ID: 1157220704

View in Genome Browser
Species Human (GRCh38)
Location 18:45826790-45826812
Sequence ACTGGAGTCCAGCTCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 190}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157220690_1157220704 21 Left 1157220690 18:45826746-45826768 CCACACCTTAGACCCCTTTGCCC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220699_1157220704 -4 Left 1157220699 18:45826771-45826793 CCATCTGGCGTGTACTCAGACTG 0: 1
1: 0
2: 1
3: 10
4: 65
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220694_1157220704 8 Left 1157220694 18:45826759-45826781 CCCTTTGCCCTCCCATCTGGCGT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220698_1157220704 -3 Left 1157220698 18:45826770-45826792 CCCATCTGGCGTGTACTCAGACT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220696_1157220704 1 Left 1157220696 18:45826766-45826788 CCCTCCCATCTGGCGTGTACTCA 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220693_1157220704 9 Left 1157220693 18:45826758-45826780 CCCCTTTGCCCTCCCATCTGGCG 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220695_1157220704 7 Left 1157220695 18:45826760-45826782 CCTTTGCCCTCCCATCTGGCGTG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220697_1157220704 0 Left 1157220697 18:45826767-45826789 CCTCCCATCTGGCGTGTACTCAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220689_1157220704 22 Left 1157220689 18:45826745-45826767 CCCACACCTTAGACCCCTTTGCC 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
1157220691_1157220704 16 Left 1157220691 18:45826751-45826773 CCTTAGACCCCTTTGCCCTCCCA 0: 1
1: 0
2: 0
3: 32
4: 346
Right 1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG 0: 1
1: 0
2: 2
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157220704 Original CRISPR ACTGGAGTCCAGCTCGGGGC TGG Intronic
900099197 1:953881-953903 ACAGGACACCAGCTGGGGGCAGG + Exonic
900133545 1:1102865-1102887 ACTGCACTCCAGCCTGGGGCTGG - Intronic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900324588 1:2102185-2102207 ACTGGTGTGGAGGTCGGGGCAGG - Intronic
901628311 1:10635865-10635887 CCTGGAGTCCAGCTCAGGGAGGG + Intergenic
902080074 1:13814731-13814753 AATGGAGTCCAGCTCAAAGCTGG - Intronic
902501848 1:16916138-16916160 ACTGCACTCCAGCTCAGGCCTGG + Intronic
902577675 1:17388672-17388694 AGTGGGGCCCAGCTGGGGGCCGG + Intronic
902969582 1:20037678-20037700 GCTGGCCTCCAGCTAGGGGCTGG + Intronic
903361019 1:22777248-22777270 ACTGGAGTGCAGCTTGAGGGTGG + Intronic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904875672 1:33652790-33652812 ACTGCAATCCAGCCTGGGGCTGG - Intronic
912954519 1:114145103-114145125 AATGGGGTGAAGCTCGGGGCAGG + Intronic
915515969 1:156412909-156412931 ATTTGAGTCCAGCTCAGGGAGGG + Intronic
919939512 1:202276549-202276571 AGTGGGGTCCTGCTGGGGGCTGG + Intronic
920065776 1:203268604-203268626 ACTGCACTCCAGCCTGGGGCAGG + Intronic
922290426 1:224205056-224205078 ACCAGAGTCCAGCTCGGTGTTGG - Intergenic
1062925723 10:1314305-1314327 AGTAGAGTCCAGCTGTGGGCAGG - Intronic
1063010023 10:2012442-2012464 CCTGGAGTCCTGCTGGGGGACGG + Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1069013426 10:63400573-63400595 GCAGGACTCCATCTCGGGGCCGG - Intronic
1070549560 10:77480393-77480415 ACTGGGGTCCATCACGTGGCTGG - Intronic
