ID: 1157216160

View in Genome Browser
Species Human (GRCh38)
Location 18:45785452-45785474
Sequence CGAGTCTCAGCACAGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157216156_1157216160 -2 Left 1157216156 18:45785431-45785453 CCTGGCCAGAAAGAGCCTTGGCG No data
Right 1157216160 18:45785452-45785474 CGAGTCTCAGCACAGTCAGGAGG No data
1157216157_1157216160 -7 Left 1157216157 18:45785436-45785458 CCAGAAAGAGCCTTGGCGAGTCT No data
Right 1157216160 18:45785452-45785474 CGAGTCTCAGCACAGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157216160 Original CRISPR CGAGTCTCAGCACAGTCAGG AGG Intergenic
No off target data available for this crispr