ID: 1157220084

View in Genome Browser
Species Human (GRCh38)
Location 18:45823186-45823208
Sequence TCCATACTGTTCCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157220084_1157220090 12 Left 1157220084 18:45823186-45823208 CCAGGCAGAAGGAACAGTATGGA No data
Right 1157220090 18:45823221-45823243 GGTGCTTTAACAACAAATTTAGG No data
1157220084_1157220091 25 Left 1157220084 18:45823186-45823208 CCAGGCAGAAGGAACAGTATGGA No data
Right 1157220091 18:45823234-45823256 CAAATTTAGGAATTTGAGCTTGG No data
1157220084_1157220089 -9 Left 1157220084 18:45823186-45823208 CCAGGCAGAAGGAACAGTATGGA No data
Right 1157220089 18:45823200-45823222 CAGTATGGAAGGTGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157220084 Original CRISPR TCCATACTGTTCCTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr