ID: 1157238271

View in Genome Browser
Species Human (GRCh38)
Location 18:45984357-45984379
Sequence CTGCTGTTTGTGAGTGAAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157238267_1157238271 25 Left 1157238267 18:45984309-45984331 CCATTTTCTCATAGTGCACAGGT 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157238271 Original CRISPR CTGCTGTTTGTGAGTGAAAA AGG Exonic
900831268 1:4967320-4967342 CTGCAGTGTGTGAGTGGGAAGGG - Intergenic
900981557 1:6048886-6048908 CTGCTGTCTGTGGGTGCCAAGGG + Intronic
901133273 1:6976292-6976314 CTGCTGTGTGTGTGTGAGATGGG + Intronic
902164498 1:14559314-14559336 CTTCTGTTTGTTAGGGGAAAAGG - Intergenic
910360396 1:86409918-86409940 CTGCTGATTGTCAGGGATAAAGG + Intergenic
910409828 1:86929881-86929903 GTTCTGTATTTGAGTGAAAAAGG - Intronic
912627984 1:111222029-111222051 CTGCTGTGTGTGGGGGAAACTGG + Intronic
912651929 1:111447845-111447867 CTGCTTTTAGTGAGAGAATATGG + Intronic
915984048 1:160445690-160445712 TTGGTGTTTGTGAGTAACAACGG + Intergenic
916001081 1:160616419-160616441 CTTATGTTTCTGAGTGAAATTGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918392699 1:184082962-184082984 CTTCTGTTTGTGAATGTAACTGG - Intergenic
921035226 1:211371589-211371611 CTGCTATTTGTGAAAGAGAATGG + Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
924823498 1:247517088-247517110 CTGCTCTTTGTGAGTGGACATGG + Intronic
1063342677 10:5282827-5282849 CAGCAGTTTGTGATTGAAATTGG + Intergenic
1065542865 10:26787419-26787441 CTGCAGTGTGTGAGTGAAGTAGG - Intronic
1065829392 10:29600577-29600599 CTGCTGTTTATAAAAGAAAATGG - Intronic
1065857498 10:29842237-29842259 CTGCTGTTTGTGGGAGGAAGGGG + Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1071306295 10:84302013-84302035 ATGCTGTTTGTGATGGACAATGG - Intergenic
1073113521 10:101077247-101077269 CTGGTATTTTTAAGTGAAAAAGG - Intergenic
1074020181 10:109574589-109574611 TTTCTGTTTGTCAGTGAAATGGG - Intergenic
1075823604 10:125334844-125334866 CTGCTGTTATTGTGTGAAAGTGG + Intergenic
1076012500 10:127001775-127001797 TTACCATTTGTGAGTGAAAATGG + Intronic
1079433738 11:20423470-20423492 CTGCTATTTCTGTGTGAAAGAGG - Intronic
1081041750 11:38222570-38222592 CGTCTGTTTGGGAGTGAACAAGG + Intergenic
1084072567 11:66745573-66745595 CTGCTGTTTGTGAGGGGTACTGG + Intronic
1085069204 11:73527177-73527199 CTGCTGTTAGTGGATGAGAAAGG - Intronic
1086062281 11:82712200-82712222 ATCCTGTTTGTGAGTGAGGATGG + Intergenic
1087891374 11:103541751-103541773 CTGCTGATTGTCAGGGATAAAGG + Intergenic
1087920228 11:103858506-103858528 CTGCTTTCTGTGACTGAAATGGG + Intergenic
1088090161 11:106028647-106028669 CTCCTGTTTGATAGTCAAAAAGG + Intergenic
1089231845 11:116984110-116984132 CAGCGGTTTGTGGGGGAAAAGGG + Intronic
1089982843 11:122786776-122786798 CTGCTTTTGGTGAGTGAGAAAGG + Intronic
1090058946 11:123447192-123447214 CAGCTGAGTGTGAGTGAAATAGG - Intergenic
