ID: 1157226156

View in Genome Browser
Species Human (GRCh38)
Location 18:45866546-45866568
Sequence GAGGGCTGCCAGCAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157226156 Original CRISPR GAGGGCTGCCAGCAAGCTGC TGG (reversed) Intronic
900184168 1:1325185-1325207 GGGGGCTGACAGCAGGCTGGGGG - Intronic
900408157 1:2501447-2501469 GGGGGCAGCAAGCCAGCTGCGGG + Intronic
901024796 1:6273523-6273545 GTGGGCTGGCAGCAAGGTGGGGG + Intronic
901234815 1:7662052-7662074 GCGGACTGCCAGCCAGTTGCAGG - Intronic
901791881 1:11658160-11658182 GAGGGCAGCCGCCAAGATGCAGG + Intronic
901941171 1:12663070-12663092 AAGGGCTTCCAGGAGGCTGCAGG + Intronic
902286487 1:15411131-15411153 GAGCGGTGACTGCAAGCTGCTGG - Intronic
903009440 1:20319605-20319627 GAGGTCATCCAGCAAGCTGGAGG + Intronic
904002892 1:27348927-27348949 CAGGGCTGGCAGCCAGCTGCAGG - Intronic
904418594 1:30377413-30377435 GAGGGCCTCCAGGAACCTGCTGG - Intergenic
904830532 1:33303703-33303725 GAGGGGTTCCAGGAAGCTGCAGG - Intergenic
905010847 1:34746130-34746152 GCAGGCTGCCAGAAACCTGCTGG + Intronic
905971227 1:42144009-42144031 GGAGGCTGCCAGCAAGCTCTGGG + Intergenic
906513483 1:46424510-46424532 GGGGTCTCCCAGGAAGCTGCAGG + Intergenic
913115393 1:115692094-115692116 CAGGGCTGCCAGCCAGGTGGGGG - Exonic
913320897 1:117587713-117587735 GGGGGCTGCCAGCAGGATGTGGG + Intergenic
914361347 1:146938760-146938782 GCGGGCCGCAAGCAAGTTGCTGG + Exonic
914491263 1:148151950-148151972 GCGGGCCGCAAGCAAGTTGCTGG - Exonic
914746404 1:150504703-150504725 GAGTGCTGGCAGAAAGCTGCGGG + Exonic
923337544 1:232983535-232983557 GTGGGCCGCCAGCACCCTGCGGG - Exonic
924443068 1:244102846-244102868 GAGGGCTGGCAGCTAACTCCTGG - Intergenic
924606617 1:245540908-245540930 GAGGGCTGTCAACAAGGTGAAGG + Exonic
1063379376 10:5574828-5574850 GATGACTGCCAGAAAGCAGCAGG - Intergenic
1065173761 10:23057144-23057166 GAGGGCTGCTGGCAAACTACTGG + Intergenic
1065244656 10:23744858-23744880 GAATTCTGCCAGCAAGCAGCTGG - Intronic
1069076026 10:64039306-64039328 GAGGAGGGCCAGCAAGGTGCAGG - Intergenic
1069528899 10:69200373-69200395 CAGCTCTGCCAGCAATCTGCAGG - Exonic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070814017 10:79312150-79312172 GATGGCTGCCAGCCAGCCACAGG + Intronic
1072611642 10:97021097-97021119 GAAGGCAGCCATCAAGCCGCAGG + Intronic
1075054198 10:119206299-119206321 CAGGGCTGCCAGGAAGTCGCAGG - Intergenic
1075894580 10:125983899-125983921 GAGGCCAGGCAGCAAGCAGCAGG + Intronic
1077192365 11:1260787-1260809 GCAGGCTGCCAGCCAGCTGACGG - Intronic
1077244949 11:1532229-1532251 GAGGGCTGGCCGCAGGCTGTGGG + Intergenic
1078933706 11:15934372-15934394 GAGGGCACACAGCAAGCTGAAGG + Intergenic
1079876359 11:25862248-25862270 GAGTTCTGCCAGCAAGGTGATGG + Intergenic
1081687253 11:45051707-45051729 GATGGCTCCCAGCACGCTCCTGG - Intergenic
1081758828 11:45562885-45562907 GAGGTCACCCAGCAAGCTGAAGG - Intergenic
1082836160 11:57651767-57651789 GTAGGCTGCCTGCAAGCTGAGGG - Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083928201 11:65822014-65822036 CAGAGCTGCCAGCAAAGTGCAGG - Intergenic
