ID: 1157241597

View in Genome Browser
Species Human (GRCh38)
Location 18:46015032-46015054
Sequence CAAGGGAGTCAGAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157241589_1157241597 26 Left 1157241589 18:46014983-46015005 CCGCAATATGGAAAGGGACAGAG 0: 1
1: 0
2: 1
3: 22
4: 233
Right 1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 27
4: 320
1157241588_1157241597 27 Left 1157241588 18:46014982-46015004 CCCGCAATATGGAAAGGGACAGA 0: 1
1: 0
2: 2
3: 10
4: 190
Right 1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 27
4: 320
1157241591_1157241597 -3 Left 1157241591 18:46015012-46015034 CCAGAGAAGCAGGAAGAATCCAA 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG 0: 1
1: 0
2: 2
3: 27
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157241597 Original CRISPR CAAGGGAGTCAGAGGGATGC AGG Intronic
900204752 1:1427170-1427192 AAAGGGAGACGGAGGGGTGCAGG - Intronic
900532963 1:3163668-3163690 CCAGGGAGCCAGAAGGAGGCCGG - Intronic
901469850 1:9448644-9448666 CCAGGGAGTGGGAGGGAGGCCGG + Intergenic
902682501 1:18053481-18053503 CCAGGGAGAAAGTGGGATGCTGG - Intergenic
902920967 1:19665712-19665734 CAAGGGAGTGATAGGGTGGCGGG - Exonic
903707174 1:25294886-25294908 GAAGAGAGTGAGAGGGCTGCAGG + Intronic
903720065 1:25398456-25398478 GAAGAGAGTGAGAGGGCTGCAGG - Intronic
903737382 1:25538669-25538691 CTAGGGAGTCAGAGGGAGCCTGG - Intergenic
904389450 1:30172325-30172347 GTAGGGAGTCAGAGGCATCCCGG + Intergenic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
904928366 1:34066348-34066370 CAAGGCAGAGAGGGGGATGCAGG - Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905918084 1:41699661-41699683 GAAAGGATGCAGAGGGATGCTGG + Intronic
906047986 1:42847111-42847133 CAAGGAAGTCAGAGGGTCGCAGG - Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
907326191 1:53640104-53640126 CAAAGCAGTCAGAGGAGTGCAGG + Intronic
907520012 1:55017565-55017587 CAAGAGATTCACAGAGATGCTGG + Intergenic
908094026 1:60718394-60718416 CAAGGGAGACATGGGGGTGCAGG + Intergenic
910058247 1:83057562-83057584 CACGGGAGAAAGATGGATGCTGG - Intergenic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911372962 1:97016198-97016220 GAAAGGAGTCAGGGGTATGCAGG - Intergenic
911556627 1:99353140-99353162 AAATGGAGTGAGAAGGATGCTGG + Intergenic
911677225 1:100672938-100672960 CAAAAGAGTCAGAGGAATGAAGG + Intergenic
911841415 1:102686805-102686827 CATGGGATTCAGAGGGCTTCTGG + Intergenic
912763096 1:112386289-112386311 CAAGGGAGTCAGCAGGAGCCAGG + Intergenic
913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG + Intergenic
913246918 1:116878429-116878451 TAAGGGATTGAGAGGGGTGCTGG - Intergenic
913937131 1:125065466-125065488 CGAGGGAGGCAGAGGGCTGATGG - Intergenic
915342303 1:155183348-155183370 GAAGGGTGTTAGAGGTATGCGGG - Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915841155 1:159214397-159214419 CCAGAGAATTAGAGGGATGCAGG + Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916344764 1:163775336-163775358 CACGGGAGTCAGAGGGAGCTGGG + Intergenic