1090102846 11:123819114-123819136 CTCCTGTTTGTGAGTTAAGTTGG + Intergenic
1091268013 11:134285829-134285851 CTTCTGTTTGGGAGTAAATATGG + Intronic
1091328630 11:134712871-134712893 CTGTTGTGAGTGAGTGACAAGGG + Intergenic
1093367970 12:18327098-18327120 TTGCTGTTTGCCAGTGATAATGG - Intronic
1094434105 12:30402225-30402247 CTGCACTTTGTGTGTGAAATAGG + Intergenic
1097851141 12:64411538-64411560 CTGCTTTTTGTCAGTAAAAATGG + Intronic
1098259934 12:68658060-68658082 CTGCTGTTTGCCAATGATAATGG + Intronic
1098516686 12:71385693-71385715 ATACTGTTTGTCAATGAAAAAGG + Intronic
1099464829 12:82970827-82970849 CTGCAGTTACTGAGAGAAAAAGG - Intronic
1100767954 12:97888343-97888365 CTGCAATTTGAGTGTGAAAAGGG - Intergenic
1104046009 12:125163504-125163526 CTGCCGTATGTGAGTGAAATGGG - Intergenic
1104258760 12:127163567-127163589 CTGCTGTTAGTGAGGGGAACAGG + Intergenic
1104890930 12:132139811-132139833 CTGCTGTTGGTGGGTGTTAAGGG - Intronic
1105750153 13:23415867-23415889 CTGCTCTTTGTTATTAAAAATGG + Intronic
1106109965 13:26768107-26768129 CTATTGTTTGGGAGTAAAAAGGG + Intergenic
1106449845 13:29870485-29870507 TTGCTGTGTGTGGGAGAAAATGG + Intergenic
1106488674 13:30195513-30195535 CTGCTGTGAGTGGGTGAAGAAGG - Intergenic
1107334173 13:39335496-39335518 CTGCTGTTTGTCAGTAAAGTGGG + Intergenic
1107761770 13:43687308-43687330 CTATTCTTTGTGACTGAAAATGG + Intronic
1107881396 13:44834886-44834908 CTGCTGTTTAGAATTGAAAAAGG - Intergenic
1108867313 13:54939140-54939162 CTGCTGTAAGTGATTGTAAAGGG + Intergenic
1109886635 13:68553479-68553501 GGGTTGTTTGAGAGTGAAAAGGG - Intergenic
1109963746 13:69665784-69665806 CTGATATTTGTGTGTTAAAAGGG - Intergenic
1110132438 13:72023680-72023702 CTGCTGATTGTCAGGGATAAAGG - Intergenic
1110231230 13:73169535-73169557 CTGCCTTTTGTCTGTGAAAATGG - Intergenic
1111536610 13:89610268-89610290 CTGTTTATTATGAGTGAAAATGG - Intergenic
1112718605 13:102215788-102215810 CTTTTATTTTTGAGTGAAAAAGG + Intronic
1113178014 13:107588593-107588615 CTGCTGTCTGTGAGTGTAAAAGG + Intronic
1115448131 14:33515547-33515569 CTGCTGTTGTAGAGTGAAAGCGG - Intronic
1118158957 14:63269842-63269864 ATGCTCTTTTTGGGTGAAAATGG + Intronic
1118745630 14:68771029-68771051 GTGCTGTTTCTGAAAGAAAAGGG + Intergenic
1118885928 14:69865879-69865901 GTGCTGTTTGTGGGTGAAGTAGG + Intronic
1119121913 14:72087534-72087556 CTAATGACTGTGAGTGAAAAAGG + Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1119902221 14:78271094-78271116 CTGAAGTTTGTCTGTGAAAATGG - Intronic
1127470025 15:59282488-59282510 CTGGAGTTTGTGAGGGAAAGAGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1127877384 15:63122474-63122496 TTGCTGTTAGTGAGTGACCATGG + Intronic
1128064432 15:64755579-64755601 CTGCTGTTTGTGAGGGCAGGGGG + Intronic
1130681451 15:86000593-86000615 CTGCTGTTACTGAGTTATAAAGG + Intergenic
1132215216 15:100057394-100057416 CTGGTCTTTGTGAGAGAAATGGG - Intronic