1085238448 11:75032730-75032752 GAGGGCTCCCAGCTAGGAGCTGG - Intergenic
1085445185 11:76596761-76596783 GAGGACTGCCAGCGAGCACCAGG + Intergenic
1087630733 11:100647658-100647680 GAGGGCTGCCAGTAAAATGGGGG + Intergenic
1088859210 11:113784140-113784162 GAGGGCTGCAAGCCACCAGCAGG - Intergenic
1089216561 11:116837782-116837804 GTGGGCAAACAGCAAGCTGCGGG + Exonic
1089615326 11:119691804-119691826 GAGGGCTCCCAGAAAACTCCTGG - Intronic
1090125035 11:124076038-124076060 CAGGGCTGTCTGCAAGCTCCAGG - Intergenic
1090865404 11:130696338-130696360 GATGACTGACTGCAAGCTGCAGG + Intronic
1091979110 12:4851213-4851235 GAGGATGCCCAGCAAGCTGCAGG - Intronic
1092008343 12:5088207-5088229 GTGGCCTGCCAGCAGCCTGCAGG - Intergenic
1092913104 12:13165551-13165573 CAGGGCTGCCATCCAACTGCTGG - Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1096218131 12:49809575-49809597 GAGGGATTCCAGAAAGCAGCTGG - Intronic
1096623733 12:52880203-52880225 GCAGGCTGACAGCAGGCTGCAGG + Intergenic
1096656944 12:53097880-53097902 GAGGGCTGCGCGGAAGCTGAGGG + Exonic
1098704107 12:73665362-73665384 GCGGGGTGCCAGCAAGCACCGGG - Intergenic
1100583383 12:95956813-95956835 GAGGGCTGGCACCACGCTGGTGG + Exonic
1101748135 12:107559597-107559619 GACAGCTGCCAGCACGCAGCTGG + Intronic
1102171287 12:110844458-110844480 GAGGGCTGTCAGCAACATGAGGG + Intergenic
1102433057 12:112898552-112898574 GATGGCAGCCAGGAAGCTGTTGG - Exonic
1103081398 12:118026825-118026847 CACAGCTGCCACCAAGCTGCAGG - Intronic
1103318001 12:120072656-120072678 GAGGGCAGTGCGCAAGCTGCCGG - Exonic
1105543050 13:21331280-21331302 GAGGGCTGCCCTCATGCTTCTGG - Intergenic
1105912749 13:24886339-24886361 GTGGTCAGCCAACAAGCTGCTGG + Intronic
1106182568 13:27381472-27381494 GAGGCCTTCTAGCCAGCTGCTGG - Intergenic
1107410490 13:40153505-40153527 GAGTGCTGTCAGCCAGCAGCAGG + Intergenic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1114184596 14:20390949-20390971 GAAGACTGCCATCAAGCTCCAGG - Exonic
1116786706 14:49296127-49296149 GCAGGCTGCCCGCAGGCTGCAGG + Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1118318195 14:64738151-64738173 GAGGGCGGCCAGCAGGGAGCTGG - Intronic
1118599230 14:67459805-67459827 CAGGGCTGCCAGCCAGCTGGGGG + Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1120657234 14:87206377-87206399 GATGGCTGCCAGCAATTTTCAGG - Intergenic
1121546752 14:94768825-94768847 GATGGCGGCCCGCAGGCTGCTGG - Intronic
1121745154 14:96283184-96283206 GAGATCTGTCAGCAAGTTGCAGG - Exonic
1122060889 14:99136087-99136109 GTGGGCTGCCAGCCACCTCCTGG - Intergenic
1122346551 14:101064594-101064616 GCGGGCAGCCAGCAAGCATCGGG - Intergenic
1122849964 14:104522789-104522811 GAGGGAGGCCAGCACACTGCAGG - Intronic
1124214712 15:27796895-27796917 GAGGGTTGCCAGAGAGCTCCAGG - Intronic
1125325992 15:38536310-38536332 GAGAGCTGCCAGCAGCTTGCTGG + Intronic
1126856100 15:52840912-52840934 GAGAGCTGCCAGGAATCTGAGGG + Intergenic
1127292332 15:57581729-57581751 GTGGGCTACCAGGGAGCTGCGGG - Intergenic
1128145770 15:65331770-65331792 GAGGTCTCCCAGCAAGTTGGTGG + Intronic