1073031369 10:100529003-100529025 ACAGGAGTCCAGCTCCAGCCTGG + Intronic
1074087642 10:110220592-110220614 ACTCGAGGCCAGCTCCTGGCAGG + Intronic
1075647730 10:124107647-124107669 AGTGGAATCCAGCTTGGGACGGG - Intergenic
1075788018 10:125063096-125063118 GCTGAGGTCCAGCTCGAGGCTGG - Intronic
1077481382 11:2816291-2816313 AGTGGAGTCAAGCTCAGTGCTGG + Intronic
1077493731 11:2874800-2874822 ACTGGAGCCCAGCTTGGAGCAGG - Intergenic
1077500893 11:2909371-2909393 ACTGGAGTCCAGGTGGGGCCGGG + Intronic
1077603929 11:3594238-3594260 GCTGGTGTCCAGCTCGGGGACGG + Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083320345 11:61842218-61842240 ACTGGTGACCAGCTCAGGGGTGG - Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088315025 11:108498441-108498463 ACTGGGGCCCACCGCGGGGCGGG + Intergenic
1088573934 11:111251460-111251482 ACTGAAGTCCACGTCTGGGCTGG + Intergenic
1089357843 11:117866799-117866821 ACTGGAGCTCAGCTCAGGGTGGG + Intronic
1091041588 11:132285938-132285960 AATGGAGTTCAGCTCAGGACTGG + Intronic
1094375606 12:29784401-29784423 ACTGGACGCGAGCGCGGGGCGGG - Intronic
1094411292 12:30170547-30170569 ACTGGAAGCGAGCGCGGGGCGGG - Intergenic
1096810178 12:54164332-54164354 ACTGGAGTCCAGGTGGCTGCAGG + Intergenic
1097249463 12:57624622-57624644 AGTGGAGTTGAGGTCGGGGCAGG + Intronic
1098414140 12:70214598-70214620 AGTGGAGTCCAGCACTAGGCTGG - Intergenic
1103982539 12:124745998-124746020 ACGGGAGGCAAGGTCGGGGCAGG - Intergenic
1104643780 12:130483491-130483513 GCTGCAGTCCTGCTGGGGGCTGG + Intronic
1105037307 12:132935123-132935145 ACTTGAGTCCAGCTGAAGGCTGG - Intronic
1110971763 13:81771906-81771928 ACTGGAGGCCTGCTCGTAGCAGG - Intergenic
1111156619 13:84336423-84336445 ACTGGAGTCAAGCTCATGGATGG - Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114713878 14:24804709-24804731 ACTGGAGACCACCCCGGGGAGGG - Intergenic
1114779976 14:25527949-25527971 ACTGCACTCCAGCTTGGGGACGG + Intergenic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119711917 14:76828571-76828593 CCTGGAGTCCTCCTCCGGGCTGG + Intronic
1121125059 14:91400495-91400517 CCGGGAGTCCAGCTCTGGCCTGG - Intronic
1121761149 14:96446164-96446186 ACTGGGGTCCTGCTGGGGGCCGG + Intronic
1123125846 14:105945410-105945432 ACTGGAGTCATGCCCAGGGCTGG - Intergenic
1124371288 15:29106272-29106294 ACTGGAGCCCTGCTTGGGGTGGG + Intronic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1129524286 15:76204140-76204162 CCTGTGTTCCAGCTCGGGGCTGG - Exonic
1130315905 15:82796342-82796364 ACTGGGGACCAGCTCTGGCCAGG - Intronic
1130990355 15:88872242-88872264 TCTGGAACCCAGCCCGGGGCTGG + Intronic
1132118917 15:99159662-99159684 AGTGGAGTCCAGGTCGTGGACGG + Intronic
1132548416 16:544158-544180 ACTGCAGCCCAGCTCGAGGGAGG + Intronic
1132695139 16:1198710-1198732 GTTGGCGTCCAGCTCTGGGCTGG + Exonic
1132853297 16:2034349-2034371 ACAGGAGTCCAGTTCGGGAGGGG - Intronic
1132853323 16:2034422-2034444 ACAGGAGTCCAGTTCGGGAGGGG - Intronic
1132853349 16:2034495-2034517 ACAGGAGTCCAGTTCGGGAGGGG - Intronic
1132853402 16:2034641-2034663 ACAGGAGTCCAGTTCGGGAGGGG - Intronic
1132853453 16:2034787-2034809 ACAGGAGTCCAGTTCGGGAGGGG - Intronic
1134379251 16:13709028-13709050 GCTGGAGTCCAGCTAGTGGGGGG + Intergenic
1134648859 16:15892486-15892508 ATTAGAGTCCTGCTTGGGGCAGG - Intergenic
