ID: 1157244187

View in Genome Browser
Species Human (GRCh38)
Location 18:46039096-46039118
Sequence ATGAACAGGTTCTATTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157244187_1157244191 11 Left 1157244187 18:46039096-46039118 CCTTACAAATAGAACCTGTTCAT 0: 1
1: 0
2: 2
3: 9
4: 166
Right 1157244191 18:46039130-46039152 TTGGCAAGGATCCTGATCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 136
1157244187_1157244189 -8 Left 1157244187 18:46039096-46039118 CCTTACAAATAGAACCTGTTCAT 0: 1
1: 0
2: 2
3: 9
4: 166
Right 1157244189 18:46039111-46039133 CTGTTCATTAATTTGAATCTTGG 0: 1
1: 0
2: 1
3: 17
4: 272
1157244187_1157244190 -3 Left 1157244187 18:46039096-46039118 CCTTACAAATAGAACCTGTTCAT 0: 1
1: 0
2: 2
3: 9
4: 166
Right 1157244190 18:46039116-46039138 CATTAATTTGAATCTTGGCAAGG 0: 1
1: 0
2: 2
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157244187 Original CRISPR ATGAACAGGTTCTATTTGTA AGG (reversed) Intronic
901364408 1:8733556-8733578 ATGAAGAGGTTCCATGTGCAAGG + Intronic
902966622 1:20009213-20009235 TTGAACAGGTTCTAATTTGAGGG + Intergenic
903217386 1:21850770-21850792 AGAAAAAGCTTCTATTTGTAAGG - Intronic
903234830 1:21943166-21943188 ATAAACACGTTCTATGTGTCAGG + Intergenic
903759710 1:25689445-25689467 ACGAACAGGTTCTATTTGTCAGG - Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910197943 1:84664780-84664802 ATGATCAGAGTCTATATGTAAGG - Intronic
911739097 1:101368053-101368075 ATAAACAAGATCTATTTGGAGGG - Intergenic
913141494 1:115945705-115945727 ACTAAAAGGTACTATTTGTAGGG + Intergenic
914511126 1:148332956-148332978 ATGAACAGATTAGATTTGGAAGG - Intergenic
915837046 1:159185629-159185651 ATCAACAGTTTCTATATGTCAGG - Intronic
920630092 1:207644406-207644428 ATGAGCAGGATTGATTTGTAGGG - Intergenic
921065814 1:211621254-211621276 ATACATAGGTCCTATTTGTAGGG - Intergenic
921570058 1:216766959-216766981 TTCATCAGGTTTTATTTGTAGGG - Intronic
922368931 1:224890574-224890596 AAGGACAGGTTCTAATTCTAAGG - Intergenic
924157156 1:241190112-241190134 ATCAACTGGTCCTATCTGTATGG + Intronic
924272812 1:242351254-242351276 TTGAACACCTTCTATTTGTTAGG - Intronic
924402526 1:243701286-243701308 ATCAACATGATCTATTTGTGAGG - Intronic
1066711903 10:38245410-38245432 TTGAACACCTTCTATTTGTTAGG + Intergenic
1067921241 10:50460037-50460059 ATGCACTGGCTCTCTTTGTAAGG - Intronic
1071437768 10:85662760-85662782 ATGAAAAGGTTCTCTGTGTGAGG + Intronic
1073530612 10:104228739-104228761 ATGTATATGTTCTAATTGTATGG + Intronic
1077948775 11:6931546-6931568 ATGAAAAGTTTATATTTGTTAGG - Intronic
1079151098 11:17899983-17900005 ATGAACATGTACTATATGTCAGG + Intronic
1079662958 11:23064669-23064691 GTGAACATTATCTATTTGTATGG + Intergenic
1080995151 11:37590641-37590663 TTGAAGAGGTTGTAATTGTATGG - Intergenic
1083905807 11:65669445-65669467 ATGGAAAGGTTTTATTTTTATGG - Intergenic
1086007632 11:82057411-82057433 ATCAACAGGTTCAATTTCTGTGG - Intergenic
1086052853 11:82614412-82614434 ATGAACAAGTAATATTTGAATGG - Intergenic
1087390365 11:97523231-97523253 ACCAACAGGTTCTATTTTTAGGG + Intergenic
1087409107 11:97768047-97768069 ATTTACAGTTTCTAATTGTATGG + Intergenic
1088758834 11:112910274-112910296 ATGAACAGGTCAAATTTGTTAGG + Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1092807630 12:12240269-12240291 ATAAAAAGATTCTTTTTGTATGG - Intronic
1100729921 12:97453631-97453653 ATGATCAAGTTTTATTTTTAAGG - Intergenic
1103236292 12:119375536-119375558 ATGGACACATTTTATTTGTATGG - Intronic
1105971714 13:25434849-25434871 ATGCACGTGTTCTATTGGTATGG + Intronic
1108194053 13:47973756-47973778 ATGAACACATTCTTTTTTTATGG - Intronic
1109244421 13:59936358-59936380 ATAAAATGGTTCTTTTTGTAGGG - Intronic
1112545189 13:100361332-100361354 ATGAACATCTTGCATTTGTATGG - Intronic
1113241501 13:108343461-108343483 AAGAAAAGGTTTTATTTGCAAGG - Intergenic
1113480604 13:110617321-110617343 AAGAACAGGTTAAATTTGTTTGG - Intronic
1114416804 14:22550376-22550398 ATGCACAGAATCTGTTTGTAAGG + Intergenic
1115041284 14:28932133-28932155 ATAAGTAGGTTTTATTTGTATGG - Intergenic
1115915491 14:38308503-38308525 ATCAAAAGGTTCTATATGTTTGG + Intergenic
1116161879 14:41277739-41277761 ATTAACAGGTTTTATTCATATGG + Intergenic
1118373869 14:65160124-65160146 TAGAACAGGTTCTATTTCCAAGG + Intergenic
1121942835 14:98089403-98089425 ATGAACTCATTCTTTTTGTATGG + Intergenic
1125076032 15:35619560-35619582 ATGAACTTGTTCTTTTTTTATGG + Intergenic
1125237025 15:37526691-37526713 AAGAACAGGATCTATTTGATAGG + Intergenic
1125468874 15:39982868-39982890 ATGAACTTGTTCTTTTTTTATGG + Intronic
1126809349 15:52385188-52385210 AAGAACTGGTTTTATTTATATGG - Intronic
1127623367 15:60755691-60755713 TTGAACAGCTTCTATGTGTTGGG - Intronic
1128901490 15:71426464-71426486 ATGAGCAGGGTCTACTTGTGTGG - Intronic
1130743877 15:86629866-86629888 ATGAAGAGGAACAATTTGTATGG + Intronic
1135523785 16:23197885-23197907 AAAAAAAGGTTGTATTTGTATGG + Intronic
1137860594 16:51842568-51842590 ATAAACAGGTTGTACTTGGAGGG - Intergenic
1140604941 16:76524168-76524190 ATGAATAGCTTCTATGAGTAAGG + Intronic
1140625303 16:76787066-76787088 ATTAATAGTTTCTATTAGTATGG + Intergenic
1144318006 17:14082258-14082280 ATGAACAGGTTCTATTCTTTTGG - Intronic
1148778766 17:50110205-50110227 ATGACCAGGTTCTGTCTCTATGG + Exonic
1152004609 17:77672229-77672251 ATGATCAGGTTCCATTACTAAGG + Intergenic
1154329676 18:13419552-13419574 ATTAACAGTCTCTATTTGTGTGG - Intronic
1156382018 18:36571695-36571717 ATCAACTGGTTGTGTTTGTACGG - Intronic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1160055880 18:75479969-75479991 TTGAAAATGTTGTATTTGTAGGG + Intergenic
1163981064 19:20900612-20900634 GTGAACAGGTTCCAACTGTAGGG - Intergenic
927953371 2:27189715-27189737 ATGAAGTGGTTCTCATTGTAGGG - Intergenic
928713382 2:34032569-34032591 ATGAACTGCTTCTAATTATAAGG + Intergenic
929988483 2:46763115-46763137 ATGAACTCTTTCTCTTTGTAAGG - Exonic
933373467 2:81447331-81447353 ATGAATATGTTCTATATGGAGGG + Intergenic
933388884 2:81646043-81646065 ATCAACAGTTTCTAATTGAATGG - Intergenic
933675626 2:85054151-85054173 ATGAACAGGATTTGTTTTTAGGG - Exonic
935913888 2:107927818-107927840 ATGAACAGGTTATATATCTGGGG + Intergenic
936235722 2:110740945-110740967 ATGAACAGCTTGTATTTCTGTGG - Intronic
938424766 2:131176158-131176180 ATGAGCGGACTCTATTTGTATGG + Intronic
939457816 2:142461173-142461195 ATGGACAGGAGCTATATGTATGG - Intergenic
940245936 2:151616145-151616167 ATGAACAGCTTCACTTTTTATGG - Intronic
941504495 2:166325015-166325037 ATTAACAGTTTATATTAGTATGG - Intronic
941752549 2:169148325-169148347 AGGAACAGGGTTTCTTTGTAGGG + Intronic
941822038 2:169853322-169853344 ATGAGCAGGATCTTTTTGTCAGG + Intronic
942872044 2:180746578-180746600 ATGAACTCGTTCTTTTTTTATGG + Intergenic
945247809 2:207736046-207736068 ATGAACTGCTTCTATTTGGTGGG + Intronic
1169981244 20:11386885-11386907 ATTAACAGGTTATATTAATATGG + Intergenic
1170197199 20:13701629-13701651 ACTAACAGGTTCTATTACTATGG + Intergenic
1170901986 20:20472942-20472964 ATCAACAGGTTCCATTTTTTGGG - Exonic
1172741450 20:37171253-37171275 ATGAACAGCTACCATTTATAAGG - Intronic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1179118696 21:38521562-38521584 ATGAACCGATTATATTTGTATGG - Intronic
1185240775 22:49744340-49744362 ATGAACTCGTTCTTTTTTTATGG - Intergenic
953187338 3:40651123-40651145 ATGAACATTTTCTATTCCTATGG - Intergenic
954016297 3:47694950-47694972 TTAAACAGGTTTTTTTTGTAGGG - Intronic
955088361 3:55724903-55724925 ATGAACAGGTTAAAGTTGAAGGG + Intronic
958040054 3:88216553-88216575 TTGAACAGCTACTATGTGTAAGG - Intergenic
958164396 3:89861090-89861112 GTTAACAAGATCTATTTGTATGG + Intergenic
960185014 3:114627634-114627656 ATGTACAGGTTTTATTTGCTTGG - Intronic
962370915 3:134820086-134820108 ATCAACAGGGTCTACTAGTATGG - Intronic
962423016 3:135244548-135244570 ATGACCAGGTTTGAATTGTATGG - Intronic
963104509 3:141635276-141635298 ATGAACAGCTTCTGTTTTCAAGG + Intergenic
963502122 3:146140776-146140798 AAGAAGAGGTTATATTTGTTTGG - Intronic
963524305 3:146396955-146396977 ATGAATATGTTCTGTTTGTAGGG - Intronic
964131131 3:153288226-153288248 AGGCAGAGGTTCTATTGGTAGGG - Intergenic
964684994 3:159385674-159385696 ATGAACACTTTCTTATTGTAGGG + Intronic
965790455 3:172381793-172381815 ATGAACTCGTTCTTTTTTTATGG + Intronic
965981170 3:174692914-174692936 TATAAAAGGTTCTATTTGTAGGG + Intronic
966753717 3:183348219-183348241 ATGAACTCGTTCTTTTTTTATGG - Intronic
968850915 4:3077345-3077367 ATGAACAGGTTATATCTGGCAGG - Intronic
972941977 4:44206950-44206972 ATGAACATTTACTATTTGTTGGG + Intronic
975328933 4:73091702-73091724 ATGAACTGGTTGTAGTTGTTGGG + Exonic
975660911 4:76688458-76688480 ATGTCCAGGTTCTATATTTAAGG - Intronic
975758781 4:77597694-77597716 ATGAATAGGGTCTATTAGAATGG + Intronic
976359492 4:84160886-84160908 ATCAACAGGTTCAAGGTGTAAGG - Intergenic
977724109 4:100274760-100274782 TTGAAAAGGTTCTAATTATATGG + Intergenic
979361561 4:119771465-119771487 AAGCACAGATTCTATTTGGAGGG + Intergenic
979449527 4:120853990-120854012 ATGAGCAGGTTCTCCTTTTATGG - Intronic
980122031 4:128737585-128737607 AAAAAAAAGTTCTATTTGTAAGG - Intergenic
980215818 4:129851946-129851968 TTGAACTGGTTGTACTTGTAGGG + Intergenic
981213801 4:142139072-142139094 ATGAGTAAGTTCTATTTGAAGGG - Intronic
981391067 4:144192526-144192548 ATACACAGGATATATTTGTAGGG - Intergenic
981783343 4:148450462-148450484 ATGAACACTTTCTATATGGAAGG + Intergenic
984547246 4:181120887-181120909 ATGAACAACTGCTATGTGTAAGG + Intergenic
984583034 4:181532501-181532523 TTGAACATTTTCCATTTGTATGG - Intergenic
985160595 4:187040460-187040482 ATTAATCGCTTCTATTTGTAAGG + Intergenic
991479440 5:67061298-67061320 ATGTACATGTTTTATTTCTATGG + Intronic
992679159 5:79136040-79136062 ATGAACTGTTTCTATTTTCAAGG + Intronic
992791649 5:80219491-80219513 ATGAACAGCGGCTATTTGTTTGG - Intronic
994284836 5:97952085-97952107 ATGAACAGGGAATATGTGTAAGG + Intergenic
994917438 5:105998790-105998812 ATGAACTCATTCTATTTTTATGG + Intergenic
995377517 5:111492812-111492834 ATGTACAGGTTGTATCTATAAGG - Exonic
996940398 5:128998477-128998499 ATGATCATGATCTATTTATATGG - Intronic
1003200163 6:3952083-3952105 ATGATCTAGTTCTATTTTTACGG + Intergenic
1003645156 6:7908952-7908974 ATTAACAGTTTCTCTTTGTTCGG - Intronic
1004572368 6:16859714-16859736 ATCAACATGTTCTATTGGAAGGG + Intergenic
1005036042 6:21555709-21555731 ATCAAGAAGTTCTATTTCTAGGG + Intergenic
1008809921 6:55483944-55483966 ATGAACATTTTGTATTAGTAGGG + Intronic
1009382649 6:63051965-63051987 ATGAACTTGTTCTTTTTTTATGG + Intergenic
1010505250 6:76649213-76649235 AAGGACAGGTTCTATCTGAAGGG - Intergenic
1010523538 6:76872404-76872426 ATGATCTGGTTCTTTTTTTATGG + Intergenic
1012734725 6:102924764-102924786 ATGACCACGTTTTATTTGTAAGG + Intergenic
1013940329 6:115653201-115653223 ACAAACAGGTCCTATTTGTTTGG - Intergenic
1014530916 6:122558132-122558154 AAGTGCAGGTTGTATTTGTAGGG + Intronic
1014598885 6:123383838-123383860 ACGAATATGTTTTATTTGTAAGG + Intronic
1015683673 6:135835199-135835221 ATGAAGAGGGTATATTTGTCAGG - Intergenic
1016405464 6:143724975-143724997 ATGAACAAGTTCACTTTCTATGG + Intronic
1018515787 6:164578537-164578559 CTGAACAGGTACTGTTAGTAAGG + Intergenic
1018959630 6:168439068-168439090 ATAATCAGGTTCCATTTTTATGG - Intergenic
1019878659 7:3838984-3839006 ATGAACACCATCTATTTGTAGGG - Intronic
1023469301 7:40496883-40496905 ATGAATATGTGTTATTTGTAAGG + Intronic
1024921147 7:54556188-54556210 ATCAACAGCTGGTATTTGTAAGG + Intronic
1030620719 7:111788037-111788059 ATGATCAGATTCTATGGGTAGGG + Intronic
1030665027 7:112267447-112267469 ATTATCACGTTCTATTTGAAAGG + Intronic
1033314488 7:140286123-140286145 ATAAACAGTTTCTATTATTATGG - Intergenic
1033881203 7:145886388-145886410 ATGGACAGGGTTTATTTGTCAGG + Intergenic
1035957623 8:4099734-4099756 AGGAAGAGGTTCTAGTTTTAAGG - Intronic
1038041266 8:23726308-23726330 GTGAACAGGTTATTTTTCTACGG - Intergenic
1039096023 8:33886681-33886703 ATAAACAGTTTATATTAGTAAGG + Intergenic
1041362290 8:57066531-57066553 ATGCACAGGTTCCATTCCTAGGG + Intergenic
1041601816 8:59727125-59727147 ATGAACTGATTATGTTTGTATGG + Intergenic
1045956406 8:107912598-107912620 ATGAACAGGTTCTTTTTAAAAGG + Intronic
1047557915 8:125952737-125952759 ATGAAAATGTTTTCTTTGTAAGG + Intergenic
1048787022 8:138061449-138061471 AAGAACAGGGTCCTTTTGTAGGG + Intergenic
1048948947 8:139476917-139476939 ATACACAGGTTCTATTTTGAGGG - Intergenic
1050836209 9:10082098-10082120 ATGAAGAGGTTCATTTTGTATGG - Intronic
1052087479 9:24285907-24285929 ATGAACATTTTATATTAGTATGG + Intergenic
1052182100 9:25542403-25542425 ATAAACAGGCTCTCTATGTAGGG + Intergenic
1057614505 9:96576919-96576941 TTGAACATGGTCTATGTGTATGG - Intronic
1058108950 9:101008899-101008921 ATGAAAAGGTACTATTTTAATGG + Intergenic
1060688439 9:125633785-125633807 AGTGACAGATTCTATTTGTAGGG - Intronic
1060871318 9:127042966-127042988 ATGTACAGGTTCTGTTAATATGG + Intronic
1186020952 X:5254596-5254618 ATGAAGAGCTTCAATTTGTTTGG + Intergenic
1188905817 X:35789847-35789869 ATACACATGTTCTATTTGAATGG + Intergenic
1190591829 X:52010739-52010761 AAGAAAAATTTCTATTTGTAAGG + Intergenic
1194719795 X:97327044-97327066 CTCAACAGGTTTTATTTTTATGG + Intronic
1196713810 X:118792199-118792221 ATGAACAAATTTTATTTGTAGGG + Exonic
1199395410 X:147331334-147331356 ATAAACAAGTTATATTAGTATGG - Intergenic
1199577774 X:149330691-149330713 CTGAAACAGTTCTATTTGTAAGG + Intergenic
1199720684 X:150541054-150541076 ATGAACAGGTGCCAGATGTAGGG - Intergenic
1200611996 Y:5335912-5335934 ATGAACAGTTTCTAATAGAAGGG - Intronic