1129297373 15:74607208-74607230 GAAGGCAGCCACCAAGCTGGAGG + Intronic
1129794526 15:78366100-78366122 GAGGACTGCCAGCTAGCTGAGGG - Intergenic
1129831672 15:78675005-78675027 GAGGTCTGACATCAAGGTGCTGG - Intronic
1130859364 15:87873073-87873095 GAGAGCTGTCAGCCAGCTTCTGG - Intronic
1130934182 15:88454984-88455006 GTTGGCTGCCAGCAAGCTTCTGG + Intergenic
1131012052 15:89026320-89026342 AAGAGCTGCCAGCAAGAAGCTGG - Intergenic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1131694101 15:94856507-94856529 GAAGGCTGCGCGCAGGCTGCGGG + Intergenic
1132032709 15:98451513-98451535 GAGAGCTGCCGCCAGGCTGCGGG - Intronic
1134021147 16:10922440-10922462 GAAGGCTGGCAGCGAGCTGCTGG - Exonic
1134259197 16:12637266-12637288 GTGGGCTGCCTGGAAGCTGGAGG - Intergenic
1135196531 16:20399438-20399460 CAGGGCTGCTGCCAAGCTGCAGG - Intronic
1135977812 16:27122399-27122421 AAGAGCCCCCAGCAAGCTGCTGG + Intergenic
1136117080 16:28101323-28101345 GTGAGCTGCCGCCAAGCTGCAGG + Intronic
1136515253 16:30764427-30764449 AAGGGGTGCCATCAAGATGCAGG - Intronic
1138718699 16:59053462-59053484 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1139374273 16:66487063-66487085 GAGGGGCCCCAGCCAGCTGCAGG + Intronic
1140106802 16:71968096-71968118 CAGGGCTGCCAGACACCTGCCGG - Intronic
1141184047 16:81774493-81774515 GAGGCCTGCCAGCCAGCAGCTGG + Intronic
1141560527 16:84864803-84864825 GACAGTTGCGAGCAAGCTGCTGG + Intronic
1142093622 16:88227805-88227827 GAGGGCTGGCATCAAGGAGCCGG + Intergenic
1142278201 16:89133900-89133922 GGGGGCTGCCAGCAGGCTCCAGG - Intronic
1143335092 17:6166085-6166107 GAGGGCTGTCCTCAGGCTGCTGG + Intergenic
1143736435 17:8914847-8914869 GAGGGCTGCCAGCAGCATGAGGG + Intronic
1144026259 17:11278660-11278682 GTGGGCCGCCAGCTAGCAGCTGG + Intronic
1144451477 17:15383455-15383477 GAGAGCTGCGGGCAGGCTGCTGG - Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1144763712 17:17721867-17721889 GAGGGCTGCTACCAGGCTTCAGG + Intronic
1144866390 17:18338348-18338370 GGGGGCTGCCCCCAACCTGCCGG - Intronic
1145865881 17:28241263-28241285 GACGGCTGCCAGCTTGCTGGAGG + Intergenic
1146285025 17:31568533-31568555 GAAAGCTGCCCGCAAGCTCCAGG - Intergenic
1147597233 17:41724997-41725019 GGGGGCTGCCAAGAAGGTGCCGG - Exonic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1147877902 17:43634547-43634569 GCAGCCTCCCAGCAAGCTGCAGG - Intergenic
1147926112 17:43946981-43947003 GACGGCTGCCAGCTTGCTGCAGG - Intergenic
1148073429 17:44921746-44921768 GAGGGCTGCATGCGAGCTGTGGG + Intergenic
1149468517 17:56898036-56898058 GAGGGCTGGCTGCACACTGCTGG - Intronic
1150000931 17:61439285-61439307 GAGTGATGACAGCAAGCTGGTGG - Intergenic
1150217774 17:63479825-63479847 GAGGGCTGGCACAACGCTGCGGG + Intergenic
1150337658 17:64342313-64342335 GAGTGGGGCCAGCAAGCTGGAGG - Intronic
1150425604 17:65074748-65074770 GGGGGCTGCCTGCACACTGCTGG - Intergenic
1151351329 17:73533729-73533751 GAGAGCTGCAAGAAAGGTGCTGG - Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151829297 17:76540271-76540293 CTGGGCTGCCACCAAGCTGAAGG + Intronic
