ID: 1157224267

View in Genome Browser
Species Human (GRCh38)
Location 18:45848675-45848697
Sequence GCCCTGGCCCTGCTAATCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157224256_1157224267 21 Left 1157224256 18:45848631-45848653 CCAACTTAAATGTATGCCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 134
1157224258_1157224267 5 Left 1157224258 18:45848647-45848669 CCCCAGGTGCCTCATTTGTCTCA 0: 1
1: 0
2: 3
3: 47
4: 505
Right 1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 134
1157224260_1157224267 3 Left 1157224260 18:45848649-45848671 CCAGGTGCCTCATTTGTCTCACC 0: 1
1: 0
2: 0
3: 31
4: 354
Right 1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 134
1157224261_1157224267 -4 Left 1157224261 18:45848656-45848678 CCTCATTTGTCTCACCCTAGCCC 0: 1
1: 0
2: 7
3: 52
4: 282
Right 1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 134
1157224259_1157224267 4 Left 1157224259 18:45848648-45848670 CCCAGGTGCCTCATTTGTCTCAC 0: 1
1: 0
2: 8
3: 39
4: 221
Right 1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157224267 Original CRISPR GCCCTGGCCCTGCTAATCCG GGG Exonic
900148832 1:1169542-1169564 GCCCTGGCCCTCCTCCTCCAGGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
903929142 1:26852410-26852432 GCCCCGGCCCTGCTACTCACTGG - Intronic
910846224 1:91606843-91606865 GCCATGCCCCTGGTAATCCTTGG + Intergenic
912702603 1:111889279-111889301 CCCCTGGCCCTGCTAAAGCAGGG + Intronic
915356185 1:155256236-155256258 GCCCTGGCCCTGCTACTTGAGGG - Exonic
916581141 1:166110306-166110328 GCCCTGATCCTGCTATTCCCTGG + Intronic
918074122 1:181156749-181156771 GCCCTCGCCCTGCGAAGCCATGG - Intergenic
924510436 1:244725274-244725296 GCCCCAGTCCTGCTAGTCCGAGG + Intergenic
1062891402 10:1063465-1063487 ACCCTCACCCTGCTAATCAGAGG + Intronic
1064338049 10:14461388-14461410 GCCCTGGCCCAGCTAGTTCCTGG + Intronic
1071483894 10:86085304-86085326 GCCCTGCCACTGCCATTCCGTGG + Intronic
1075675059 10:124290478-124290500 CCCCTGGCCCTGCTACTTCCTGG - Intergenic
1079159420 11:17978346-17978368 GCCCTGGGCCTGCCCATCTGTGG + Intronic
1079187137 11:18247855-18247877 GCCCTGGACCTGATAAACTGGGG - Intronic
1081838389 11:46176619-46176641 GCCCTGGCTCTGTTACTCCCTGG + Intergenic
1083319772 11:61838581-61838603 GCCCTGGCTCTGCTAAACAGAGG - Intronic
1086927900 11:92660427-92660449 GCCCAGCCCCTGCTGATCCCTGG - Intronic
1087022105 11:93613635-93613657 GCCCTTGCCCTACTAATCAGGGG - Intergenic
1087048796 11:93866401-93866423 GCCCTTACCCTGCAAACCCGAGG - Intergenic
1087177571 11:95109532-95109554 GCCCTGGCCCTTCAATTCAGTGG + Intronic
1092462487 12:8698386-8698408 GCCCAGCCCCCGCTAATCGGGGG - Intronic
1096792078 12:54051725-54051747 GCCCTGGCCCTGCTGAGCCTGGG + Intronic
1100294898 12:93251938-93251960 TTCCTGGCCCTGCTCATCCAAGG - Intergenic
1106543298 13:30709555-30709577 GCCCTGGTCCATCTAATCCCTGG - Intergenic
1107715611 13:43196428-43196450 CCCCGGTCCCTGCTAATCCCAGG - Intergenic
1114075475 14:19159126-19159148 ACCCTGGCCCTGCTTCTCTGTGG - Intergenic
1114086793 14:19240853-19240875 ACCCTGGCCCTGCTTCTCTGTGG + Intergenic
1115851259 14:37592061-37592083 GCCCTTGCCCGGCTTGTCCGGGG + Exonic
1119824054 14:77642284-77642306 GTCCTGGCCCCGCTCACCCGAGG + Intergenic
1122792346 14:104189326-104189348 GCCCAGGCCCAGTTAGTCCGAGG + Intergenic
1202898323 14_GL000194v1_random:22448-22470 GCCCAGGCCCTGCTTCTCTGTGG + Intergenic
1202899177 14_GL000194v1_random:25878-25900 ACCCAGGCCCCGCTTATCCGCGG + Intergenic
1128604752 15:69028293-69028315 GCACTGACCCTGCTCATCCATGG + Exonic
1129153190 15:73702166-73702188 TCCCTGCCCCTGCTAACCCCAGG - Intronic
1132678083 16:1128933-1128955 GCCCTGGCCTGGCTCATCGGGGG + Intergenic
1133051591 16:3120254-3120276 GCCCTGGCCATGCTGATGCTGGG + Exonic
1135404775 16:22190334-22190356 GCCCTGGCCCTGCACTTCCTAGG + Exonic
1136544644 16:30948471-30948493 GACCTGGCCCGGCTCATCCCCGG - Exonic
1138318785 16:56093409-56093431 GCCCTGGGCCTGAGAATCCTAGG + Intergenic
1141196872 16:81866863-81866885 GCCCTGGCCCAGCTGTTCCTTGG + Intronic
1141462040 16:84183462-84183484 GCCCGGGACCTGCTTTTCCGCGG - Exonic
1141701121 16:85642605-85642627 GCTCTGGCCCTGCTAAGCTCTGG + Intronic
1146911415 17:36650766-36650788 GCCCTGGCTCTGACAATCTGGGG + Intergenic
1148747353 17:49926142-49926164 ACCCTGGCCCTGCTGAGCCTGGG - Intergenic
1151264412 17:72943180-72943202 GCCCTGGGGTTGCTGATCCGGGG + Intronic
1154176369 18:12088881-12088903 GCCCTGGCCCTGCTCTGCTGTGG + Intergenic
1155297694 18:24400371-24400393 CCCCTGGCCCTGCCATTCCCGGG + Intergenic
1156453123 18:37277838-37277860 ACCCCGCCCCTGCTAATCCCTGG + Intronic
1157224267 18:45848675-45848697 GCCCTGGCCCTGCTAATCCGGGG + Exonic
1157291007 18:46409656-46409678 GCCATGCCCCTGCTACTCAGAGG - Intronic
1159228788 18:65577179-65577201 TCCCTGGCCCTGTTGATCCTTGG - Intergenic
1160523812 18:79524089-79524111 GCCCTGCCCTTGCTATTCCGGGG - Intronic
1160739676 19:680103-680125 GCCCTGCCCCTGGGAACCCGAGG + Intronic
1161811704 19:6475302-6475324 GCCCAGGCCCTGCTCTTCGGGGG - Exonic
1163410412 19:17150482-17150504 CCCCTGGCCCTGCCACTCCTTGG + Intronic
1164463028 19:28464577-28464599 GCCCTGGCCCTCCCCATCCCAGG - Intergenic
1164607403 19:29610137-29610159 GCTCTGGCCCTGCTTTTCTGAGG - Intronic
1165326762 19:35118625-35118647 GCCCTGGCTCTGCCTAGCCGGGG - Intronic
1167505657 19:49869832-49869854 TCCCGGGGCCTGCTAATCTGAGG - Exonic
1167797594 19:51719807-51719829 GCCTTCGCCCTGCTCATCCTGGG - Exonic
1202648268 1_KI270706v1_random:159783-159805 ACCCAGGCCCCGCTTATCCGCGG - Intergenic
925271755 2:2614767-2614789 GCCGTGGCCCTGCTGAACCCTGG - Intergenic