1132312903 15:100870129-100870151 CAGCTGATTCTGAGTGGAAAGGG + Intergenic
1134329143 16:13234825-13234847 CTGCTCTTTGTTTGTGAAAAGGG + Intronic
1141253832 16:82382736-82382758 GTGCTGTTTCTGAGTAACAATGG + Intergenic
1143641330 17:8199785-8199807 CTGCTGTTTCTCAGAGAAGAGGG + Intergenic
1144029299 17:11305154-11305176 CTGCTTTTTGTAAGAGGAAAAGG - Intronic
1150731134 17:67695229-67695251 ATGCTTTGTGTGAGTTAAAAAGG + Intronic
1150979081 17:70121432-70121454 CCAGTGTTTGTTAGTGAAAAAGG + Intronic
1152480227 17:80545938-80545960 CTGCAGTTTTTGGTTGAAAATGG + Intronic
1153561257 18:6374090-6374112 CTGCTGTTTGTGTGTTCACAGGG - Intronic
1153721796 18:7911343-7911365 CTGCTGTTTGAAATGGAAAATGG - Intronic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1155088861 18:22486384-22486406 CTTATGTTTCTGAGTGAAAAGGG - Intergenic
1156348229 18:36278479-36278501 ATGTTATTTGTGAATGAAAATGG - Intergenic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157909681 18:51604119-51604141 CTGCTGCTTGTTTGAGAAAAGGG + Intergenic
1158826046 18:61220787-61220809 CTGCTGTTGTTGAATGAATATGG - Intergenic
1163327992 19:16617622-16617644 GTGCTGTTTGGGATTGAAATTGG - Intronic
1163371469 19:16903583-16903605 GGGCTGTTTGTGAGTGCCAAGGG - Exonic
1165642895 19:37405082-37405104 CTGCTGTTAATGTGTGAAAGAGG + Intergenic
1166920661 19:46226973-46226995 CTGCTGGTTGTCAGTGACACAGG - Intergenic
925251783 2:2445107-2445129 CTCCTGAATGTGTGTGAAAAAGG + Intergenic
928761314 2:34586598-34586620 TTGCTTTTTGTGACTGTAAATGG + Intergenic
929362324 2:41108560-41108582 TTGCTTTTTATGATTGAAAATGG - Intergenic
929622559 2:43370441-43370463 CTTCTGTTTGTTTGTGAGAACGG - Intronic
931012934 2:57938687-57938709 CTTCTGTTTATGAGAGAAACAGG - Intronic
936522473 2:113219945-113219967 GTGCTGTTTGTGATGGAAGAAGG - Intronic
937049245 2:118875190-118875212 CTGCTGTTTAAGAGTGGCAAGGG + Intergenic
937642894 2:124233894-124233916 CTGGTGTTTTTGAGTTTAAAAGG - Intronic
937989759 2:127655638-127655660 CTGCTGTGTGTGAGAGAGAGAGG + Intronic
939932632 2:148254239-148254261 CTGCTGATTGTTAGGGATAAAGG + Intronic
940185744 2:150983399-150983421 ATGCTTTTTGTGAGTAGAAATGG + Intergenic
940801642 2:158139422-158139444 CTGATGTTTGGGAATGAAAATGG - Intergenic
941859588 2:170264899-170264921 GTGCAGCTTGTCAGTGAAAAGGG + Intronic
942011099 2:171763080-171763102 GTGCTGTTTGTTAGTGAGATTGG + Intergenic
945350129 2:208767554-208767576 CTTCTTTTTGTGTCTGAAAATGG - Intronic
945780409 2:214164488-214164510 ATGCTTTTTGTGAGTGAGATTGG + Intronic
946021558 2:216643895-216643917 CTGCTCTTTGTGAGTGTGGAGGG - Intronic
946226257 2:218265565-218265587 CTGCAGTGTGTGAGTGAGGATGG - Exonic
946262804 2:218509990-218510012 CTGCTGTTGGTGAGAGGAAAGGG + Exonic
947321229 2:228921163-228921185 TTGCAGTTTGTCAGTGAGAATGG - Intronic
947422912 2:229956743-229956765 CTGCACTTTGGGAGAGAAAAAGG + Intronic
1169303970 20:4472009-4472031 CTTCTCTATGTGAGTAAAAATGG + Intergenic