1152057423 17:78040953-78040975 GGGAGCTGCCAGGAAGCTCCCGG - Intronic
1152433436 17:80261458-80261480 GATGGCTGCCTGCAAGCCGGCGG + Intronic
1153489237 18:5630409-5630431 GCGGGCTGCGAACAAGCTCCGGG - Intronic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157799204 18:50605331-50605353 GAGGGCTCCCAGGAAGATTCAGG + Intronic
1158434960 18:57428848-57428870 GAGGGCTGCGAGAAACCTGTTGG - Intergenic
1159973218 18:74678485-74678507 GAGGACAGCCAGCAGGCTGATGG - Intronic
1160009825 18:75098075-75098097 GGGGGCTGCCACTCAGCTGCTGG + Intergenic
1160672359 19:371900-371922 GAGTGCTGCCAGCCAGATGGCGG + Intronic
1161769220 19:6222369-6222391 CCGGGCTTCCAGCAAGCGGCCGG - Exonic
1162906227 19:13825716-13825738 GAGGGCTGCCAGGTGGATGCGGG + Intronic
1163309443 19:16504469-16504491 CAGGGCAGCCAGCCAGCTGGGGG - Intronic
1163373367 19:16914875-16914897 GAGGGATTGCAGCAAGCTCCTGG + Intronic
1163710295 19:18842614-18842636 GATGACTGCCAAGAAGCTGCAGG - Intronic
1164583011 19:29446586-29446608 AATGGCTGCCAGCAGGCAGCAGG - Intergenic
1164748723 19:30635552-30635574 AAGGGCTGCCTGCAAGGTGCAGG + Intronic
1165105964 19:33469876-33469898 GAGGGCTGGCAGCATGATGGGGG - Intronic
1165325105 19:35109904-35109926 CCCGGCTGCCAGCAGGCTGCTGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG + Intronic
1167233302 19:48298377-48298399 GAGGGCTGGCACCCAGCTGGCGG - Intronic
1167611905 19:50511758-50511780 GGGAGCTGGCAGCAGGCTGCGGG + Exonic
925389924 2:3487669-3487691 GAAGGCTGCACGCGAGCTGCAGG + Intergenic
925429607 2:3779798-3779820 GGTGGCAGCCAGGAAGCTGCAGG - Intronic
925440740 2:3883214-3883236 GAGAGCCCCCAGGAAGCTGCTGG + Intergenic
926003293 2:9351754-9351776 CAGCGCTCCCAGCAAACTGCGGG + Intronic
926155095 2:10448950-10448972 GGGGGTCGCCAGCACGCTGCGGG + Intergenic
927327358 2:21820462-21820484 GAAGGCAGCCAGCCATCTGCAGG - Intergenic
929820851 2:45272250-45272272 GAGGGCAGGGAGCAAGCTTCAGG + Intergenic
930237656 2:48903280-48903302 GAGGGATGCCAGTAAGAGGCTGG - Intergenic
930858468 2:56044323-56044345 GAGGGTTCCCAGTAAGCTCCTGG + Intergenic
932490449 2:72116530-72116552 CAGGACTTCCAGAAAGCTGCAGG + Intergenic
932749879 2:74364742-74364764 GAGGGTTGTCAGCCAGCAGCAGG - Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
935131922 2:100267005-100267027 CAAGACTGCCAGCATGCTGCTGG - Intergenic
935293006 2:101625679-101625701 CGGGGCTGACAGAAAGCTGCTGG - Intergenic
935847453 2:107182119-107182141 ATGGGCTGCCAGCTTGCTGCTGG + Intergenic
936246994 2:110837041-110837063 GAGTGCTGGCATCAGGCTGCTGG + Intronic
937910185 2:127071885-127071907 GAGGCCTGCCTTCAAGCTCCAGG - Intronic
937910770 2:127074466-127074488 GCGGGCTGCCAGGTGGCTGCTGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940866204 2:158819845-158819867 GAGCACTGCCAGCAAGATGGAGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941802213 2:169672535-169672557 AAGAGCCCCCAGCAAGCTGCTGG + Intronic
945243581 2:207698400-207698422 GAAGTCTGCCATCAAGGTGCTGG + Intergenic
946272697 2:218607703-218607725 GAGGGCTGGCATCAAGATGAAGG + Intergenic