1136478379 16:30526752-30526774 AGTGCAGCCCAGCCCGGGGCCGG - Intronic
1138525037 16:57600312-57600334 ACTGGAGCCCAGAGAGGGGCAGG - Intergenic
1138651508 16:58463884-58463906 GCTGGGGTCGTGCTCGGGGCTGG - Intronic
1141648112 16:85378137-85378159 AGTGGGGGCCAGCTTGGGGCAGG + Intergenic
1143500371 17:7335318-7335340 AGTGGTGTCCAGCTGGTGGCTGG + Intergenic
1144344749 17:14339768-14339790 TCTGGAGGCCAGCCTGGGGCTGG + Intronic
1144966379 17:19079175-19079197 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1144981539 17:19172882-19172904 CCTGGAGTCCAGCTGGGCACGGG - Intergenic
1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG + Intergenic
1147171275 17:38620556-38620578 ACTGGAGTCCAGCCACGGCCTGG - Intergenic
1148511391 17:48173140-48173162 ACTGCAGTCCAGCCTGGGCCTGG + Intronic
1150108697 17:62479377-62479399 ACCTGGGCCCAGCTCGGGGCCGG + Intronic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1158436913 18:57440480-57440502 ACTGGAGACCAGCTCCGGGCAGG - Intronic
1158488852 18:57892211-57892233 ACTGGAGCCTAGCTGGAGGCTGG - Intergenic
1159010760 18:63057173-63057195 CCTGGAGTCCAGGTCAGGGTTGG + Intergenic
1160596100 18:79975502-79975524 AGTGGAGGCCAGCCTGGGGCTGG - Intronic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161586921 19:5110755-5110777 CCAGGAGCTCAGCTCGGGGCTGG - Exonic
1161977737 19:7615621-7615643 CCGGGGGTCCAGGTCGGGGCGGG + Exonic
1162449677 19:10747341-10747363 ACTGGATTCCAGCCAGGGCCTGG + Intronic
1163125801 19:15243558-15243580 ACTGGAGTCCAGATGAGGTCAGG - Intronic
1163468985 19:17486152-17486174 ACAGCTGCCCAGCTCGGGGCTGG + Intronic
1164605673 19:29596196-29596218 AATGGAGTCGCGCTGGGGGCAGG - Intergenic
1165230068 19:34381267-34381289 TCTGGTGTCCAGCTTGGGGTGGG + Intronic
1166764698 19:45245685-45245707 GCTGGAGAGCAGCTCTGGGCTGG - Intronic
1167506237 19:49872606-49872628 ACTGGAGTCCCGGTGGGGGTTGG - Intronic
1168172426 19:54597390-54597412 CCTGGAATCCTGCTCGGGGAGGG - Intronic
1168241850 19:55092611-55092633 CCAGGAGTCCAGGTAGGGGCGGG - Exonic
1168246944 19:55117253-55117275 GGTGGAGTCCAGCACGGCGCGGG + Exonic
1168405548 19:56108425-56108447 ACTGGAGGAGAGCTCTGGGCAGG - Intronic
932467830 2:71934907-71934929 ACAGGACTCCTGCTGGGGGCAGG - Intergenic
944563383 2:200963640-200963662 ACCGGAGGCCAGCTGGGGGATGG + Exonic
944681681 2:202083378-202083400 ACTGGAGTAGAGGTCGGGGCAGG - Intronic
947346052 2:229190335-229190357 CCTGGGGTATAGCTCGGGGCTGG - Intronic
948438179 2:237967589-237967611 ACTGGACTCCCGATCGGGGCAGG + Intronic
948784714 2:240346333-240346355 ACTCGAGTCCAGAGCAGGGCTGG + Intergenic
948889885 2:240902384-240902406 ACAGGAGGCCAGCTGAGGGCAGG - Intergenic
1169030395 20:2402359-2402381 GCTGGAGGCCAGCTCGGGAAGGG - Intronic
1169113834 20:3049838-3049860 ACTGCTGTCCAGCATGGGGCTGG + Intergenic
1169405268 20:5316750-5316772 GGCGGAGTCCAGCGCGGGGCGGG - Intergenic
1170185348 20:13583307-13583329 ACTGTAGACCAGCTCTGGCCTGG + Intronic
1170794988 20:19539351-19539373 GCTGGATTTCAGCTGGGGGCAGG + Intronic
1172838630 20:37888660-37888682 GCTGGACTCCAGCTCAGGGATGG - Intergenic
1173405395 20:42759995-42760017 ACTGGAGTCAAGCTCCAGCCTGG + Intronic
1175898609 20:62351191-62351213 ACTGGAGTGAAGGTCAGGGCTGG + Intronic