1170431294 20:16279117-16279139 CTGCTGTTTGGGAAGGGAAATGG - Intronic
1170517575 20:17147936-17147958 CTGCTGCTTATCAGGGAAAAAGG - Intergenic
1170863693 20:20133604-20133626 CTTCTTTTTGTGTGTGAACATGG - Intronic
1171385830 20:24769007-24769029 CTGGTGCATGTGAGTGAGAATGG + Intergenic
1173132817 20:40410598-40410620 CTGTTGTTTGTAAATGACAAAGG - Intergenic
1174848239 20:53965091-53965113 CTGCAATTTGGCAGTGAAAATGG - Intronic
1175955943 20:62609532-62609554 CTGCTGTGTGGGAGTGACATGGG + Intergenic
1176364997 21:6027410-6027432 CTGCTGTTTCTGAGTCCACAGGG - Intergenic
1178505097 21:33155861-33155883 ATGCTCTTTGTGAGTTAAAGAGG + Intergenic
1179460365 21:41530702-41530724 CTGCTGTCAGTGAGGGAAAGGGG + Intronic
1179664209 21:42898964-42898986 CGTCTGTGTGTGAGTGGAAACGG + Intronic
1179758521 21:43511135-43511157 CTGCTGTTTCTGAGTCCACAGGG + Intergenic
1182394857 22:30027912-30027934 CTTCTGTGTGAGAGGGAAAAGGG - Intronic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
952339823 3:32436234-32436256 CTGATGTTGGTGAGTGAGACAGG + Intronic
953028504 3:39159884-39159906 CTACTGGTTGAGAGTGAAATTGG - Intergenic
954332375 3:49897905-49897927 CTGCTTTTTGAGAGTCAAAAAGG - Intronic
954888457 3:53899842-53899864 CTTCTGTATGAGAGTGAACAAGG + Intergenic
955544681 3:60015565-60015587 CTGCTTTTTCTGTGTTAAAAGGG + Intronic
956352247 3:68350650-68350672 CTGCTGTTTTTCTGTTAAAAAGG - Intronic
957124843 3:76145844-76145866 GTGATATTTGTGAATGAAAAAGG - Intronic
957685565 3:83500967-83500989 CTGCTGATTGTCAGAGATAAAGG + Intergenic
958691814 3:97478912-97478934 CTGCTGTTTAGCAGTGAAAATGG + Intronic
959410372 3:106014136-106014158 CAGCTGTTTGTGAGTGATCTTGG - Intergenic
960147678 3:114220242-114220264 CTCCAGTTTGTCAGTGAAGAAGG + Intergenic
961470386 3:127107630-127107652 GGGCTGTTTGTGGGAGAAAATGG + Intergenic
964433196 3:156625955-156625977 CTGCTGATTGTCAGGGATAAAGG - Intergenic
964667107 3:159186830-159186852 ATGCTGCTGGTGAGAGAAAACGG + Intronic
965943222 3:174210170-174210192 CTGATGCTTGTGAGTGAGGATGG - Intronic
969554071 4:7894264-7894286 CTGCTGTTGGAGTGTGAACACGG - Intronic
970715329 4:18915165-18915187 GTGCTTTTAGTGAGTGAAAAGGG + Intergenic
971345083 4:25804353-25804375 TTGCTTTCAGTGAGTGAAAAAGG - Intronic
973709496 4:53614344-53614366 GTGCTGTTTGTGAGATGAAATGG - Intronic
975184929 4:71390278-71390300 CTGTTTTTAGTGAGTGAAATGGG + Intronic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
975600325 4:76093111-76093133 ATGCTGTTTCTGACTGAAGATGG - Intronic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
976828905 4:89290851-89290873 CTGCTGTTTGTGTGTGAATGGGG - Intronic
980569461 4:134595137-134595159 GTGCATTTTGTGAGAGAAAATGG + Intergenic
981232970 4:142380063-142380085 CTGGGATTTGTGAGTGAAACTGG - Intronic
981819821 4:148873230-148873252 CTGCTGATGGTGAGAGGAAATGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