916967272 1:169962544-169962566 AAAAGGAGTTAGAGGGATGCAGG + Intronic
917514165 1:175693278-175693300 CAAGGGAGACAGGTGGATGGTGG - Intronic
918093496 1:181316797-181316819 GAAGGGAGTCACAGGGAAGGAGG - Intergenic
918629462 1:186698959-186698981 AAAGGGAATCAAGGGGATGCTGG + Intergenic
921606997 1:217167461-217167483 CAAGGGGATCTGAGAGATGCAGG + Intergenic
922060888 1:222090265-222090287 CGATGGAGTCAGAGGGATGAGGG + Intergenic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
924846797 1:247782530-247782552 CAAGGGAGACAGATGTAGGCTGG + Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063422427 10:5923944-5923966 CCAGGCAGACAGAAGGATGCAGG - Intronic
1065437486 10:25717677-25717699 TAAGGGAGACAGAGGAATGGAGG - Intergenic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1073081377 10:100863110-100863132 CATGGGAGTCAGAGTGTTGAGGG + Intergenic
1073496475 10:103896089-103896111 AAAGGGAGTGAGAGGGAGGATGG + Intronic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1078352344 11:10604556-10604578 CAAGGGTGTGAGAGAGGTGCTGG + Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1081806213 11:45892194-45892216 CGAGGGCCTGAGAGGGATGCTGG + Intronic
1081878838 11:46430416-46430438 AATGGGAGTCAGAGGGACCCAGG - Intronic
1081979459 11:47257553-47257575 CAAGGGAGGAGGAGGGAGGCTGG + Intronic
1082659682 11:55894904-55894926 CAAAGGAGTCCCAGGGATTCGGG - Intergenic
1084116325 11:67044952-67044974 GAAGGGGGTCAGAGTGATGCGGG + Intronic
1084289570 11:68153130-68153152 GAAGGGAGGCAGAGCGCTGCTGG - Intergenic
1085749629 11:79150086-79150108 GAGGCGAGTCAGAGGGATCCTGG - Intronic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086929824 11:92680864-92680886 AATGGGAGTCAGAAGGATCCAGG - Intronic
1090486280 11:127115243-127115265 GAAGGTAGCTAGAGGGATGCAGG - Intergenic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1092229599 12:6769219-6769241 CAAGGGAGGCGGAGGGACACAGG + Intronic
1092905751 12:13099205-13099227 AAAGGAAGTGAGTGGGATGCTGG - Intronic
1095310126 12:40688745-40688767 CTAGGGAGTCAGAGCCATCCAGG + Intergenic
1096877912 12:54644883-54644905 CACAGAAGTCAGAGGGATGGAGG + Intronic
1096975613 12:55697860-55697882 CAGGGGAGGCAGAGGCCTGCGGG - Intronic
1098060144 12:66553333-66553355 CAAGGGAGGGAGAGGGAAGGAGG - Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1098600813 12:72329927-72329949 TAAGGGAATCAGAGAGATGAGGG + Intronic
1100149292 12:91715843-91715865 AAAGGGGGTCAGAGAGATGGAGG + Intergenic
1100186481 12:92145355-92145377 CGAGGGCGTCGGAGGGACGCGGG - Intronic
1101428346 12:104606131-104606153 CAAGGGATTTAGAGGAATTCTGG + Intronic
1102536275 12:113583695-113583717 CAAGTGAGTCAGTGAGAGGCTGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103326956 12:120128101-120128123 TAAGGGAATCAGATGGATCCAGG + Intronic