947498987 2:230658761-230658783 GAGGCCTGGCAGGAAGCTGGTGG - Intergenic
948461752 2:238132999-238133021 GAGGGCAGCGGGCAAGCTGTTGG + Exonic
948513305 2:238487636-238487658 GAGGGCTGCCAGCAGCCCTCGGG - Intergenic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
1169475594 20:5928485-5928507 GAGGGCCGCCAGCATGATGAAGG + Intergenic
1170947847 20:20907907-20907929 GAGGGCTGCCCACAAGCTACTGG - Intergenic
1176101676 20:63367332-63367354 GAAGGTTGGCAGCAAGCTGAAGG + Intronic
1177090410 21:16760474-16760496 GGAGGTTGTCAGCAAGCTGCAGG + Intergenic
1177724628 21:24951057-24951079 AAGGGCCCCCAGGAAGCTGCTGG + Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179708076 21:43193986-43194008 AAGGGCTGCCAGCAGGGTTCTGG + Intergenic
1179798957 21:43801874-43801896 GAGTGCTGACAGGAAGCTCCAGG + Intronic
1180038907 21:45265786-45265808 GAGGGGTGCCAGCAAGGGGGCGG - Intronic
1181185237 22:21098623-21098645 GAGGGCCACCAGGAAGATGCTGG + Intergenic
1182026664 22:27124499-27124521 GAGGGCTCCCAGAAGGCGGCAGG + Intergenic
1182935942 22:34221630-34221652 CTGGGCTGTCAGCAAGCTTCAGG + Intergenic
1183528083 22:38336124-38336146 AAGGCCGGCCAGCAAGCTTCAGG - Intronic
1183688600 22:39375837-39375859 GAGGGAAGCCAGCCAGATGCAGG - Intronic
1184405913 22:44300742-44300764 GAGGGGTGCCAGTAAGGTGGAGG + Intronic
1184723452 22:46329304-46329326 GATGGTTGCCAGAAAGATGCTGG + Intronic
1184737242 22:46406511-46406533 GAGTGCTCCCAGCAGGCTGGTGG - Intronic
950479106 3:13233778-13233800 GAGGGCTCCCGGCAGGCTCCTGG + Intergenic
951805815 3:26642555-26642577 GCTGGATGTCAGCAAGCTGCTGG + Intronic
952035417 3:29195565-29195587 GAGAGCTCCCAGGAAGCTACTGG + Intergenic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953469928 3:43157982-43158004 GAGGGCTGCCCGCAGCCTGCTGG + Intergenic
953714042 3:45300838-45300860 GAGAGTTGCCAGCTGGCTGCTGG - Intergenic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954993067 3:54857569-54857591 GAGGGCAGCCAACAGGGTGCAGG - Intronic
961695139 3:128698857-128698879 GAGGGCTGGCCGCAGGCTGCGGG + Intergenic
961958064 3:130824748-130824770 GAGGGCTGCCCTCAGACTGCTGG + Intergenic
962951452 3:140223419-140223441 AAGGGCTGGCAACAAGCTCCAGG - Intronic
963604786 3:147405050-147405072 GAGGGGAGCCAGAAAGGTGCAGG - Intronic
965400418 3:168206495-168206517 AAGGGCTGCCAGAAGGCTGTGGG - Intergenic
968250917 3:197212530-197212552 GAAGACTGCCAGCAAGCCGCTGG - Intronic
968377396 4:54525-54547 GGGGGCTGGCAGCAGGGTGCAGG - Intronic
968384737 4:125722-125744 GGGGGCTGGCAGCAGGATGCGGG - Intronic
968401708 4:304237-304259 GGGGGCTGGCAGCAGGGTGCAGG + Intronic
968405956 4:339036-339058 GGGGGCTGGCAGCAGGGTGCAGG - Intronic
968734846 4:2290073-2290095 GGGGCCTGCCATCACGCTGCTGG - Intronic
969050359 4:4368661-4368683 GAGGGCTGGCATAGAGCTGCAGG + Intronic
969131048 4:4991308-4991330 GACGGCTGCCACCAAGCCCCAGG + Intergenic
969916832 4:10499551-10499573 TAGGGCTGCCAACAGGCTTCAGG - Intronic
970823053 4:20241911-20241933 GAGGGCTCACAGCATGCTTCTGG + Intergenic
970882525 4:20948529-20948551 GCTGGCAGCCAGCATGCTGCAGG - Intronic