1175946584 20:62561878-62561900 ACTGGAGTCAAGAGAGGGGCAGG + Intronic
1180143835 21:45908985-45909007 GCTGGAGACTAGCTGGGGGCTGG - Intronic
1180878130 22:19184810-19184832 CCTGGAGCCCAGCTCGAGTCAGG + Intronic
1180940735 22:19658321-19658343 ACTGGAGTCCACCTGGGAACTGG + Intergenic
1180955847 22:19740869-19740891 ACTGCAGTCCAGGGAGGGGCAGG - Intergenic
1181067053 22:20311747-20311769 ACTGGAGCCCAGCCCAGGGATGG + Intergenic
1182033544 22:27179752-27179774 GCTGGAGTCTAGCTCCAGGCTGG + Intergenic
1183466871 22:37984402-37984424 TGTGCGGTCCAGCTCGGGGCTGG + Exonic
1183679997 22:39322616-39322638 ACTGGAGGCCTGCTCTGTGCCGG + Intergenic
1183731144 22:39619255-39619277 GCTGGAGGCCAGCTGGGGCCAGG - Intronic
1184219364 22:43089411-43089433 AGTAGAGTGCAGCGCGGGGCGGG - Exonic
1184226011 22:43129175-43129197 AGAGGAGTCAGGCTCGGGGCAGG - Intronic
1184257089 22:43293499-43293521 ACTGGACTCCAGCTCGTGTGAGG - Intronic
1184841067 22:47052679-47052701 ACAGGAGTCCTGCTCAGGACAGG - Intronic
1184877054 22:47282661-47282683 CCTGGTGCCCAGCTCAGGGCAGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950950821 3:16996388-16996410 ACAGGTGTCCAGCTGGAGGCTGG - Intronic
955756973 3:62234938-62234960 ACTTGAGACCATCTCGGGGGGGG - Intronic
961276427 3:125730866-125730888 ACTGGTGTCCGGCTCGGGGACGG - Intergenic
961441832 3:126958004-126958026 CCTGTAGACCAGCTCAGGGCAGG - Intronic
966969416 3:185029394-185029416 ACTTGAATCCAGCTCTTGGCAGG - Intronic
968817279 4:2828635-2828657 ACTGGGCTGCAGCTCAGGGCTGG - Intronic
968885999 4:3332744-3332766 ACAGGAGTCATGCCCGGGGCAGG - Intronic
969023068 4:4151090-4151112 ACTGGTGTCGGGCTCGGGGACGG + Intergenic
969167388 4:5328909-5328931 TCTGAAGTCCAGCTGGTGGCCGG + Intronic
969363956 4:6683094-6683116 CCTGGAGCCCAGCTCAGGACAGG - Intergenic
969730737 4:8955993-8956015 ACTGGTGTCGGGCTCGGGGACGG - Intergenic
970075227 4:12210802-12210824 ACTGGAGTCAGAGTCGGGGCAGG + Intergenic
972317963 4:37945029-37945051 AGTAGAGTCCAGCTCTGGACTGG + Intronic
983989261 4:174097748-174097770 ACTGGAGTGCAGTGCGGGGATGG - Intergenic
990910006 5:60843770-60843792 ACTGGGGTCCCGCGCGGCGCTGG - Intronic
992153128 5:73926098-73926120 CCTGGTGTCCAGCCCAGGGCAGG + Intronic
995450178 5:112291547-112291569 ATTAGAGTCCTGCTAGGGGCAGG - Intronic
995552303 5:113293731-113293753 TCAGGAGTCCAGATCCGGGCAGG + Intronic
997270081 5:132529113-132529135 ACTGGGATCCAGCTGGGGCCTGG - Intergenic
998394733 5:141811494-141811516 AGTGGAGTCCAGGTTGGGGATGG - Intergenic
999130444 5:149278940-149278962 ACTGGAGGCCAAATCGTGGCTGG - Intronic
1000719616 5:164690934-164690956 AATGCAGTCCAGCTCGGGCACGG + Intergenic
1001419189 5:171573929-171573951 GCTGGCGGCCAGGTCGGGGCGGG + Intergenic
1001982412 5:176046253-176046275 ACTGGAGTCCACCTGGGAACTGG - Intergenic
1002044468 5:176534146-176534168 CCTTGTGTCCAGCTCAGGGCAGG + Intronic
1002167353 5:177356634-177356656 ACTGGAGTTCATCTGGGGCCAGG + Intergenic
1002235049 5:177797804-177797826 ACTGGAGTCCACCTGGGAACTGG + Intergenic
1002330039 5:178434819-178434841 ATGGGATTCCAGCTCAGGGCTGG + Intronic
1002594177 5:180311604-180311626 GCTGGTGTCCAGCACAGGGCAGG - Intronic
1005391244 6:25335788-25335810 TCTGGATGCCAGCACGGGGCAGG - Intronic
1005578338 6:27210634-27210656 ACTGCACTCCAGCCTGGGGCTGG + Intergenic