928413120 2:31069662-31069684 GCTCAGGCCCTGCTGCTCCGGGG - Intronic
933778682 2:85787063-85787085 GCCCTCACCCAGCCAATCCGAGG + Exonic
937405083 2:121620242-121620264 CCACTGGCCCTGCTAATTCTGGG - Intronic
941067396 2:160919039-160919061 GCCCTGGCCCTGCTACTCCCTGG - Intergenic
948909087 2:240994058-240994080 ACCCTGGCCCTGCTGGACCGTGG - Intergenic
1169289311 20:4335155-4335177 GCCCTGGCCCTTCTCAGCCAAGG + Intergenic
1171892518 20:30728896-30728918 GCCCTGGCCTTGCTGTTCCCAGG - Intergenic
1173258521 20:41412530-41412552 GCCAGGGCCCTGTTAATCCCTGG + Intronic
1175995086 20:62808410-62808432 GCCGTGGCCCTGGTAATCGCCGG - Intronic
1176603580 21:8812908-8812930 ACCCAGGCCCCGCTTATCCGAGG + Intergenic
1176618561 21:9040648-9040670 ACCCAGGCCCCGCTTATCCGCGG + Intergenic
1176706194 21:10121274-10121296 ACCCAGGCCCTGCTTCTCCGTGG - Intergenic
1178293499 21:31388932-31388954 GCACTGGCTCTGCTAAGCCAGGG + Intronic
1179612736 21:42563047-42563069 GCCCTGTCCCTGCTAGGCTGTGG - Intronic
1180158664 21:45989556-45989578 CCCCTGCCCCTGCTCCTCCGGGG + Intronic
1180291070 22:10851881-10851903 ACCCTGGCCCTGCTTCTCTGTGG - Intergenic
1180345865 22:11704465-11704487 ACCCAGGCCCCGCTTATCCGAGG + Intergenic
1180353632 22:11822710-11822732 ACCCAGGCCCCGCTTATCCGCGG + Intergenic
1180384610 22:12169648-12169670 ACCCAGGCCCCGCTTATCCGCGG - Intergenic
1180493873 22:15881303-15881325 ACCCTGGCCCTGCTTCTCTGTGG - Intergenic
1180717218 22:17879975-17879997 GACATGGCCTTGCTCATCCGAGG + Intronic
1182074778 22:27488140-27488162 GCCCAGGCCCTGCCACTCAGAGG - Intergenic
1182419592 22:30242446-30242468 GACCAGGCCCTGCTAAGCCCTGG + Exonic
1185113799 22:48919887-48919909 CCCCTGACCCTGCTCATGCGAGG + Intergenic
1185249733 22:49794416-49794438 GCCCAGGCCCTGCTCACCAGAGG + Intronic
950408787 3:12820876-12820898 ATCCTGGCCCTGCTATTCCCTGG + Intronic
952558219 3:34558078-34558100 GCCATGGCCCTGCCATTCCCTGG - Intergenic
954415495 3:50391348-50391370 GCCCTGGCCCAGCTCCTCCCTGG + Intronic
954461717 3:50630598-50630620 GACCAGGCCCTGCTACTCGGTGG - Intronic
961463982 3:127070464-127070486 TCCCTGGCCCTGCCACACCGTGG + Intergenic
961714977 3:128851947-128851969 GCCCTGGCCCTGGTCCTCCTTGG + Intergenic
972354472 4:38267521-38267543 GCCCTGGTGCTGCTAACCCCAGG - Intergenic
972670968 4:41214045-41214067 CCCCAGGCCCTGCCAAGCCGGGG + Intronic
980467599 4:133205061-133205083 GCACAGGCCCTGCTTATCCTGGG - Intronic
988919725 5:35929244-35929266 ACCCTGGCTCTGCTACTCCCTGG - Intronic
992866457 5:80961074-80961096 TCCCTTGCCGTCCTAATCCGGGG + Intronic
993913438 5:93711883-93711905 GCCCCGGCCCTGCTAGTCTGAGG + Intronic
1001492543 5:172165642-172165664 CCCCAGGCCCAGCTAATCAGAGG + Intronic
1001591461 5:172868294-172868316 CCCCTGGCTCTGAAAATCCGTGG + Intronic