1103859882 12:124003749-124003771 TGAGGGAGTCAGAGGGAAGATGG + Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104737252 12:131143232-131143254 GAAGGAAGTCAGAGGGCGGCAGG - Intergenic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1106199947 13:27527838-27527860 CAAGGGTGGCAGAGGCAGGCAGG - Intergenic
1106375037 13:29177891-29177913 CCAGGGAATCTGAGGGATCCTGG - Intronic
1109343438 13:61089607-61089629 TAAGGGAGACAGAGGAATGGAGG - Intergenic
1111757763 13:92420621-92420643 TAAGGGGGTGAGAGGGAGGCAGG - Intronic
1112524559 13:100132270-100132292 CAAGGGAGTCTGAGGGGTAATGG - Intronic
1113066321 13:106376821-106376843 CAAGGGAGACAGATGGATTAGGG - Intergenic
1113554804 13:111224207-111224229 CAAGGGAGTAAGAGTGAGGGTGG - Intronic
1113804533 13:113105746-113105768 CAAGGGTGACAGAGGGATGGGGG - Intergenic
1114186081 14:20403604-20403626 AAAGGGAGTCAGAGAAATGCAGG - Intronic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1121506911 14:94484533-94484555 CATGGGCCACAGAGGGATGCTGG - Intergenic
1122874257 14:104656295-104656317 CATGGGAGCCGGCGGGATGCTGG - Intergenic
1122900084 14:104778772-104778794 CAAGGGAGTCGGAGGACCGCAGG + Intronic
1123760102 15:23425283-23425305 CAAGGGAGGCACAGAGAGGCTGG - Intergenic
1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG + Intergenic
1124746551 15:32345721-32345743 GAGGGGAGAAAGAGGGATGCAGG - Intergenic
1126511916 15:49486889-49486911 CAAATGAGTAAGAGGGATGGAGG - Exonic
1126541012 15:49824099-49824121 CGAAGGAGTGAGATGGATGCAGG + Intergenic
1127289234 15:57555291-57555313 TGAGAGAGTCAGAGGGGTGCAGG + Intergenic
1128702575 15:69814940-69814962 CAAGGGACCAAGAGGGATGCAGG + Intergenic
1129169675 15:73799959-73799981 CAAGGGAGTGAGAGGTCAGCAGG - Intergenic
1129239591 15:74243574-74243596 GAAGGGTGACAGAGGGAGGCAGG + Intronic
1130059306 15:80558199-80558221 CAAGGGACTTAGAAGGAGGCTGG - Intronic
1130075248 15:80683320-80683342 CAAGAGAGTCAGACAGAAGCTGG + Intronic
1130687748 15:86053815-86053837 GCAGAGACTCAGAGGGATGCAGG + Intergenic
1132378016 15:101344572-101344594 CAAGGGAGTCTGTGGGGTGGAGG + Intronic
1134512599 16:14860398-14860420 CAAGGGAGTGATAGGGATCATGG + Intronic
1134700237 16:16258893-16258915 CAAGGGAGTGATAGGGATCATGG + Intronic
1134971590 16:18535766-18535788 CAAGGGAGTGATAGGGATCATGG - Intronic
1135060425 16:19266857-19266879 CTAGGGAGCCAGAGGGTTGAGGG - Intronic
1138341157 16:56289891-56289913 CAAGAGAGGCAGTGGGAAGCTGG - Intronic
1138673728 16:58635964-58635986 CCAGGGAATCAGAGGGATTGGGG - Intergenic
1140772964 16:78222962-78222984 GAGGGGAGCCAGAGGAATGCAGG + Intronic
1141097234 16:81171507-81171529 CAAGGCAGACAGAGGTCTGCAGG - Intergenic
1141251599 16:82363880-82363902 CAATGGAGTCAGAGGCTTGCAGG + Intergenic
1141279857 16:82621545-82621567 CAAGGTAGCCAGAGGTATGAAGG - Intergenic
1141677192 16:85524077-85524099 CCCGGAAGTCAGAGGGATGAGGG - Intergenic
1141686278 16:85571732-85571754 CAAGGGAGGCAGAGGCGTGGGGG + Intergenic
1142644693 17:1304293-1304315 GGAGGGAGACAGAGGGATGGAGG - Intergenic
1142848848 17:2694738-2694760 CCAGGGAGTCAGAGAGAAGAGGG - Intronic