971176436 4:24286826-24286848 GAAGGCTACAAGCAAGATGCTGG + Intergenic
971478409 4:27093046-27093068 GAGGGCTGCCAAGCAGCAGCAGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
972127938 4:35792540-35792562 TAAGGCTGCCATCAAGATGCTGG + Intergenic
972302898 4:37802219-37802241 AAGGGCTGCCACCAAGTGGCAGG + Intergenic
972702243 4:41505354-41505376 TTGGGCTGCCAGCAAGCCACGGG + Intronic
974115886 4:57578714-57578736 GAGGGCCCCCTGGAAGCTGCTGG - Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
981591484 4:146368280-146368302 TTGGGCTTCCGGCAAGCTGCAGG + Intronic
985570574 5:642644-642666 CAGGGCTGCCTGCAAACTGCAGG - Intronic
985703914 5:1389753-1389775 GAGGGCTGCCAGCCATCACCAGG - Intergenic
985987318 5:3527034-3527056 GTGGGCTGCCACCAAGCCTCAGG - Intergenic
986326424 5:6678591-6678613 AAGAGCTCCCAGCAGGCTGCTGG - Intergenic
986334924 5:6747288-6747310 GAGGGCAGCCAGCAACCGGGCGG - Intronic
986848106 5:11779490-11779512 GAGGGTGCCCAGCAAGGTGCTGG + Intronic
987743545 5:21941104-21941126 GCTGCCTGCCAGCTAGCTGCAGG + Intronic
988734643 5:34008071-34008093 GAGGGCTTCTTGCAGGCTGCTGG - Intronic
989090421 5:37724546-37724568 CAGGGCTGACAGCAAGCTGTTGG + Intronic
991763741 5:69951239-69951261 GCTGCCTGCCAGCTAGCTGCAGG + Intergenic
991783584 5:70166895-70166917 GCTGCCTGCCAGCTAGCTGCAGG - Intergenic
991842972 5:70826307-70826329 GCTGCCTGCCAGCTAGCTGCAGG + Intergenic
991876029 5:71167230-71167252 GCTGCCTGCCAGCTAGCTGCAGG - Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
995543411 5:113206162-113206184 GAGGCCTGGCAGCAAGGTGGAGG + Intronic
995592859 5:113717656-113717678 AAGGGCTGCCTTCAGGCTGCTGG + Intergenic
997364638 5:133318214-133318236 GAGGGATGCAAGCAAGGTGAGGG - Intronic
998950430 5:147388372-147388394 GTGGGCAGCCAGCAAGCTGCTGG + Intergenic
999124695 5:149238538-149238560 GAGGGCTGGCTGCAACCTGTGGG - Intronic
1001028507 5:168244550-168244572 GACAGCTGCCAGCCCGCTGCTGG - Exonic
1001296744 5:170504032-170504054 GAGCGCTGGCAGCAGGCAGCAGG + Intronic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1002059003 5:176615302-176615324 GAGGGCTGCCAAGGAGCAGCTGG - Intergenic
1002094460 5:176822892-176822914 GTGGGGTGCCAGCAAGCGACAGG + Intronic
1002474091 5:179454116-179454138 GAGAGATGCCAGCAGGCAGCTGG - Intergenic
1002689274 5:181038927-181038949 GACGGGAGCCAGCAAGCTTCAGG - Intergenic
1003408940 6:5846513-5846535 GAGGGCTGCCGTCATGCTTCTGG + Intergenic
1003428776 6:6019904-6019926 GAGGGCTGCCTGCAAGGTAGGGG - Intergenic
1005992733 6:30913713-30913735 CAGGGCTGCCACCAAGGAGCTGG + Intronic
1007094114 6:39202872-39202894 GATGGCTGGCAGCAAGCCTCTGG + Intronic
1007169988 6:39856139-39856161 GAGGGCTCCCAGCAACCTGTGGG + Intronic
1007762025 6:44138836-44138858 GGGAGCAGCCAGCCAGCTGCAGG + Intronic
1008562341 6:52735291-52735313 GAGAGCTCCCAGCAAGCCGCTGG - Intergenic
1010947860 6:81999184-81999206 GAGGGATGTCAGCAAGATGATGG + Intergenic
1011734649 6:90298127-90298149 GATGGCTGAAAGCAAGCTGAAGG + Intergenic
1012496476 6:99838841-99838863 CAGTGCTGCCTGCAAGCTGGAGG - Intergenic
