ID: 1157213487

View in Genome Browser
Species Human (GRCh38)
Location 18:45763301-45763323
Sequence CAGAGAGAATGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157213474_1157213487 29 Left 1157213474 18:45763249-45763271 CCCAACCCACTGTTTTCCTTTGC No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213482_1157213487 -7 Left 1157213482 18:45763285-45763307 CCAATAGGATGAAATACAGAGAG No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213477_1157213487 23 Left 1157213477 18:45763255-45763277 CCACTGTTTTCCTTTGCCTGTTG No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213475_1157213487 28 Left 1157213475 18:45763250-45763272 CCAACCCACTGTTTTCCTTTGCC No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213481_1157213487 7 Left 1157213481 18:45763271-45763293 CCTGTTGGATTCTGCCAATAGGA No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213476_1157213487 24 Left 1157213476 18:45763254-45763276 CCCACTGTTTTCCTTTGCCTGTT No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data
1157213479_1157213487 13 Left 1157213479 18:45763265-45763287 CCTTTGCCTGTTGGATTCTGCCA No data
Right 1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157213487 Original CRISPR CAGAGAGAATGGAGGGAAGA GGG Intergenic
No off target data available for this crispr