1143138050 17:4723113-4723135 CACGGGAGTCGGAGGGATGCTGG - Intergenic
1143305343 17:5942052-5942074 CAAGGGAATCAGAAAGCTGCTGG - Intronic
1146055724 17:29580059-29580081 CAAGAGAGGCAGAGGCATGGAGG - Intronic
1146722535 17:35133244-35133266 AAAGGGAGGCAGAGGAAGGCAGG + Intronic
1149102520 17:52923052-52923074 CAAAGGAGTCCTAGGGATTCAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149592249 17:57839013-57839035 CCAGGGAGGCAGGTGGATGCTGG + Exonic
1150001711 17:61444451-61444473 CTAAGGAGTCAGAGGCACGCTGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150915324 17:69430687-69430709 CAATGGAGTCAGAGGAAAACAGG + Intronic
1151033008 17:70763579-70763601 CAAGGATGCCAGAGGAATGCAGG + Intergenic
1152408707 17:80111434-80111456 CATGGGGGTCAGGGGGATTCTGG + Intergenic
1155932769 18:31724368-31724390 CCAGGGAGTCAGAGGTCAGCTGG - Intergenic
1156722475 18:40086928-40086950 CAAGGGAGCAGGAGGGAAGCAGG + Intergenic
1156798761 18:41081894-41081916 CAAGGGAGTTACAGGGCTTCTGG + Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157786966 18:50492307-50492329 CAAGGGAGGCTTTGGGATGCAGG + Intergenic
1158424855 18:57329724-57329746 CTAGGGAGGCAGAGAGAAGCAGG + Intergenic
1161278739 19:3433833-3433855 CCAGGGAGGAGGAGGGATGCTGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162568065 19:11454913-11454935 CAACGGGGTCAGAAGCATGCGGG - Intronic
1164404978 19:27936575-27936597 CAAGGGAGGCGGTGGGGTGCGGG + Intergenic
1166082399 19:40452188-40452210 CAAGGACGTCAGAGGGCTGATGG - Intronic
925858955 2:8156699-8156721 CAAAGGTGACAGAGGGATGCGGG + Intergenic
927279660 2:21293172-21293194 CTAGGGAGTAAGAGTGATACAGG - Intergenic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
929247803 2:39721591-39721613 CAAGGTAGGCAGAGGCTTGCTGG + Intergenic
929896681 2:45966913-45966935 CCAGGGAGATAGAGAGATGCAGG + Intronic
929981450 2:46683933-46683955 CAAGGGAGTCAGAGGAATTGAGG - Intergenic
932127375 2:69156325-69156347 AAAGGGAGGGAGAGGGATGCTGG - Intronic
932496936 2:72150214-72150236 CAAGGGGGGCTGAGGGAAGCAGG - Intergenic
932963847 2:76447191-76447213 TAAGGAAGACAGAGGGAAGCAGG - Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
935814196 2:106831213-106831235 CAAGGGAGCAAGAGGAATGTGGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936757566 2:115733346-115733368 CATGGGAGTCACAGGAAGGCAGG + Intronic
937727663 2:125186555-125186577 AAAAGGAGTCACAGGGATTCAGG + Intergenic
937986551 2:127640626-127640648 CAAGGGAGGGAGGGGGTTGCTGG + Intronic
939456324 2:142441564-142441586 CACGGGAGACAGAGCGATGGGGG - Intergenic
940567613 2:155387774-155387796 CAAGGAAGTCAGTGAGATGGGGG - Intergenic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
941936037 2:170982095-170982117 GAAGGGAGACAGAGGAATGGAGG + Intergenic
942526188 2:176855611-176855633 CAAGGCAGCCAGAGAGAAGCAGG + Intergenic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947389611 2:229625514-229625536 CAAGGGAGACGGAGGGGAGCGGG + Intronic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
948525890 2:238570564-238570586 CAAGGGATGCAGGGGGCTGCGGG + Intergenic
1168856487 20:1012843-1012865 CGAGGGAGGCAGAGGGAGGGAGG + Intergenic
1168890093 20:1289556-1289578 CAATGGAGTCAGGGGCATGGTGG + Intronic
1169648792 20:7843746-7843768 CAAGGGAGTCAGAAGGAGTTGGG - Intergenic
1169924984 20:10773806-10773828 CAAAGGAGTAGGAGTGATGCAGG - Intergenic
1170601183 20:17842974-17842996 GAAAGCAGGCAGAGGGATGCTGG - Intergenic
1170627991 20:18044121-18044143 CAGGGGAGGCATAGGTATGCTGG - Intronic
1171531472 20:25856255-25856277 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171532890 20:25863754-25863776 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1172198879 20:33111560-33111582 CAAGGGAGGAAGAGGGTTGGGGG - Exonic
1172922702 20:38499162-38499184 CAAGGGGGACAGAGGGACACAGG - Intronic
1173140116 20:40474588-40474610 CAAGGTAGTGAGAGGGGAGCTGG - Intergenic
1173307231 20:41862301-41862323 CCAGAGAGTCAGAGGGATAGCGG - Intergenic
1173406871 20:42773952-42773974 GAGAGGAGTCAGAGGCATGCTGG - Intronic
1175290729 20:57873367-57873389 CAACACAGTCAGAGGGATGGGGG + Intergenic
1175391228 20:58628640-58628662 CCTAGAAGTCAGAGGGATGCAGG - Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176793739 21:13353025-13353047 CAAATGAGTAAGAGGGATGGAGG - Intergenic
1176887742 21:14276111-14276133 GAAGGGAGGCAGAAGGATGTGGG + Intergenic
1177896151 21:26857711-26857733 AGAAGGAGTCAGGGGGATGCTGG - Intergenic
1178095802 21:29213553-29213575 CAAGGAATGCAGAGGGTTGCAGG - Intronic
1178619575 21:34161870-34161892 CAAAGGAGTCCCAGGGATTCAGG + Intergenic
1179979478 21:44888760-44888782 AGAGGGACTCAGAGGGCTGCTGG - Exonic
1180320005 22:11311157-11311179 GAAGGGAGAGAGAGGGAGGCAGG - Intergenic
1180620512 22:17158935-17158957 CCAGCGAGTCAGAGGAAGGCAGG + Intronic
1180639917 22:17290313-17290335 CAAGGGAGGCAGTGGGGTGGAGG - Intergenic
1182014976 22:27032109-27032131 CAAGGGAGACAGAGAGAAGCTGG + Intergenic
1182150462 22:28023741-28023763 CAAGGGAGTTAGATGGATGAGGG + Intronic
1183259590 22:36785887-36785909 CAAGCAAGGCAGAGGAATGCCGG - Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183778768 22:39985193-39985215 CAGGGGTGTCAGAGGCATCCCGG + Intergenic
1184239346 22:43203770-43203792 GAAGGGAGGCAGAGGGAGGGAGG + Exonic
1185111923 22:48905078-48905100 CGAGAGGGTGAGAGGGATGCGGG - Intergenic
1185111939 22:48905143-48905165 CGAGAGGGTGAGAGGGATGCGGG - Intergenic
1185192929 22:49450202-49450224 CAAGGGAAGCAGAGAAATGCAGG + Intronic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949413510 3:3792567-3792589 CAAGGGAAGCAGAGGAATGTAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
952337243 3:32414569-32414591 CATGGGAGGAAAAGGGATGCTGG + Intronic
952713740 3:36457251-36457273 CCAAGGAGTCAGAGGGTTGGTGG + Intronic
953245700 3:41189890-41189912 TAAGGGACTCAGAGGGAACCAGG - Intergenic
953409773 3:42684160-42684182 CAAGTGACTCAGAGGAATGATGG + Intergenic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953948122 3:47165883-47165905 CTAGGGAGTCAGATGGACCCTGG - Intergenic
955871392 3:63442117-63442139 AAAGGGAGTAAGAGAGATGATGG + Intronic
955973178 3:64456229-64456251 CAAGGCAGAGAGAGGGATGAAGG + Intergenic
959905158 3:111703201-111703223 AAAGGGGGTTGGAGGGATGCAGG + Intronic
962274060 3:133999017-133999039 CAATGGAGTCAGAGCTAGGCAGG - Intronic
962938295 3:140101910-140101932 CAAGGGAGGCAGGGGCATGTAGG + Intronic
965205748 3:165717959-165717981 CAAGGGGGTCCCAGGGATTCAGG + Intergenic
966266743 3:178055113-178055135 CTTGGGAGTCAGAGAGATGGGGG + Intergenic
966600848 3:181773720-181773742 CTAGGGAGTCAGAGCCATGTGGG - Intergenic
966726693 3:183115109-183115131 CAAGGCCGTCAGAGGGGTGCCGG - Intronic
966948497 3:184795245-184795267 CTAGGGAGTTAGAGGATTGCTGG + Intergenic
967236008 3:187384271-187384293 CAAGGGATCCTGTGGGATGCTGG - Intergenic
967740339 3:192996926-192996948 TAAGGGAGACAGAGGAATGGAGG - Intergenic
968800663 4:2741533-2741555 CAAGGGGGTCAGTGGGAGCCTGG - Intergenic
968928024 4:3560196-3560218 CAAGTGAGTCACAGGGAACCAGG - Intergenic
969105394 4:4803673-4803695 CAAGGGAGTCAGATGGCCTCAGG + Intergenic
969515315 4:7644517-7644539 CAAGGGAGTCCAAGTGATGCTGG + Intronic
970143605 4:13009900-13009922 CAAGGGAGGCTGGGAGATGCTGG - Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971041032 4:22752439-22752461 CTAGGGAGTCAGATGGATGATGG + Intergenic
971394495 4:26215807-26215829 CAAGGAGGTGAGAGGGATGCGGG - Intronic
973648828 4:52977079-52977101 CAAGGAAGTTAGAGTGATACGGG - Intronic
975475838 4:74822224-74822246 CAAGCATTTCAGAGGGATGCTGG + Intergenic
977254492 4:94725851-94725873 CAAGGGAGTCAGGGGGGAGAGGG - Intergenic
978448775 4:108806351-108806373 CAAGGAACTCAGAGCCATGCTGG + Intergenic
978909458 4:114047456-114047478 AGAAGGAGTCAGGGGGATGCTGG - Intergenic
980304482 4:131040164-131040186 CAAGAGAGCAAGAGAGATGCTGG + Intergenic
980767952 4:137332536-137332558 CAAGAGAGACAGAGGGAAGTTGG + Intergenic
982399652 4:154952992-154953014 CAAAGGAGTCCCAGTGATGCAGG + Intergenic
983166418 4:164482345-164482367 ACAGGGAGTCAGAGGGAGGGTGG + Intergenic
985944911 5:3173110-3173132 AAAGGGAGCAAGAGGGATGAGGG - Intergenic
986094862 5:4544531-4544553 CAAGGGAGGCAGAGTGCTCCGGG - Intergenic
986640805 5:9870106-9870128 CAAGGGAGTCAGAGGAAGAGAGG - Intergenic
988405167 5:30815007-30815029 CAAGGGAGACAGATGTAGGCTGG + Intergenic
988957279 5:36332211-36332233 GGAAGGAGTCAGGGGGATGCCGG + Intergenic
989820908 5:45795264-45795286 CAAGGGGGTCTCAGGGATTCAGG - Intergenic
992965614 5:81997000-81997022 CACTGGTGTCAGAGGGATGCTGG - Intronic
993124682 5:83819080-83819102 GAAGGGAGAGAGAGGGATGGGGG - Intergenic
994989402 5:106979649-106979671 CAAGGGAGTAGGAGGAATGGAGG - Intergenic
995709903 5:115024887-115024909 CCAGGAAGTCAAATGGATGCTGG + Intergenic
998397023 5:141825273-141825295 CAATGCAGTCAGAGGGAAGGGGG + Intergenic