1015046728 6:128785221-128785243 GAGGGTTGACAGCCAGTTGCTGG + Intergenic
1016241112 6:141931973-141931995 GAGGGCTACCTGCAATCTGAAGG - Intergenic
1017812566 6:157994596-157994618 GAGGGCCAGCAGCGAGCTGCAGG + Intronic
1018732829 6:166665672-166665694 AAGGTCTCCCAGCAAGCTGCAGG + Intronic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019362762 7:613954-613976 CAGGGCTGCCACCAAGCGGGTGG + Intronic
1019471050 7:1221187-1221209 GGTGGCTGCCAGCATGCTGAAGG - Intergenic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1021968434 7:25944934-25944956 GAGGGCTGCCTGCCAGGAGCTGG - Intergenic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1028770959 7:94620961-94620983 GAGGCCTGCCACCAATCTGTTGG - Intronic
1029034599 7:97505706-97505728 GAGGCCTGCCAGGAAACAGCAGG - Intergenic
1032742188 7:134749977-134749999 GAGGGCTCCCAGAAAGCTGCTGG + Intronic
1034550375 7:151816679-151816701 GGGGGCTGGCTGCAGGCTGCAGG - Intronic
1037776103 8:21836702-21836724 GAGGGCTGCCGGCAGGGTGGGGG - Intergenic
1038883473 8:31639535-31639557 TGGGGCTGCGAGCAAGCGGCTGG - Intronic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1040014748 8:42691281-42691303 GAGGGCTGCCATCAAACTGCTGG - Intergenic
1043309314 8:78838553-78838575 GATGGGTTCCTGCAAGCTGCAGG - Intergenic
1045060735 8:98408703-98408725 GAGCGCTGCCAGCCAGCCTCTGG - Intronic
1047993747 8:130313931-130313953 GAGGGAAGCCAGCAGTCTGCAGG - Intronic
1048603352 8:135942607-135942629 GAGAGCTCACAGCAGGCTGCTGG - Intergenic
1048873068 8:138814668-138814690 CTGGGCTGCCCTCAAGCTGCTGG - Intronic
1049709038 8:144055482-144055504 CTGGGCTCCCAGCAAGCCGCTGG + Intronic
1049778602 8:144417455-144417477 GGGGGCTGCCTCCAAGCTGGGGG + Intergenic
1051050828 9:12929967-12929989 GATGGCTGCCAGCAAGTTCAGGG + Intergenic
1053150030 9:35737413-35737435 GAGGGCTTCCAGACAGCTGAAGG - Exonic
1055785222 9:79863772-79863794 GAAGGCGGCCAGGAAGGTGCTGG + Intergenic
1055882981 9:81024063-81024085 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1058885869 9:109320778-109320800 GCGGGCTGCCAGGGGGCTGCCGG + Exonic
1058977185 9:110136195-110136217 GAGAGCTGGCAGCAGGCTCCAGG - Exonic
1060105434 9:120870047-120870069 GAGCTCTGCCTGCCAGCTGCCGG + Intronic
1061092529 9:128434521-128434543 GGCGGGTGCCCGCAAGCTGCTGG + Exonic
1061146962 9:128805714-128805736 CAGGGCTGGCACCAGGCTGCCGG - Intronic
1061953545 9:133949746-133949768 CAGGGCTGCCTGCGTGCTGCAGG - Intronic
1062397110 9:136356959-136356981 CAGGGCTGCCAGCTGGCTGGTGG + Intronic
1203571840 Un_KI270744v1:139721-139743 GGGGGCTGGCAGCAGGGTGCAGG + Intergenic
1189065079 X:37799057-37799079 GAGGGTTTCCAGCAAACTGAGGG - Exonic
1194591083 X:95800461-95800483 GAGAGCCCCCAGCAAGCTGCTGG - Intergenic
1196107370 X:111911221-111911243 GAGGGGTGCCTGCCAGCTGAAGG - Intronic
1196786564 X:119426122-119426144 GAATGCTCCCAGCCAGCTGCGGG - Intronic
1196824680 X:119731815-119731837 GGGAGCTGTCAGCAGGCTGCTGG + Intergenic
1199979920 X:152915251-152915273 GAGGGCTGGCCCCAAGCTGCAGG - Intronic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic