ID: 1157241767

View in Genome Browser
Species Human (GRCh38)
Location 18:46016567-46016589
Sequence GTCTCCTCCATTAGACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157241767 Original CRISPR GTCTCCTCCATTAGACTCTG AGG (reversed) Intronic
900018850 1:172664-172686 GTCTCCTCCACTGGATTGTGAGG + Intergenic
900049106 1:531259-531281 GTCTCCTCCACTGGATTGTGAGG + Intergenic
900071336 1:773083-773105 GTCTCCTCCACTGGATTGTGAGG + Intergenic
900330611 1:2132778-2132800 GTTTCCACCCTTAGTCTCTGAGG + Intronic
902916433 1:19642858-19642880 CTTTCCTCCATTAGACCTTGAGG - Intronic
904391596 1:30189623-30189645 CCCTCCTCCACTAGACTCTAAGG + Intergenic
905477971 1:38242197-38242219 GCCTCTTCAATTAGGCTCTGAGG - Intergenic
905934905 1:41815636-41815658 GCCTCCTCCATGGGCCTCTGAGG - Intronic
908352375 1:63298975-63298997 GTCTGCTCCATCAGACCCTATGG + Intergenic
909960601 1:81836328-81836350 GCCTCCTCATTTAGCCTCTGAGG - Intronic
910244137 1:85120740-85120762 GTCTGCTTCCTTAGACTGTGAGG + Intronic
910445802 1:87298052-87298074 GTCTCTCCCACTAGACTCTAAGG + Intergenic
911946792 1:104120921-104120943 GTCTCTTCCACTATACTGTGAGG + Intergenic
916165885 1:161967132-161967154 GTCTCTTCCATGGGACTATGTGG + Intergenic
918881277 1:190124914-190124936 GTCACCTTCATGACACTCTGTGG - Intronic
922106699 1:222518532-222518554 GTCTCCTCCACTGGATTGTGAGG + Intergenic
924348881 1:243096098-243096120 GTCTCCTCCACTGGATTGTGAGG + Intergenic
1063142417 10:3267368-3267390 GTCTCCTCCACTTTCCTCTGCGG + Intergenic
1063163200 10:3434945-3434967 GTCTCTTCCATTAGCCTCTCTGG + Intergenic
1064086215 10:12348736-12348758 GTCTCCTCCCAGAGACTCAGTGG - Intergenic
1065443868 10:25777455-25777477 ATCTCCTCCATTGGATTATGAGG + Intergenic
1066621119 10:37351608-37351630 CTCTCCTCCAATATACTATGAGG + Intronic
1066727484 10:38408805-38408827 GTCTCCTCCACTGGATTGTGAGG - Intergenic
1067174014 10:43929969-43929991 GTCTCTTCCTTTAGAGACTGTGG + Intergenic
1076975450 11:167860-167882 GTCTCCTCCACTGGATTGTGAGG + Intronic
1078007973 11:7546898-7546920 GTCTCTTCCACTAGATTGTGTGG + Intronic
1079908780 11:26283758-26283780 GTCTCCTCCATTAGAATTTAAGG - Intergenic
1081500409 11:43661015-43661037 TTCTCCTCCCTCAGCCTCTGGGG - Intronic
1085764027 11:79266877-79266899 GTCTCTCCCATAAAACTCTGTGG - Intronic
1087896160 11:103589219-103589241 GTCTCCCCCACTAGACTATGAGG - Intergenic
1088636442 11:111825687-111825709 GTTTCTTCTACTAGACTCTGAGG + Intronic
1089386641 11:118072726-118072748 GTCTCCTTCAGTAGACTGTAGGG + Intergenic
1089389885 11:118093525-118093547 GGCTCCTCCATGTGACTCTGTGG + Intronic
1090652537 11:128820118-128820140 GTGTCCTCCATTAGACAATAAGG + Intergenic
1091334055 11:134753528-134753550 GTCACCTCCAGGACACTCTGGGG - Intergenic
1091392135 12:132039-132061 GTCTCCTCCACTAATCTTTGTGG - Intronic
1093091989 12:14932193-14932215 GTCTCCTCTATTACCCTCTTAGG - Intronic
1093784660 12:23178208-23178230 GGCTACTCCAGTAGGCTCTGAGG + Intergenic
1096997191 12:55845995-55846017 CTCTCCTCCATTATCCTCTCTGG - Intergenic
1100214758 12:92435850-92435872 GCCTTCTCCACTAGACTGTGAGG + Intergenic
1100448562 12:94683549-94683571 GTCTCTGCCTTTAGAGTCTGTGG - Intergenic
1100651540 12:96595231-96595253 GTCTCCTCCAGTATGCTGTGAGG + Intronic
1103278242 12:119732122-119732144 ATCTCCTCCAGTAGACTCTTAGG + Intronic
1104653874 12:130558599-130558621 GTCTCTTCCCTTTGTCTCTGGGG - Intronic
1104896513 12:132167531-132167553 ATCTCCTCCCTTGGATTCTGTGG - Intergenic
1105267267 13:18832074-18832096 GTCTCCTCTATTAGACTAATTGG + Intergenic
1105742929 13:23347638-23347660 GCCTTCTCCATTAGACTGTAGGG - Intronic
1106299380 13:28450163-28450185 GTCTGCTCAGCTAGACTCTGAGG - Intronic
1106411233 13:29513043-29513065 GTCTCCTGAAGTAGACTCAGTGG + Exonic
1107553461 13:41497596-41497618 GTCTCCTCCGTTAGACCATGAGG + Intergenic
1108704112 13:52969594-52969616 GGAGACTCCATTAGACTCTGGGG - Intergenic
1111870467 13:93825550-93825572 CTCTTCTGCATTAGACTGTGAGG - Intronic
1112352298 13:98646301-98646323 TTCTCCTCCTTTAGAATGTGGGG + Intergenic
1112357563 13:98686720-98686742 ATCTCCTTTATTAGACTGTGAGG + Intronic
1114737671 14:25059383-25059405 TTCTCCTGCATCAGACTGTGAGG - Intergenic
1118505324 14:66404678-66404700 GTCTCCTGAATCAGACTCTCTGG + Intergenic
1119347311 14:73936891-73936913 TTCTACTGCATTAGGCTCTGTGG - Intronic
1119874504 14:78045995-78046017 GTCTCCTCCCCTTGAATCTGGGG + Intergenic
1121807280 14:96840171-96840193 GTCTCCTCCATTTTACTCCTAGG + Intronic
1122741279 14:103872766-103872788 GTCTCCACCAACAGAATCTGTGG + Intergenic
1127067281 15:55253337-55253359 TTCTCCTGCCTTAGCCTCTGGGG - Intronic
1127748783 15:62009851-62009873 GTCTCTTCCATTAAAAACTGAGG + Intronic
1128734802 15:70047266-70047288 GTCTCCTCCATAAGCCTGAGAGG + Intergenic
1131678340 15:94694809-94694831 GTCTCCTCAATTAGCTTCTGTGG - Intergenic
1133691730 16:8222095-8222117 ATCTAATCCTTTAGACTCTGTGG + Intergenic
1133782352 16:8949422-8949444 TTCTTCTCCACTAGACTTTGAGG - Intronic
1134244334 16:12528731-12528753 GGCCCCTCCATTTGAATCTGTGG + Intronic
1136507130 16:30711821-30711843 GTCTTACCCTTTAGACTCTGTGG + Exonic
1136649948 16:31660500-31660522 GTCTCATTCCTTTGACTCTGCGG + Intergenic
1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG + Intergenic
1137048152 16:35687186-35687208 GTCTCTTCCATTAGAATGCGTGG + Intergenic
1138022189 16:53494804-53494826 CTCTCCTCCACTAGAGCCTGAGG + Intronic
1140724286 16:77798188-77798210 TTATCCTGCATTAGGCTCTGGGG - Intronic
1141444243 16:84047845-84047867 GTTTCCTCCATTGGACACAGTGG - Intergenic
1142444810 16:90129799-90129821 GTCTCCTCCACTGGATTGTGAGG - Intergenic
1142462701 17:105667-105689 GTCTCCTCCACTGGATTGTGAGG + Intergenic
1144294760 17:13863251-13863273 CTCTCCTCCATTAGAAAATGTGG - Intergenic
1144756700 17:17683823-17683845 TTCTCTTCCACTAGACTGTGGGG + Intronic
1148041314 17:44709408-44709430 GTCTTCTCCAAGAGACCCTGGGG - Intronic
1150932765 17:69603152-69603174 GTCTCCCCCACTAGACTGTGAGG - Intergenic
1152586553 17:81191955-81191977 GGCTCCCCCCTTAGCCTCTGGGG - Intronic
1153823128 18:8849467-8849489 TTCTCCTCCACTGGACTCTGAGG - Intergenic
1154421144 18:14229355-14229377 GTCTCCTCTATTAGACTAATTGG - Intergenic
1157025987 18:43844290-43844312 GTCTCCTCCATTAGATTATAAGG + Intergenic
1157114981 18:44854085-44854107 GTCTCCCCTAATAGACTCTTGGG + Intronic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1157728894 18:49987005-49987027 GTCTCCTCCTTTGGAGTCTCAGG - Intronic
1160652406 19:238043-238065 GTCTCCTCCACTGGATTGTGAGG + Intergenic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162519991 19:11174077-11174099 ATCTCCTCCATCAGACTAGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162888227 19:13712407-13712429 GTTTCCTTCATTAGGCTCTCAGG - Intergenic
1163023701 19:14497081-14497103 GTCTCCTCCATCTGACTGTGAGG + Intergenic
1163138889 19:15332832-15332854 GCCTCCTCCATCAGTCTGTGGGG - Intergenic
1164371490 19:27647846-27647868 GTCTCTTCCATTAGAATGTCTGG + Intergenic
1164374666 19:27674490-27674512 GTCTCCATCATTAGACTGTCTGG + Intergenic
1164374922 19:27676162-27676184 GTCTCTTTCATTAGAATGTGGGG + Intergenic
1164375185 19:27677930-27677952 GTCTCTTCCATTAGAATGTGGGG + Intergenic
1164376288 19:27691095-27691117 GTCTCTCCCATTAGAATGTGTGG + Intergenic
1164381128 19:27737921-27737943 GTCTCTCCCATTAGAATGTGTGG + Intergenic
1164384388 19:27760777-27760799 GTGTCTTCCATTAGAATGTGTGG + Intergenic
1164384526 19:27761692-27761714 GTCTCCCCCATTAGAATGTGTGG + Intergenic
1167441278 19:49510592-49510614 GGCTCCCCCATTAGACTTTGGGG + Intronic
1167593101 19:50415000-50415022 GCCTCCTCCCTCAGACTCAGGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
927036874 2:19187300-19187322 GTCTCTTCCACTAGACTCTGAGG + Intergenic
929246977 2:39712748-39712770 CTCTCCTCCATTCTTCTCTGAGG - Intronic
929297152 2:40261230-40261252 GTCTCTTCCATAAGAAACTGGGG + Intronic
931642562 2:64394802-64394824 GTCTCTGCCACTAGACTATGGGG + Intergenic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
932556163 2:72826337-72826359 GTCTCCCCCACTAGACTGTAAGG - Intergenic
935955976 2:108377101-108377123 GTCTCCTTCACTACACTCTAAGG - Intergenic
938654974 2:133422022-133422044 GTTTCCTCCACTAGAATCTGGGG - Intronic
944389600 2:199203757-199203779 GTTTCCCCCATTGGACTCCGAGG + Intergenic
946077108 2:217083462-217083484 GGCTCATCCATGGGACTCTGAGG - Intergenic
1170131355 20:13023359-13023381 GTCTCCACATTTAGACTGTGAGG + Intronic
1172073090 20:32272974-32272996 GTCTCCTCCCCAAGATTCTGGGG + Intergenic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1173554257 20:43954421-43954443 GCCTCCTGCAGTGGACTCTGAGG + Intronic
1174056807 20:47803755-47803777 GTCTCCACCCTTAGTCTCTGGGG + Intergenic
1174080095 20:47964886-47964908 GTCCCCTCCAATAATCTCTGAGG + Intergenic
1175468758 20:59210689-59210711 GACTCCTCCATTAGTCCATGGGG - Intronic
1176852332 21:13930604-13930626 GTCTCCTCTATTAGACTAATTGG + Intergenic
1178881097 21:36450645-36450667 GAATCTTCCATTAGACTCTAGGG - Intergenic
1179431546 21:41324715-41324737 TTCTTCTCTAGTAGACTCTGAGG - Intronic
1179716955 21:43293289-43293311 GCCTCCCCCATTAACCTCTGCGG + Intergenic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181048637 22:20228333-20228355 CTCTCCCCCATGGGACTCTGGGG + Intergenic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1184632054 22:45789456-45789478 CACTCTTTCATTAGACTCTGGGG - Intronic
950896945 3:16461284-16461306 ATCTCCTCAAATAGACTCTAAGG + Intronic
951953502 3:28228094-28228116 TTCTCTTTCATTAGACTATGAGG - Intergenic
952883278 3:37998434-37998456 GATTCCTCCCTTAGACCCTGGGG - Intronic
953125534 3:40088566-40088588 GTCTCCCATACTAGACTCTGAGG - Intronic
954696432 3:52429709-52429731 GTCTCCTCCAGTAGGCTCCTGGG - Intergenic
955342053 3:58132543-58132565 GTCTCCTTAATTATACTCTAGGG + Intronic
956032358 3:65052338-65052360 TTCTCCTCCCTCAGGCTCTGTGG - Intergenic
958489579 3:94754538-94754560 GTGTCCTCCATTAGAGTTTCAGG - Intergenic
959824319 3:110775118-110775140 GTCTTCTCCATGACACTCTATGG + Intergenic
961834605 3:129646601-129646623 ATCTCCTGCATAAGACTGTGGGG + Intergenic
962850976 3:139308184-139308206 GGCTGCTACACTAGACTCTGAGG - Intronic
964552783 3:157903640-157903662 GTCTTCTCCATCTCACTCTGGGG + Intergenic
965211707 3:165798035-165798057 ATCACCTCCATTAGACTTTAAGG + Intronic
968365427 3:198181929-198181951 GTCTCCTCCACTGGATTGTGAGG - Intergenic
969083414 4:4637748-4637770 GCCTCCCCCATTAGACTATGAGG + Intergenic
969241232 4:5899570-5899592 GTTTCCTCCTGTAGACTCTGAGG + Intronic
971960997 4:33486993-33487015 ACATCCTCCATTAGACTCTTGGG - Intergenic
972985592 4:44760645-44760667 GTCTCCTCCATGATTCCCTGGGG - Intergenic
973016715 4:45148958-45148980 TTCTCCTCCGTTAGTCTCTCTGG - Intergenic
973213475 4:47642264-47642286 GTCTCTTTCATTAGAGTCTACGG - Intronic
976793456 4:88906178-88906200 TTCTCCTGCATCAGCCTCTGGGG - Intronic
979254464 4:118597096-118597118 GTCTCCTCCACTGGATTGTGAGG - Intergenic
979334501 4:119448935-119448957 GTCTCCTCCACTGGATTGTGAGG + Intergenic
979477236 4:121172330-121172352 TCCTCCTCAATTTGACTCTGAGG - Intronic
980025864 4:127765649-127765671 GTGTCCTCCACTAGACTCTTAGG - Intronic
980215462 4:129847024-129847046 GTCTTTACCATTAGACTGTGGGG - Intergenic
981029484 4:140109887-140109909 CTCTCTTCCATTAGACTCAGTGG - Intronic
981055741 4:140359472-140359494 GTCACTTCCATTACACTCTCTGG + Intronic
981624347 4:146738772-146738794 GTGTCCTACCTTATACTCTGGGG + Intronic
982165490 4:152610034-152610056 GGCTACTGAATTAGACTCTGGGG + Intergenic
986643451 5:9893781-9893803 GTCTACTGAATAAGACTCTGTGG + Intergenic
986703255 5:10432384-10432406 GTCTCCTTCACTCAACTCTGTGG + Intronic
990025654 5:51184430-51184452 GTCTAATCCATTAGCCCCTGTGG - Intergenic
990301763 5:54455945-54455967 GTCTCCTCCAGTGGACTCAGCGG + Exonic
992121516 5:73598227-73598249 TTCTCCTGCCTCAGACTCTGGGG - Intergenic
997005476 5:129811822-129811844 GTCTCCCCCTTTAAACTCTGGGG - Intergenic
999432353 5:151535383-151535405 GTCTCCTGCCTTATACCCTGGGG + Intronic
1001319253 5:170666864-170666886 GTGTCCTCCAGCAGACTCTGAGG + Intronic
1002319662 5:178367527-178367549 GTCTCCTCCATTCAACACGGTGG - Intronic
1002971771 6:2030168-2030190 ATCTCCTCCACAAGAGTCTGTGG + Intronic
1006791074 6:36701709-36701731 GTCTCCTGCATGAGGCTGTGAGG + Intronic
1007729157 6:43935308-43935330 GTCTTTCCCATTAGACTCCGAGG - Intergenic
1007729828 6:43939070-43939092 GTTTCCTCCACTGGACACTGAGG - Intergenic
1008565562 6:52764650-52764672 CTCTCCTCCTTAAGGCTCTGTGG - Intergenic
1008686723 6:53933331-53933353 GTCTGCTGCATTTGACTCTGTGG + Intronic
1010749501 6:79602231-79602253 GTCTCATCCAGTAGACTCTAAGG - Intergenic
1011061897 6:83279074-83279096 GTCTCCTTAAATAGACTTTGAGG - Intronic
1012643717 6:101654017-101654039 GTCTCCTCGTTTAAACTGTGAGG + Intronic
1013466863 6:110425426-110425448 GTCTTCTCCACAAGATTCTGGGG - Intronic
1014531807 6:122568396-122568418 CTCTCCTCTATCACACTCTGGGG - Intronic
1015252311 6:131139872-131139894 GTCTTATCCATTAGATTCTAAGG - Intronic
1016916936 6:149252772-149252794 TTCTCCTCCTTTTGACTTTGAGG + Intronic
1018093073 6:160362580-160362602 GTTTCATGCATTAGACTCTCTGG + Intronic
1018360670 6:163064145-163064167 GTGTCTTCCAGTGGACTCTGAGG - Intronic
1019293995 7:264327-264349 GCCTCCTGCTTTAGACTCTGGGG - Intergenic
1019483852 7:1278923-1278945 GTCTCCGCCATTGTCCTCTGGGG - Intergenic
1020220689 7:6234394-6234416 TTTTCCTCCAATAGGCTCTGTGG - Intronic
1020361009 7:7326703-7326725 TTCTTCACTATTAGACTCTGAGG + Intergenic
1021937537 7:25646109-25646131 GTATTCTCCATTAGACTGTAAGG - Intergenic
1022462805 7:30627266-30627288 GGCTTCTCCATCACACTCTGGGG + Intronic
1022561125 7:31350871-31350893 GTCTCCCCTACTAGACTGTGAGG + Intergenic
1023948675 7:44823731-44823753 ATCTCCGCCTTTAAACTCTGAGG + Intronic
1024069556 7:45774762-45774784 GTCTCCTCCACTGGATTGTGAGG - Intergenic
1026790736 7:73329790-73329812 GTCTCCTCCACTACATTGTGAGG - Intronic
1030830769 7:114218079-114218101 GTTTTCTCTATTAGACTGTGAGG + Intronic
1032046941 7:128619048-128619070 GTCTCCTCCACTGGATTGTGAGG - Intergenic
1033522230 7:142172504-142172526 CTCTCATCCATTAGAATCAGAGG - Intronic
1038359044 8:26859518-26859540 GTCTCCTTAACTAGACTGTGAGG + Intronic
1040802963 8:51363757-51363779 GTCTCCTCCCTTAGTACCTGGGG + Intronic
1041294552 8:56341375-56341397 GTCTCCTGCTTCAGACCCTGGGG + Intergenic
1045410108 8:101908716-101908738 CTCTCCTCCATTGGACTATGTGG - Intronic
1048313502 8:133344563-133344585 GCCTTCCCCCTTAGACTCTGAGG + Intergenic
1048929815 8:139304932-139304954 GTCTCCTAAATCAGACTCTCAGG + Intergenic
1053079760 9:35165523-35165545 TTCTCCTGCCTTAGCCTCTGGGG + Intronic
1056196665 9:84235728-84235750 GTCACCCCCATGAGACTCAGAGG - Intergenic
1056361611 9:85863263-85863285 GTTGCCTCCACTAGACTCTGAGG + Intergenic
1056859847 9:90170880-90170902 GTCACCTCCACTACACTCTTTGG - Intergenic
1062749795 9:138244796-138244818 GTCTCCTCCACTGGATTGTGAGG - Intergenic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1189185805 X:39053739-39053761 CTTTTCCCCATTAGACTCTGAGG - Intergenic
1189865008 X:45318848-45318870 TTCTCCTGCATTATTCTCTGTGG + Intergenic
1191234859 X:58126167-58126189 GTCTCTTCCATTAGAATGTTTGG - Intergenic
1191237325 X:58144606-58144628 GTCTCTTCCATTAGAATCCCTGG - Intergenic
1191241308 X:58192083-58192105 GTCTCTTCCATTGGAATGTGTGG - Intergenic
1191246072 X:58229281-58229303 GTCTCTTTCATTAGAATGTGTGG - Intergenic
1191900977 X:66040323-66040345 GTCTCCTCCACAAGATTCAGAGG + Intergenic
1192545153 X:72006878-72006900 GTCTCTCCCACAAGACTCTGAGG + Intergenic
1192578696 X:72263115-72263137 GTCTCCCCCAGGAGACTGTGAGG - Intronic
1200842642 Y:7798879-7798901 GTCTCCTCAAATAGACTCTGAGG + Intergenic