1002109750 5:176900523-176900545 GCCCTGGCCATGCTTGTCAGGGG - Intergenic
1004767998 6:18753205-18753227 GCCATGTCCCTGGTAATCAGCGG + Intergenic
1006185869 6:32181423-32181445 GCCCTGGCCCTGGGGATCCTGGG - Exonic
1006932702 6:37697382-37697404 GGCCCGGCCCTCCTGATCCGGGG + Exonic
1010527108 6:76914889-76914911 ACCCTGGCTCTGCTATTCAGTGG + Intergenic
1018864661 6:167737274-167737296 GCCCTGGCCCTGCAACCCCACGG - Intergenic
1019061215 6:169259510-169259532 GCCCTGGCCCTGGGAATTCTGGG - Intergenic
1021801602 7:24312512-24312534 GCCATGGTCCTGCTAATGCTTGG - Intergenic
1021934363 7:25615272-25615294 GCCCTGGCCCTGGTGTCCCGTGG - Intergenic
1022382642 7:29874730-29874752 TCCCTGGCTCTACTAACCCGTGG + Intronic
1023563035 7:41495728-41495750 ACCCTGGCCCTGCTGCTCGGTGG - Intergenic
1024473772 7:49789892-49789914 GCACTGGCCCTGGTGCTCCGGGG + Intronic
1024633883 7:51271040-51271062 GCACAGGCCCTGCTACTCCCAGG + Intronic
1032451354 7:132034702-132034724 GCCCTGGTCCTGATGATCTGGGG + Intergenic
1034222733 7:149459248-149459270 GCCCTGGCCGTGCTAGTGAGAGG - Intronic
1035203858 7:157282160-157282182 GCCCTAGCCCTGCAAATGCCAGG - Intergenic
1035653950 8:1291550-1291572 GCCCTGCCATTCCTAATCCGGGG + Intergenic
1037802037 8:22041159-22041181 GCCCTGGCCTTGCTTACCTGGGG - Intergenic
1037920144 8:22800245-22800267 GCCCTGGGCCTGCTAACCATAGG + Intronic
1038491954 8:27977736-27977758 GCCCTGGCTCTCCTGATCCCCGG + Intronic
1049429062 8:142550841-142550863 TCCCTGACCCTGCTAAGCTGAGG + Intergenic
1050681568 9:8117561-8117583 ACCCTGGGGCTGCTAATGCGAGG - Intergenic
1053198644 9:36137944-36137966 GCCCTGGCCCAGCCAATCACTGG + Intronic
1053643479 9:40108391-40108413 ACCCAGGCCCTGCTTCTCCGTGG - Intergenic
1054324334 9:63705619-63705641 ACCCAGGCCCTGCTTCTCCGTGG - Intergenic
1054356302 9:64066840-64066862 GCCCTGGCCTTGCTGTTCCCAGG + Intergenic
1054541273 9:66268213-66268235 ACCCAGGCCCTGCTTCTCCGTGG + Intergenic
1060519942 9:124288615-124288637 ACCCGGGCCCTGATAATCCTGGG + Intronic
1062262060 9:135667717-135667739 GCCTTGGCTCTGCTCCTCCGAGG - Intergenic
1062309710 9:135929247-135929269 GCCCTGGCCCTGCCAGCCCTGGG + Intergenic
1062459441 9:136656758-136656780 GCCCTGGCCCTGCGAAGTGGAGG - Intergenic
1202791229 9_KI270719v1_random:91362-91384 ACCCAGGCCCTGCTTCTCCGTGG - Intergenic
1195967622 X:110443047-110443069 CTCCTGGTCCTGCTTATCCGGGG - Intronic
1198710188 X:139493065-139493087 GCCCTGGTGCTGCTGATCTGGGG + Intergenic
1199826325 X:151504143-151504165 GCCCTGGCTCTGCCATTCAGTGG + Intergenic
1200829786 Y:7679122-7679144 GCCCTGGCCCTGGTACACCCCGG + Intergenic
1201151497 Y:11097693-11097715 ACCCAGGCCCCGCTACTCCGTGG + Intergenic
1201152059 Y:11099921-11099943 GCCCATGCCCTGCTTCTCCGTGG + Intergenic
1201329797 Y:12805396-12805418 GCTCTGGCCCTTTTAATCCCTGG + Intronic