ID: 1157245605

View in Genome Browser
Species Human (GRCh38)
Location 18:46051672-46051694
Sequence CAGAAAAGCCCCAAACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157245600_1157245605 7 Left 1157245600 18:46051642-46051664 CCCATCTAAACATCAACATGATC 0: 1
1: 0
2: 2
3: 94
4: 3474
Right 1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG 0: 1
1: 0
2: 3
3: 21
4: 233
1157245601_1157245605 6 Left 1157245601 18:46051643-46051665 CCATCTAAACATCAACATGATCC 0: 1
1: 0
2: 2
3: 18
4: 236
Right 1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG 0: 1
1: 0
2: 3
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157245605 Original CRISPR CAGAAAAGCCCCAAACCCCC AGG Intronic
900577471 1:3390457-3390479 CAGACAAACCCCAAAACCCCAGG + Intronic
903063225 1:20684517-20684539 CAGCCAAGCCCCCAGCCCCCTGG - Intronic
903141564 1:21342296-21342318 CAGAACAGGCACAAACCTCCTGG - Intronic
903815274 1:26060221-26060243 CTGGAAAGCTCCAAATCCCCAGG + Intronic
904358908 1:29959824-29959846 CAGCAGAGCCACTAACCCCCTGG - Intergenic
905235462 1:36543157-36543179 CAGAAGAGTCCCAGACACCCAGG - Intergenic
906066652 1:42985695-42985717 AAAAAAGGGCCCAAACCCCCTGG - Intergenic
906066701 1:42986009-42986031 CAGAAAAGGCCCAAACCAGCCGG - Intergenic
906144503 1:43551894-43551916 CATAAAACCCCCAGAGCCCCTGG + Intronic
906962410 1:50426593-50426615 CAGAAAAAGCCAAAACCCTCCGG + Intergenic
909355702 1:74707545-74707567 ATCAAAAGCCCCAAACCCCCAGG + Intronic
911040167 1:93585000-93585022 CAAAAAACCCCCAAACTCCAAGG + Intronic
913167288 1:116199984-116200006 AATAAGAGCCCCAAACCCCAGGG - Intergenic
913748000 1:121928612-121928634 CAGAGAAGTCCCAAAATCCCTGG + Intergenic
915493535 1:156265523-156265545 GAGGAAAGCCCCAAACCCACAGG + Intronic
915613591 1:157016099-157016121 CAAATAAGACCTAAACCCCCAGG + Intronic
918785756 1:188760712-188760734 GAGAAAACCCCCAAGCCTCCTGG - Intergenic
919182398 1:194103468-194103490 CAGATAAACCCCCAATCCCCAGG + Intergenic
920211674 1:204333079-204333101 CAGAGAAGACCCAGGCCCCCAGG + Intronic
922584411 1:226722889-226722911 CAGAAAAGATGCAAACCCCCAGG + Intronic
923534007 1:234834555-234834577 CACAGCAGCCTCAAACCCCCAGG + Intergenic
1063626995 10:7699535-7699557 CAGAAAACACCCAGACACCCTGG + Intergenic
1063800195 10:9568133-9568155 AAGAAAAGCCCCAGACCTGCTGG + Intergenic
1065810630 10:29439499-29439521 CACCACAGCCCCAAACTCCCAGG - Intergenic
1066633513 10:37479481-37479503 CAGAAAAGATCAAAACTCCCTGG - Intergenic
1067459057 10:46444128-46444150 CAGACAAGCCCCATTCCCCTAGG + Intergenic
1067628140 10:47940502-47940524 CAGACAAGCCCCATTCCCCTAGG - Intergenic
1070476807 10:76836807-76836829 CCGAAGAGCCCCAAGTCCCCAGG - Intergenic
1071194342 10:83140192-83140214 CAGAAAATCCCCAGAGCCACTGG - Intergenic
1071230669 10:83581084-83581106 CTGGATAGCCCCCAACCCCCGGG - Intergenic
1071342819 10:84664367-84664389 CAGAGAAGCCACAGACCCACAGG + Intergenic
1074082806 10:110181279-110181301 AAGATAAGCCCAAAGCCCCCAGG + Intergenic
1074421170 10:113309777-113309799 AAGAAAAGCCCCCAGCCCCCAGG - Intergenic
1075324537 10:121520266-121520288 CAGAAAAGCCTCAAGCCTGCTGG + Intronic
1075542584 10:123328013-123328035 AAGAAAATCCCCAAACCCTTAGG + Intergenic
1077129617 11:964357-964379 CAGAGAAGCCCCAGAACTCCAGG - Intronic
1081641078 11:44755017-44755039 CAGAAAAGCCCCAGACCAGATGG + Intronic
1084136617 11:67188113-67188135 CAGAACAGCCTCAAACTCCTGGG - Intronic
1084664486 11:70569201-70569223 GAGGACAGTCCCAAACCCCCGGG + Intronic
1084754649 11:71229326-71229348 CATAAAACCCCAAAACCTCCTGG + Intronic
1087165380 11:94998076-94998098 CAGGAAGGCCCCACAACCCCGGG - Exonic
1091850733 12:3694610-3694632 CAGAAAGTCCCCATGCCCCCCGG - Intronic
1092238260 12:6822764-6822786 CAGGAAAAGCTCAAACCCCCTGG - Intronic
1092730055 12:11522834-11522856 CACTAAAGCCCCAAATTCCCAGG - Intergenic
1094830381 12:34297470-34297492 CAGGGATGCCCCAATCCCCCAGG - Intergenic
1096169526 12:49456068-49456090 CAGAAAAACCCCATACCCACAGG - Intronic
1098423270 12:70327709-70327731 CAGAAAAGGCCCCTACCCTCAGG - Intronic
1098559945 12:71861324-71861346 AAGAAAAGCCCAAAACCCAATGG - Intronic
1100898448 12:99211882-99211904 CAGGAAAACCCCAAACCTCTTGG + Intronic
1103469620 12:121169693-121169715 CAGGCTAGCCTCAAACCCCCGGG - Intronic
1103506693 12:121445808-121445830 CAGAAAAGCCCCAAAGGAGCAGG + Intronic
1104899036 12:132178299-132178321 CAGTACAGCCTCAAACTCCCGGG - Intergenic
1105910162 13:24856986-24857008 GAGAAACGCTCCAAACCCCATGG + Intronic
1107269742 13:38601488-38601510 CAGAATAGACCCTGACCCCCAGG + Intergenic
1111372264 13:87334095-87334117 CAGCAAAACCACAAACCCACTGG + Intergenic
1112508260 13:99988418-99988440 AAGAAAAGCCCCAAACCCCATGG - Intergenic
1112842509 13:103598634-103598656 CAGACTAGCCCCAAACTTCCTGG + Intergenic
1113309953 13:109121721-109121743 CACAGTGGCCCCAAACCCCCAGG + Intronic
1113381622 13:109810881-109810903 CAGGAAAGCCCACAAGCCCCTGG + Intergenic
1113512567 13:110867750-110867772 CAGAAAATCCTCAAACCACAGGG - Intergenic
1113930859 13:113968159-113968181 CAGAAAACACCCAGAGCCCCAGG - Intergenic
1114635881 14:24186546-24186568 CAGAAAATTCCCAACCTCCCAGG + Intronic
1114731662 14:24999769-24999791 CAGAAAAGCCCAAAGCCCAGAGG + Intronic
1118210741 14:63763738-63763760 CAGTACAGCCTCAAACTCCCAGG + Intergenic
1118882086 14:69837685-69837707 CAGAAAAACCCCAAATTCACCGG - Intergenic
1119739307 14:77003867-77003889 CAGCAAAGGCCCACAGCCCCAGG - Intergenic
1122203715 14:100137832-100137854 CAGAGGAGCCCCAAACCCTGGGG - Intronic
1122272045 14:100572629-100572651 CGGAGAAGGCCCAACCCCCCAGG - Intronic
1122894651 14:104750695-104750717 CAGCAAAGCCACAAACCCACCGG - Intergenic
1123117014 14:105899412-105899434 AAGATAAGCTCCAGACCCCCAGG - Intergenic
1123119077 14:105908720-105908742 AAGATAAGCTCCAGACCCCCAGG - Intergenic
1124180464 15:27468269-27468291 GATAAAAGCCCCAAATCCCATGG - Intronic
1128187908 15:65659407-65659429 CATTGCAGCCCCAAACCCCCAGG + Exonic
1128536819 15:68497850-68497872 CAGACAAGGCACAAGCCCCCTGG - Intergenic
1131472220 15:92707404-92707426 AAGGAAAGCCCCAAACACCTGGG - Intronic
1131955640 15:97732518-97732540 AAGAAAAGTCCCAAATCACCTGG + Intergenic
1131985824 15:98042129-98042151 CACAAAACCCCTGAACCCCCAGG - Intergenic
1132538847 16:498060-498082 CACAACAGCCCCAGACTCCCTGG + Intronic
1133130920 16:3675750-3675772 CAGGACTGCGCCAAACCCCCAGG + Intronic
1133217153 16:4299560-4299582 CAGACAAGCCCCGAACCTCACGG + Intergenic
1133594172 16:7274508-7274530 CAGAGAAGTCCCAAACTCTCAGG - Intronic
1136343853 16:29663078-29663100 CAGGTGAGCCCCAGACCCCCAGG + Intronic
1136412797 16:30086616-30086638 CAGAACAGGCCCCAGCCCCCGGG - Exonic
1138461450 16:57150564-57150586 CACAAATGCCCCTAACACCCTGG + Intergenic
1140260331 16:73372771-73372793 AAGAAATGCCCCTAAGCCCCAGG - Intergenic
1141919567 16:87126976-87126998 GAGAAAAGCGACAAATCCCCAGG - Intronic
1142347487 16:89563155-89563177 CAAGAAAGCCCCAAATCCCCTGG - Exonic
1143185706 17:5008747-5008769 CAGAAGGACCCCAAAGCCCCAGG - Intronic
1144724348 17:17494259-17494281 CAGAAAAGCCCCAGATGCCTGGG - Intergenic
1147860868 17:43522241-43522263 CAGAAAAGCCCCTAGACCCTGGG - Intronic
1147950249 17:44103523-44103545 CAGAACAGCACCCAACACCCAGG + Intronic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1151266757 17:72962516-72962538 CAAAAAACCCCCAAAACCCAAGG - Intronic
1151992031 17:77581487-77581509 CAGTGCAGCCTCAAACCCCCAGG + Intergenic
1152554594 17:81046608-81046630 CAGAAGTCCCCCAACCCCCCTGG + Intronic
1152617577 17:81345077-81345099 CAGAATACCCCCAAAGCCCATGG + Intergenic
1153167109 18:2274437-2274459 CAGAATATCTCCAAACCCCCAGG - Intergenic
1153777438 18:8466430-8466452 CAGACCAGCCCCACACTCCCTGG + Intergenic
1154385746 18:13890411-13890433 TAGAAAAGCCTGAAAGCCCCTGG - Intronic
1155017969 18:21864072-21864094 CTGAAAAGCCTGAAACCCACAGG - Intronic
1157245605 18:46051672-46051694 CAGAAAAGCCCCAAACCCCCAGG + Intronic
1157519891 18:48338238-48338260 CAGTGCAGCCCCAAACGCCCAGG + Intronic
1157577552 18:48753875-48753897 CAGCCAAACCCCAAACCCGCAGG + Intronic
1160206284 18:76836294-76836316 CACTGCAGCCCCAAACCCCCGGG + Intronic
1160746110 19:711369-711391 CAGGCAAGGCTCAAACCCCCGGG + Intronic
1162005916 19:7779185-7779207 CACTGCAGCCCCAAACCCCCAGG + Intergenic
1166566402 19:43768120-43768142 TAGAAAATCCACAAACCCTCAGG - Intronic
1167468831 19:49664397-49664419 CTAGAAAGCCCCAAACCCCCAGG + Intronic
1168022696 19:53621206-53621228 CACTAAAGTCCCAACCCCCCGGG + Intergenic
926636320 2:15183628-15183650 GAGAAAAGCCCCAAACTCTCTGG - Intronic
928220361 2:29398232-29398254 TAAGAAAGCCCCAAACCCTCAGG + Intronic
928240173 2:29579148-29579170 CAGAAAATGCCCAAAGCCCAGGG + Intronic
929635552 2:43517376-43517398 CAGAAAAGACTCAAACTGCCAGG + Intronic
929791927 2:45029728-45029750 GAGAAAACCACCAAACCTCCTGG + Intergenic
930949839 2:57127126-57127148 CAGAAAATCCACAAAGCCCATGG - Intergenic
935652545 2:105394495-105394517 CACTAAAGCCTCAAACCCCTGGG - Intronic
