ID: 1157236086

View in Genome Browser
Species Human (GRCh38)
Location 18:45966785-45966807
Sequence AGTCCCTGCCATGCATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157236086_1157236087 -9 Left 1157236086 18:45966785-45966807 CCTCTTTATGCATGGCAGGGACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1157236087 18:45966799-45966821 GCAGGGACTAAAAATGTTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 138
1157236086_1157236088 23 Left 1157236086 18:45966785-45966807 CCTCTTTATGCATGGCAGGGACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1157236088 18:45966831-45966853 AGTAAAGAGAGAGTCAACGATGG 0: 1
1: 0
2: 0
3: 15
4: 270
1157236086_1157236090 25 Left 1157236086 18:45966785-45966807 CCTCTTTATGCATGGCAGGGACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1157236090 18:45966833-45966855 TAAAGAGAGAGTCAACGATGGGG 0: 1
1: 0
2: 0
3: 13
4: 176
1157236086_1157236091 29 Left 1157236086 18:45966785-45966807 CCTCTTTATGCATGGCAGGGACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1157236091 18:45966837-45966859 GAGAGAGTCAACGATGGGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 176
1157236086_1157236089 24 Left 1157236086 18:45966785-45966807 CCTCTTTATGCATGGCAGGGACT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1157236089 18:45966832-45966854 GTAAAGAGAGAGTCAACGATGGG 0: 1
1: 0
2: 0
3: 6
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157236086 Original CRISPR AGTCCCTGCCATGCATAAAG AGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901004542 1:6165501-6165523 AGTCCCTGCCATGGACCACGAGG + Intronic
901025286 1:6275914-6275936 AGACCCTGCCCTGCATAATGTGG + Intronic
901898973 1:12341724-12341746 GGTCTCTGCCATGCAGATAGGGG + Intronic
902713036 1:18253567-18253589 ATTCCCTGCCAAGCATTAAAAGG - Intronic
909658554 1:78057280-78057302 AGTCCCAGCCATACATTCAGAGG - Intronic
909810209 1:79924061-79924083 AGTCCCAGCCATGACTAAAAGGG + Intergenic
911462444 1:98207458-98207480 AGTTCCTGCCAGACATAAAGTGG - Intergenic
918087439 1:181257701-181257723 AGCTCATGCCATGCATACAGTGG + Intergenic
920784811 1:209030962-209030984 GCTCTCTGCCATCCATAAAGAGG - Intergenic
921765945 1:218972933-218972955 TGTCCCAGCCATGGCTAAAGGGG + Intergenic
1064561994 10:16602521-16602543 ACTCCCTGCCCTGCAGAAAATGG - Intronic
1071245056 10:83752957-83752979 AGTCCCAGCCATGGCTAAAAGGG - Intergenic
1075119940 10:119657442-119657464 GGACCCTGCCAGGCATCAAGAGG - Intronic
1075679720 10:124323461-124323483 AGCCTCTGCCCTGCAGAAAGGGG + Intergenic
1079149197 11:17882767-17882789 AGACCCTGACATGCACAATGGGG + Intronic
1079785319 11:24664655-24664677 AGTTCCAGCCATGCAAACAGGGG + Intronic
1087338192 11:96869366-96869388 ATTTCCTGGCATGCAAAAAGTGG - Intergenic
1089583509 11:119495956-119495978 AGTAACTGCACTGCATAAAGAGG + Intergenic
1089672180 11:120064153-120064175 AGTCCCTGCAAAGCAAGAAGGGG + Intergenic
1090511258 11:127377507-127377529 TACCCCTGCCATGAATAAAGAGG + Intergenic
1093634148 12:21444559-21444581 AGTGCTTACCATGCATCAAGTGG + Intronic
1100886166 12:99072904-99072926 AGTGCCTGGCATGCAGTAAGTGG + Intronic
1101008410 12:100425416-100425438 AGTACATGCCTTGCATAAACTGG + Intergenic
1102736035 12:115160497-115160519 AGTGCCTGTCATGCAAAAGGAGG - Intergenic