981983849 4:150829943-150829965 GTGCATTTTGTGAATGAAAAAGG - Intronic
986159260 5:5210212-5210234 CTTCTGTTTGTTAAGGAAAATGG + Intronic
987409645 5:17602138-17602160 GGTCTGTTTGTGGGTGAAAAAGG - Intergenic
987550270 5:19370419-19370441 CTCCTGAGTGTGAGAGAAAATGG - Intergenic
989161971 5:38399810-38399832 CTGCTCCTTTTGAGTGAAGATGG + Intronic
989527757 5:42473028-42473050 CTACTGTTTCTAAGTGAAAGAGG + Intronic
990132486 5:52604057-52604079 CTGTTTTTTATGAGTAAAAATGG - Intergenic
990502989 5:56415458-56415480 CTGCTGTTTGTCATGGGAAATGG - Intergenic
990762816 5:59149421-59149443 CTGCGGTTTGGGAGTTAAATGGG - Intronic
991453014 5:66772684-66772706 CTGCTGTTTTAGGGTGTAAATGG + Intronic
991980091 5:72221449-72221471 TTACTGTTTTTGAGTGAAAGGGG - Intronic
992837752 5:80657112-80657134 CTGCTCTTTGTGTATGTAAAAGG + Intronic
993685499 5:90932417-90932439 CTTCTGTTTGCTAGTGGAAATGG + Intronic
994322579 5:98410391-98410413 CTGCTGTTAGTGAGATAAATGGG + Intergenic
994508891 5:100678155-100678177 GTGCTGTTTGTGTGTGGAACTGG - Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
994980824 5:106874148-106874170 CTGCTGATTGTCAGGGATAAAGG + Intergenic
997461263 5:134053990-134054012 CTGCTGTTTGTCACTGACAATGG + Intergenic
998923624 5:147098522-147098544 CTACTGTTTGGGAATGGAAATGG - Intergenic
1000391911 5:160731214-160731236 TTGCCGTTTGTGAGTAAAGATGG + Intronic
1000593609 5:163188328-163188350 CTACAGTTTGTAAGTGAAGAAGG - Intergenic
1001298866 5:170519046-170519068 CTGTTCTTTGTGTGTGGAAAAGG + Intronic
1001673841 5:173496331-173496353 CTGCTGTCAGTTTGTGAAAAGGG + Intergenic
1002963679 6:1941621-1941643 CTGCTGTCAGTGAGAGAAAGGGG + Intronic
1003774243 6:9341441-9341463 TTGCTGTCTGTGAGAAAAAAAGG + Intergenic
1003800518 6:9660137-9660159 CTGCTGTTGGTGGTTGACAAAGG + Intronic
1005732771 6:28714709-28714731 GTGCTGCCTGTAAGTGAAAAGGG - Intergenic
1011521777 6:88215077-88215099 GTCCTATTTGTGAGTAAAAAAGG - Intergenic
1011752776 6:90469949-90469971 CTGCTGTTTGAGAGTGAGAGTGG + Intergenic
1012416584 6:99019897-99019919 CTGCTGATTGTCAGGGATAAAGG + Intergenic
1013926021 6:115473599-115473621 CTCTTGTTTGTGAGTGTGAAAGG - Intergenic
1014420526 6:121238974-121238996 CTGCTGGTTGTAACTGAATATGG + Intronic
1014519229 6:122419411-122419433 CTGATGTTTGTGAGAGATAAGGG + Intronic
1014920506 6:127209666-127209688 CTGCTGCATGTGTTTGAAAAAGG - Intergenic
1017531709 6:155299263-155299285 CTTCTCTTTGTGAGCAAAAAGGG + Intronic
1017636337 6:156447200-156447222 GTTCTATTTGTGATTGAAAACGG - Intergenic
1018328221 6:162697998-162698020 TTGCTGTTTGTAAGGGAAACAGG - Intronic
1021229492 7:18068729-18068751 TTGATGGATGTGAGTGAAAATGG + Intergenic
1021824619 7:24536940-24536962 CTGCTTTTAGTGAATGACAATGG + Intergenic
1022258699 7:28683791-28683813 CTGCTGTTTTTCAGTGACATAGG - Intronic
1023025928 7:36049559-36049581 CTCCTGTGTTTGAGTGAAGAAGG + Intergenic
