042603095 8:70518902-70518924 GTCCTTAAAAAACAAAGAGAAGG - Intergenic
1043588392 8:81796254-81796276 GACATCCAAGATCAAGGTGATGG - Intergenic
1043997536 8:86836918-86836940 GTCCTTCAGGACCATGGAGAGGG - Intergenic
1045603842 8:103750042-103750064 ATCCTACAAGATTAAGGAAATGG + Intronic
1046695888 8:117338801-117338823 GTCCTTCAAGCTGAGGGACAAGG - Intergenic
1047462949 8:125086201-125086223 GAACTTCAAGATCAAGGTGTTGG + Intronic
1047762442 8:127964104-127964126 GTCCTTCCAGGACAAGCAGATGG + Intergenic
1048286424 8:133145344-133145366 GTCCTACAACAGCAAGGAGCTGG + Intergenic
1050605946 9:7301255-7301277 GTACTTCCAGATCAAGGTGCTGG - Intergenic
1052977126 9:34419500-34419522 GTTCTTCAAGATAAGGGAGGAGG + Intronic
1053446372 9:38156279-38156301 CTCCTGCAAGATGCAGGAGAGGG + Intergenic
1054710300 9:68504394-68504416 GTCATTCAAGATCATGGTAAGGG - Intronic
1055229741 9:74048117-74048139 AGCCTTCAAGATCAAGAACAAGG - Intergenic
1057462918 9:95281541-95281563 GTTCTTCAAGATGAAAGAAAAGG + Intronic
1057622198 9:96645932-96645954 CTCCTTGAAAATCAAAGAGAGGG + Exonic
1060550240 9:124481541-124481563 GTCCTTCATGACCTAGGACAGGG + Exonic
1062646890 9:137552228-137552250 GTTCGTGCAGATCAAGGAGATGG + Exonic
1187303400 X:18073477-18073499 GTACTTCCACATGAAGGAGAGGG - Intergenic
1188172414 X:26943716-26943738 GACCTTCAAGATCAAGGCCCTGG - Intergenic
1191825183 X:65357053-65357075 CTCCTTGAAAATCAAAGAGAGGG + Intergenic
1195437166 X:104857970-104857992 TTCCTGCAATATCAAGGTGAGGG - Intronic
1195805657 X:108762693-108762715 GAAGTTCAAGATCAAGGAGCCGG + Intergenic
1196433019 X:115647563-115647585 GTCCTGGAAGATCTTGGAGATGG + Exonic
1196892702 X:120306353-120306375 GTCCCTCAAAATCAAGAGGAAGG - Intronic
1197887630 X:131235054-131235076 GTCCTTGAAGATAAAGGAAAGGG - Intergenic
1202135781 Y:21659459-21659481 GTATTTCAAGATCCACGAGAAGG - Intergenic