1107734600 13:43385080-43385102 TTTCCCTGCCATCCAGAAAGCGG - Intronic
1119862620 14:77947608-77947630 AGTTCCAGCCATGGCTAAAGAGG + Intergenic
1120219414 14:81715310-81715332 AGCCCCTGCAATAGATAAAGAGG - Intergenic
1123795100 15:23763213-23763235 AGACCCTGCAATGCAGCAAGAGG - Intergenic
1124215888 15:27806923-27806945 AGGCCATGCCATGCAGAATGTGG - Intronic
1124366099 15:29072556-29072578 AGTCTCAGCCCTGCAGAAAGGGG + Intronic
1128765077 15:70246435-70246457 AGCCCCTGCCAATCTTAAAGTGG + Intergenic
1131728963 15:95258993-95259015 ATGCCCTGCCATGCACAAAGAGG - Intergenic
1134625720 16:15721161-15721183 AGTCCCGGCCATGCATCCTGTGG - Intronic
1138663996 16:58547414-58547436 AGTCCTTGCCTTACAAAAAGGGG + Intronic
1139594167 16:67948511-67948533 AGAGGCTGCCATGCATGAAGGGG + Intronic
1143266218 17:5639912-5639934 AGTACCTGCCATGCGGCAAGTGG - Intergenic
1143647117 17:8238000-8238022 CGCCCCTGCCATGCCTAGAGGGG + Intronic
1147958030 17:44148442-44148464 TGTGCCTGCCATCCACAAAGCGG + Exonic
1152876908 17:82791571-82791593 AGTCCCTGTCATGCAAAGATGGG + Intronic
1152969929 18:151913-151935 AGTCTCTGCCATGCAGATGGTGG - Intergenic
1156008175 18:32468606-32468628 TATCCCTGCCATTCATAAAAAGG - Intronic
1157236086 18:45966785-45966807 AGTCCCTGCCATGCATAAAGAGG - Intronic
1157806380 18:50660938-50660960 AGTCCCTCCCATGCATGAGAGGG + Intronic
1163102985 19:15108829-15108851 AGTCCCTGGCATCCCAAAAGGGG - Intronic
1165095115 19:33405985-33406007 TGTCCATGTCATGCATAAAATGG - Intronic
1165440881 19:35826641-35826663 GGTCCCTGACAGGCAAAAAGTGG + Exonic
925245582 2:2379666-2379688 AGTCCCAGTCATGGCTAAAGGGG + Intergenic
929888091 2:45896169-45896191 TATCCCTGCCATGCCTAGAGTGG + Intronic
932689026 2:73896838-73896860 GCTCCCTGCCAAGCATGAAGCGG + Exonic
936509370 2:113132893-113132915 AGTCCTTGCCATGCAAGAATGGG - Exonic
940255570 2:151724642-151724664 AGTCCATGCCCTGCCCAAAGAGG - Intronic
940989588 2:160084365-160084387 AGTTACTTCCATCCATAAAGAGG + Intergenic
941306256 2:163871805-163871827 AGAACATGCTATGCATAAAGAGG - Intergenic
942647174 2:178125202-178125224 AGTTCCTGCCTTGAACAAAGAGG - Intronic
944481111 2:200158760-200158782 AGTTCAGGCCATGCATTAAGAGG + Intergenic
945675055 2:212846007-212846029 AGTCCCTGGGAGGCAAAAAGGGG - Intergenic
1170337115 20:15282075-15282097 AGTCCCAGCCATGGCTAAAAGGG - Intronic
1173542347 20:43863543-43863565 GGTTCCTGCCATGCACAGAGAGG - Intergenic
1178352056 21:31879274-31879296 AGTCCCTGCCAAGGATTAATAGG - Intronic
1179099957 21:38347712-38347734 AGTCCCTGCTATGCAAGGAGAGG + Intergenic
952045933 3:29320044-29320066 AGTCTCTGCCATGTAAAAGGAGG + Intronic
954002770 3:47570896-47570918 ATTCCCTGGCATGCACAAATGGG - Intronic
954810355 3:53243659-53243681 GGTCCCTGCCAGGCAGAAAAGGG - Intronic
956518849 3:70081537-70081559 AGTGCCTGCCATGCACAAGGTGG - Intergenic
958101951 3:89023387-89023409 AGAGGCTGCCATGCATAAATTGG - Intergenic
958720538 3:97837791-97837813 AGACTCTGGCATCCATAAAGAGG + Intronic
958913066 3:100016674-100016696 AGTCCATGCAATTCATAAACTGG + Intronic
961377822 3:126478544-126478566 AGCCCCTGCCATCCAGAAACTGG + Intergenic
964323061 3:155517956-155517978 TGTATCTCCCATGCATAAAGGGG - Intronic