1024641224 7:51330215-51330237 CTCCTGTTTTTCAGAGAAAATGG + Intergenic
1027879489 7:83815580-83815602 CTGGTATAGGTGAGTGAAAATGG + Intergenic
1028016059 7:85714560-85714582 CTTCTGTTGGTGTGTTAAAAGGG + Intergenic
1028349897 7:89833345-89833367 ATGTTATTTATGAGTGAAAAAGG + Intergenic
1028660548 7:93267722-93267744 TGGATGTTTGTGAGTGAGAAAGG + Intronic
1030778283 7:113564214-113564236 CTCCTATTTATGAGTGAGAACGG + Intergenic
1031358116 7:120813643-120813665 CTGCTGTTTGGTAATTAAAAGGG - Intronic
1032451552 7:132036014-132036036 ATGCTGTTTGTGAATAAAAGTGG - Intergenic
1036531189 8:9589052-9589074 TTAGTGTTTGTGACTGAAAACGG + Intronic
1040491154 8:47923601-47923623 CTAATGATTGAGAGTGAAAATGG - Intronic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1043147885 8:76679134-76679156 CTGCAACTTGTAAGTGAAAAAGG - Intergenic
1043628921 8:82302158-82302180 CTGCAGTTTGTCTGTAAAAAAGG + Intergenic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1044632431 8:94292559-94292581 CTGCTGTCTGTGAGTGTACCTGG - Intergenic
1044702238 8:94975213-94975235 CTGCTGAATGTGAATGAAAGGGG - Intronic
1045370637 8:101518911-101518933 CTGCTGTTTGTGAGGCACATTGG + Intronic
1046848759 8:118949186-118949208 ATTCTTTTTGTGAGTGCAAAGGG - Intronic
1047044202 8:121033633-121033655 CTGATCCTTGTGAGGGAAAATGG + Intergenic
1047466681 8:125122902-125122924 TGGCTGCTTTTGAGTGAAAATGG - Intronic
1048222683 8:132556546-132556568 CTGCTGTTTCTGAGAGCAGAAGG + Intergenic
1049923305 9:385020-385042 CTGATTTTTGTAAGTCAAAAAGG - Intronic
1051728562 9:20114177-20114199 GTGCTATTTGGGAGTGGAAATGG - Intergenic
1052742186 9:32403886-32403908 CTACTGTTTGAGGGTGAAAAAGG + Intronic
1053449519 9:38181314-38181336 CTGCTGAATGTGATAGAAAAAGG + Intergenic
1056860055 9:90172863-90172885 TTTCTGTCTGTGAATGAAAAGGG + Intergenic
1057267820 9:93630579-93630601 CTGCTGTTTGTGTGTCCTAAGGG + Intronic
1059255811 9:112929580-112929602 CTGCTGATTGTGAGTGCATCTGG - Intergenic
1060976246 9:127766887-127766909 CTGCGGTGGGTGAGTGAAGATGG - Intronic
1061602254 9:131678928-131678950 CTGCTTTTTATGAGTGAAACTGG + Intronic
1062155462 9:135045844-135045866 CAGCTGTTTGGGGGTAAAAAGGG + Intergenic
1062424075 9:136498047-136498069 CTGCTGTGTGGGAGTGGGAAGGG + Intronic
1186692620 X:11994768-11994790 CTTCACTTTGTGAGTGATAAGGG + Intergenic
1189149493 X:38690296-38690318 CTGCGGTTACTGACTGAAAAGGG - Intergenic
1189575532 X:42349048-42349070 CTCATGCTTGAGAGTGAAAAGGG + Intergenic
1189881146 X:45493763-45493785 TTGCTGTTGGTATGTGAAAATGG + Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1195869908 X:109475061-109475083 GACCTGTGTGTGAGTGAAAAAGG + Intronic
1195964636 X:110418906-110418928 CTGCTGCCTGTGTGTGTAAAGGG - Intronic
1197305948 X:124842375-124842397 CTGCTGCTTGTGAGTAAAGGTGG - Intronic
1200208509 X:154334775-154334797 CTCCTGTTTTTGTCTGAAAATGG + Intergenic
1200732007 Y:6752738-6752760 CTGCTGTATGCCAGTGAAATTGG - Intergenic