ID: 1157215801

View in Genome Browser
Species Human (GRCh38)
Location 18:45782500-45782522
Sequence CCTGATTGGTAGTTATTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157215798_1157215801 -3 Left 1157215798 18:45782480-45782502 CCAACACACATCAGTGGCTGCCT No data
Right 1157215801 18:45782500-45782522 CCTGATTGGTAGTTATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157215801 Original CRISPR CCTGATTGGTAGTTATTTGC TGG Intergenic
No off target data available for this crispr