964495970 3:157290142-157290164 AGTCCCTGCAGTTCATAATGTGG - Intronic
969881925 4:10181576-10181598 AGTTCCTGTGATGCATATAGAGG - Intergenic
974415927 4:61606781-61606803 AGTCCCTGTCTTGCATAATGAGG + Intronic
975395457 4:73869349-73869371 AGCCCCAACCATGCATAAAAGGG + Intergenic
975410037 4:74038711-74038733 AGTCTCAACCATGCATAAAAAGG - Intronic
975415425 4:74099217-74099239 AGCCCCAACCATGCATAAAAGGG - Exonic
981342281 4:143635071-143635093 AGTCCCTGACTTACATAAATTGG - Intronic
987597501 5:20020543-20020565 AGCTCCAGCCATGGATAAAGGGG + Intronic
991766919 5:69993805-69993827 AGTCTTTGCCATTCATAAGGCGG + Intergenic
991846151 5:70868882-70868904 AGTCTTTGCCATTCATAAGGCGG + Intergenic
994860742 5:105189536-105189558 AGTTCCTACCATCAATAAAGAGG - Intergenic
997130483 5:131271531-131271553 AGTCCCTTACATACATAAAATGG - Intronic
1000382382 5:160640790-160640812 AGTGTCTGGCATGCATGAAGGGG - Intronic
1000653583 5:163848571-163848593 AGACACTCCCATGGATAAAGAGG + Intergenic
1001043749 5:168355534-168355556 AGAGCCAGCCATGCAAAAAGTGG + Intronic
1002311213 5:178315070-178315092 AGGGCATGCTATGCATAAAGGGG - Intronic
1003300272 6:4874398-4874420 AGTTCCTGCCAGGCACACAGTGG - Intronic
1007352278 6:41282585-41282607 AGACCCTGGCATGCACAGAGAGG - Exonic
1008893045 6:56518690-56518712 AGTGCCTCCCATGAATAAAATGG + Intronic
1009422868 6:63483026-63483048 AGTGCCTGACATGCAGTAAGTGG - Intergenic
1011211200 6:84958470-84958492 AGTCCCAGCCATGGCTAAAAGGG + Intergenic
1018513014 6:164546573-164546595 TGCCTCTGCCATTCATAAAGTGG - Intergenic
1020068034 7:5204794-5204816 AGTCCCAGCTATGCAAGAAGGGG - Intronic
1020068227 7:5206227-5206249 AATCCCTCCCTTGCATTAAGGGG + Intronic
1022609781 7:31858228-31858250 AGTCCCTCCCAACCATAAAGGGG - Intronic
1022848987 7:34240522-34240544 AATGACTGCCATGCATAAATTGG - Intergenic
1027218308 7:76198263-76198285 AGTCCCAGCCAGGCACAGAGAGG + Intergenic
1029626041 7:101720757-101720779 AATTCCTGCCCTGCAGAAAGAGG + Intergenic
1030688035 7:112506539-112506561 AGTGCCTGCCCTGGACAAAGGGG + Intergenic
1037205065 8:16307391-16307413 AGTCCCTTACATGCATACAGGGG - Intronic
1038253713 8:25930475-25930497 AGTCCCTGCAAGGCACTAAGCGG - Intronic
1040026099 8:42784324-42784346 AGTCCCTGCCTTGTCTCAAGAGG - Intronic
1042655061 8:71086829-71086851 AGTCCCGACCATGAATACAGAGG - Intergenic
1043122938 8:76353005-76353027 AGTTCTTACAATGCATAAAGTGG - Intergenic
1045010331 8:97953283-97953305 ACTCTCTGCCATGCTTAAATAGG + Intronic
1045050871 8:98323888-98323910 TGTCCCTGCCATACAGGAAGAGG + Intergenic
1046849105 8:118952448-118952470 AGACAATGCCATGCATAAAGAGG - Intergenic
1052977186 9:34419968-34419990 AGTGCCTGCCAGGCATAATGGGG - Intronic
1053428961 9:38029189-38029211 AGCCCCAGCCTGGCATAAAGGGG + Intronic
1057049675 9:91914243-91914265 ATTCCCAGCCAAGCATAACGTGG + Intronic
1057795957 9:98158367-98158389 AGTATCTGCCATGCACCAAGGGG - Intronic
1059118752 9:111622456-111622478 ACTCCCTGCCATTCTTCAAGTGG + Intergenic
1061120055 9:128636644-128636666 AGTCCATGCCATGCAGGATGGGG + Intronic
1061950932 9:133935474-133935496 AGTCCCTGCCGTGGACAGAGGGG - Intronic
1187675134 X:21709108-21709130 AGTCCATGCCAGTCACAAAGTGG + Intronic
1194450691 X:94041641-94041663 AGCCCCTGCCATGCCTAAAAGGG + Intergenic