999147961 5:149408133-149408155 CAGGGGACTTAGAGGAATGCAGG + Intergenic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
1000104281 5:158044053-158044075 GAAGGAAGTCAGTAGGATGCAGG + Intergenic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002919263 6:1554844-1554866 CAAGGGAGGCACAGGGACTCCGG - Intergenic
1004426836 6:15512424-15512446 CACGGCACTCACAGGGATGCGGG - Intronic
1005527230 6:26662893-26662915 CAAGCAAGTCAGAGGCATGCAGG + Intergenic
1005850423 6:29816768-29816790 CCAAGGGGTCTGAGGGATGCTGG - Intergenic
1005863030 6:29916028-29916050 CCAGGGGGTCTGAGGGACGCTGG - Intergenic
1006056130 6:31385681-31385703 CCAGGGGGTCTGAGGGATGGTGG + Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1007517987 6:42428837-42428859 GAAGGGAGGGAGAGGGAGGCAGG - Intronic
1007687469 6:43675453-43675475 CAAGAGGGGCAGAGGGCTGCAGG - Intronic
1009242948 6:61202066-61202088 CAAAGGAGTCTCAGGGATTCAGG + Intergenic
1011539963 6:88418519-88418541 GGAAGGAGTCAGGGGGATGCTGG + Intergenic
1013292604 6:108732289-108732311 CATGGGAGGCAGAGGAATGGTGG - Intergenic
1014024171 6:116625727-116625749 CAAGGGAGTCAGAGGAAGCAAGG + Intronic
1015692107 6:135936989-135937011 GAAGGGAGTCAGAGTGAGGAGGG + Intronic
1018711415 6:166500424-166500446 CCAGGGAGTGAGAAGGAGGCAGG + Intronic
1018855272 6:167670157-167670179 CAACTGAGACAGAGGGAGGCTGG + Intergenic
1018898125 6:168035399-168035421 CCAGGGCGGCAAAGGGATGCCGG + Intronic
1019278231 7:187198-187220 CAAGGGTGGGAAAGGGATGCTGG - Intergenic
1022614984 7:31920175-31920197 CCAGGGAGTTAAAGGGAAGCAGG - Intronic
1024087714 7:45910397-45910419 CATGGGAGTCAAGGTGATGCAGG - Intergenic
1024491503 7:49990546-49990568 CAAAGGAGTCCCAGGGTTGCAGG - Intronic
1025284611 7:57651639-57651661 CGAGGGAGGCAGAGGGCTGATGG - Intergenic
1026103393 7:67401080-67401102 CCAAGGAGTCAGATAGATGCTGG + Intergenic
1026284966 7:68955025-68955047 GCAGGGAGACAGAGGGATGGGGG + Intergenic
1026362936 7:69619384-69619406 CTTGGAAGTCAGGGGGATGCAGG + Intronic
1027132297 7:75599497-75599519 CAAGGGAGTGAGTGGCAGGCGGG - Intronic
1029438956 7:100577019-100577041 GAAGGGAATTAGAGGGATGATGG + Intronic
1030337192 7:108340137-108340159 AGAAGGAGTCAGGGGGATGCCGG - Intronic
1030843594 7:114383435-114383457 GGAAGGAGTCAGGGGGATGCTGG + Intronic
1032192155 7:129771498-129771520 CAGGGGAGGCATGGGGATGCAGG - Intergenic
1033082205 7:138308983-138309005 GAAGGGGGTCAGTAGGATGCTGG - Intergenic
1033100708 7:138468880-138468902 CAAAGGAGCCAGAGAGATTCGGG - Intronic
1034942119 7:155237380-155237402 CAAGGGAGCCAGGGTGCTGCTGG + Intergenic
1035883273 8:3266210-3266232 CCAGGGAGTCAGGGGGCTCCCGG + Intronic
1036073808 8:5472693-5472715 CCAGGGAGTGAGAGGGTTTCAGG - Intergenic
1037026425 8:14043885-14043907 AGAGAGAGTCAGAGAGATGCAGG - Intergenic
1037466845 8:19169235-19169257 CATGGGAGTCAGAGGAAAACGGG + Intergenic
1037563394 8:20095250-20095272 CATCTGTGTCAGAGGGATGCAGG + Intergenic
1037614660 8:20507892-20507914 CAAAGCAGTCCGAGGGCTGCTGG - Intergenic
