ID: 1157223942

View in Genome Browser
Species Human (GRCh38)
Location 18:45846190-45846212
Sequence CAGGGGGCCCAGAAACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157223942_1157223956 21 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223956 18:45846234-45846256 ATCCCAGTGGAGGTCAGGGGCGG No data
1157223942_1157223953 16 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223953 18:45846229-45846251 GTAAGATCCCAGTGGAGGTCAGG No data
1157223942_1157223954 17 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223954 18:45846230-45846252 TAAGATCCCAGTGGAGGTCAGGG No data
1157223942_1157223959 24 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223959 18:45846237-45846259 CCAGTGGAGGTCAGGGGCGGTGG No data
1157223942_1157223955 18 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223955 18:45846231-45846253 AAGATCCCAGTGGAGGTCAGGGG No data
1157223942_1157223950 11 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223950 18:45846224-45846246 GCCCTGTAAGATCCCAGTGGAGG No data
1157223942_1157223949 8 Left 1157223942 18:45846190-45846212 CCCTCATGTTTCTGGGCCCCCTG No data
Right 1157223949 18:45846221-45846243 AAAGCCCTGTAAGATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157223942 Original CRISPR CAGGGGGCCCAGAAACATGA GGG (reversed) Intergenic
No off target data available for this crispr