1011381465 6:86746404-86746426 TCTGGAGCCCAGATCGGGGCAGG - Intergenic
1017815961 6:158016918-158016940 TCTGGCGTCCAGCTGGGGGCAGG - Intronic
1019608722 7:1924251-1924273 ACAGGAGTCCTTCTCGCGGCAGG + Intronic
1024746501 7:52413064-52413086 ACGTGAGGCAAGCTCGGGGCAGG + Intergenic
1029733450 7:102452473-102452495 ACTGCACTCCAGCTCTGGCCTGG - Exonic
1032217471 7:129968860-129968882 CCTGGAGTCCAGTTTGGTGCTGG - Intergenic
1032406457 7:131659466-131659488 TCTGGAGTGCAGCCTGGGGCTGG - Intergenic
1033797618 7:144866353-144866375 ACTGGACTCCAGCTCTAGACAGG - Intergenic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1036210380 8:6835705-6835727 GGTGGAGTCCAGCTCAGGTCCGG + Intergenic
1036225978 8:6958002-6958024 ACTGGACTCCCCCTCTGGGCCGG + Intergenic
1037686978 8:21149138-21149160 AGTGGTGTCCAGCTGGGGGTAGG - Intergenic
1037705070 8:21311238-21311260 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705094 8:21311326-21311348 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705149 8:21311543-21311565 ACTGAAATCCAGTCCGGGGCTGG + Intergenic
1037705192 8:21311719-21311741 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705251 8:21311977-21311999 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705401 8:21312611-21312633 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705435 8:21312743-21312765 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705447 8:21312786-21312808 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705460 8:21312830-21312852 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705496 8:21312961-21312983 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705582 8:21313311-21313333 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1037705609 8:21313399-21313421 ACTGGGATCCAGTCCGGGGCTGG + Intergenic
1039842996 8:41307030-41307052 AATGGACTCCAGGTCAGGGCTGG + Intronic
1041786484 8:61639816-61639838 ACTGGAGTCAAGCACGGGGCAGG - Intronic
1042532780 8:69832639-69832661 ACTGGACTGCAGCCCGGGGCGGG - Exonic
1044685725 8:94823675-94823697 ACAGGAGCCCAGCTCCGGCCGGG + Intronic
1045054688 8:98358912-98358934 GCTGCAGTCCAGCTCAGGGGTGG - Intergenic
1048207275 8:132425157-132425179 ATTGGCGTCCAGTTGGGGGCAGG - Intronic
1049494824 8:142924753-142924775 ACTGGAACTCAGCCCGGGGCAGG - Intergenic
1049579397 8:143404546-143404568 ACGGGAGTCCAGGTCCAGGCTGG + Intergenic
1055404287 9:75958348-75958370 AATGGAGTGCAGCTCAGGGGAGG + Intronic
1057079039 9:92158618-92158640 ACTGGAGTCCAGCCCGAGCATGG - Intergenic
1060155628 9:121318217-121318239 CCTGGTGTCCAGCCTGGGGCTGG - Intronic
1061051579 9:128199328-128199350 ACTGCACTCCAGCTTGGAGCTGG + Intronic
1061966206 9:134014746-134014768 ACTGCACTCCAGCTTGGGGGAGG - Intergenic
1061998598 9:134204191-134204213 ACTGGAGTCCAGTGCGGGCCAGG - Intergenic
1062041537 9:134406634-134406656 CCCGGAGCCCAGCACGGGGCAGG + Intronic
1062253288 9:135608865-135608887 CCTGGTGTCCAGCCCGTGGCAGG - Intergenic
1185449657 X:275572-275594 CCTGGAGTCCAGCCCGGGGTGGG + Intergenic
1186609282 X:11123462-11123484 ACTGGGGCCCGTCTCGGGGCCGG + Intergenic
1187388741 X:18872089-18872111 TTTGGAGGCCAGCTGGGGGCAGG - Intergenic
1190726408 X:53193291-53193313 ACGGGAGTCGGGCTCGGGGCCGG - Exonic
1199822649 X:151464541-151464563 ACTGAAATCCAGCTATGGGCTGG + Intergenic