1039045290 8:33444099-33444121 CAAAGGAGTAAGAGGGCTTCAGG + Intronic
1039609098 8:38904766-38904788 CACTGGAGTTAGAGGGATGGAGG + Intronic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1039840014 8:41286446-41286468 CAAGGGAGGCAGAGGGAGTGTGG + Intronic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1045343976 8:101278089-101278111 CAAGGGAGTCAGAGGAGTTCTGG + Intergenic
1045650311 8:104336194-104336216 CAAGGAAGGGAGAGGGCTGCAGG + Intronic
1048798790 8:138176850-138176872 CAAGGCAGTGAGAGGGTTGAGGG - Intronic
1048933843 8:139339108-139339130 CCAAGCAGTCAGAGGGATGCCGG + Intergenic
1050144621 9:2553535-2553557 CCAGGGTTTCAGAGGGAGGCAGG + Intergenic
1050929730 9:11308130-11308152 CAAAGGAGTCTGAGGGGTTCAGG - Intergenic
1051697819 9:19788573-19788595 CAAACGACTCAGGGGGATGCGGG - Intergenic
1053802882 9:41775277-41775299 CAAGTGAGTCACAGGGAACCAGG - Intergenic
1053884205 9:42629202-42629224 CAAATGAGTAAGAGGGATGGAGG - Intergenic
1053888463 9:42665092-42665114 CAAATGAGTAAGAGGGATGGAGG + Intergenic
1054142364 9:61539793-61539815 CAAGTGAGTCACAGGGAACCAGG + Intergenic
1054191187 9:61986623-61986645 CAAGTGAGTCACAGGGAACCAGG - Intergenic
1054223225 9:62436648-62436670 CAAATGAGTAAGAGGGATGGAGG - Intergenic
1054227485 9:62472539-62472561 CAAATGAGTAAGAGGGATGGAGG + Intergenic
1054647182 9:67601094-67601116 CAAGTGAGTCACAGGGAACCAGG + Intergenic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1055260069 9:74423857-74423879 AAAAGGAGGAAGAGGGATGCTGG - Intergenic
1057432053 9:95004366-95004388 CACGGCAGTCTGAGGGCTGCGGG + Intronic
1059177505 9:112180695-112180717 AAAGGGAGGGAGAGGTATGCTGG - Intergenic
1059431283 9:114251890-114251912 CAAGGCACTCAGAGGGTTGTAGG - Intronic
1061342883 9:129997214-129997236 CTCGGGAGTCTGAGGGAGGCAGG + Intronic
1061673748 9:132203800-132203822 CCTGGGAGTCAGAGGGAAGGGGG + Intronic
1061842321 9:133366474-133366496 CCAGGCAGTCAGAGACATGCAGG + Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1185989349 X:4875706-4875728 CAAGGGAGAAAGATGGAGGCTGG - Intergenic
1186601018 X:11037375-11037397 CAATGGAGTCAGAGAGATCAGGG + Intergenic
1186776047 X:12865642-12865664 GGAGGGAGCCAGAGGGAGGCAGG + Intergenic
1187290976 X:17952796-17952818 CAAGGGAGACTGGGTGATGCAGG + Intergenic
1190327224 X:49214027-49214049 CTAGGGAGTGAGAGGGACTCAGG - Intronic
1191258899 X:58292001-58292023 CCAGGCTTTCAGAGGGATGCTGG + Intergenic
1192439459 X:71164095-71164117 CAATGAAGGCAGAGGGATGGAGG - Intronic
1194059690 X:89181737-89181759 CAAAGGAGTCAAAGGGGTTCAGG + Intergenic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196002067 X:110796327-110796349 CAGGGGAGTCAGAGGGTAGTCGG - Intergenic
1196811027 X:119629148-119629170 CAAAGGTGCCACAGGGATGCTGG + Intronic
1200022822 X:153226197-153226219 CCAGGGAGAGAGAGGAATGCAGG + Intergenic
1200082844 X:153587651-153587673 GCAAGGAGTCAGAGGGGTGCTGG + Intergenic
1201321104 Y:12699413-12699435 CAAGGGAGTCCCAGTGATTCAGG + Intergenic