ID: 1157220091

View in Genome Browser
Species Human (GRCh38)
Location 18:45823234-45823256
Sequence CAAATTTAGGAATTTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157220084_1157220091 25 Left 1157220084 18:45823186-45823208 CCAGGCAGAAGGAACAGTATGGA No data
Right 1157220091 18:45823234-45823256 CAAATTTAGGAATTTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157220091 Original CRISPR CAAATTTAGGAATTTGAGCT TGG Intergenic
No off target data available for this crispr