937709281 2:124960877-124960899 CATATAAACCCCAAAACCCCAGG + Intergenic
939735172 2:145835214-145835236 CACAAGAGCCTCAAACTCCCAGG + Intergenic
941486501 2:166088688-166088710 CAGTAAAGTCCCAAAGCCCGTGG + Intronic
945168429 2:206970358-206970380 GAAAAAATCCCCAGACCCCCAGG - Intergenic
945892866 2:215448767-215448789 CAGAAAAACCCCAAACTCAGTGG + Intergenic
946688840 2:222295880-222295902 CAGACAAGCCCCAGACAACCGGG + Intronic
947775633 2:232706868-232706890 CAGTACAGCCTCAAACTCCCAGG - Intronic
948706059 2:239793184-239793206 CAGAAAAGTGCCAAATCACCAGG + Intronic
1172061145 20:32188300-32188322 CAGGAGAGCCCCTAATCCCCAGG - Intergenic
1172601099 20:36183505-36183527 CAGCACAGCCTCAATCCCCCTGG + Intronic
1175308112 20:57991905-57991927 CTGAAAAGTCCCACATCCCCAGG + Intergenic
1175973166 20:62697354-62697376 CAGCAAAGCCCTGAACCCCAAGG + Intergenic
1176177686 20:63736417-63736439 CACAGAACCCCCAAACCCACAGG - Intronic
1176965946 21:15211660-15211682 CAGAAAAGCCGCAAGCACGCTGG + Intergenic
1179448712 21:41452784-41452806 CTGGAAAGCCCCAAAATCCCAGG - Exonic
1179537913 21:42064051-42064073 CAGAAACCCCCCAAGCCCCAAGG - Intronic
1179652923 21:42825345-42825367 AAGAAAAGCCCAAGACCCCATGG + Intergenic
1180977935 22:19860707-19860729 CACTGAAGCCCCAAACCTCCCGG - Intergenic
1184032147 22:41901362-41901384 CAGAAAAGGCCCAAACTGGCTGG + Intronic
949355676 3:3178442-3178464 CAGGAAAAACCCAAACCCACTGG + Intronic
950643819 3:14365293-14365315 CAGAAAAGACTCAAGGCCCCAGG - Intergenic
950647096 3:14383663-14383685 CAGAGAAGGCCCAAGCACCCAGG + Intergenic
951711907 3:25591963-25591985 CACAAGAGCCTCAAACCCACTGG - Intronic
953261104 3:41339626-41339648 CGGAAAAGCCCCATTCCACCTGG - Intronic
953981815 3:47417241-47417263 CAGAAAGGCCCACAATCCCCGGG + Intronic
955775675 3:62430366-62430388 CAGAAAAGCACCAAAACACTCGG + Intronic
955925743 3:64003042-64003064 CCCAATCGCCCCAAACCCCCTGG - Exonic
956743944 3:72296702-72296724 CAGAAAAGTCACAAAAGCCCGGG + Intergenic
957387839 3:79519946-79519968 CAGAATAGTCTCAAACTCCCAGG - Intronic
959091776 3:101911093-101911115 CAGGAAAGCCCCCATCTCCCTGG - Intergenic
960670205 3:120148335-120148357 CAGAGAAGCCTCAAACTCCTGGG + Intergenic
960949878 3:122992452-122992474 CCGAAATGCCCCACACCCACAGG - Intronic
961629901 3:128288913-128288935 CTGAAAAGCCCTATACCTCCAGG - Intronic
962168603 3:133077165-133077187 CAGCACAGCCCCAAACGGCCAGG - Intronic
962230595 3:133662082-133662104 CAGCAAAGCCCTAAACCCAAAGG - Intergenic
962533253 3:136303006-136303028 CAGAACAGCCTCAAACACCTGGG - Intronic
962616702 3:137133822-137133844 CAGAAAGCCCCCACATCCCCAGG + Intergenic
962775444 3:138654979-138655001 AAGAACAGCCACCAACCCCCAGG + Exonic
963201929 3:142595160-142595182 CACAAAAGCCCCAAACCAGAAGG - Intergenic
965793274 3:172411633-172411655 CAGAGCAACCCCCAACCCCCAGG - Intergenic
968214196 3:196874092-196874114 CACTGAAGCCCCAAACTCCCAGG - Intronic
968602646 4:1517648-1517670 CAGATGAGCCCCCCACCCCCTGG + Intergenic
968792800 4:2679828-2679850 AAGAAAAGCCCCAAACCTGATGG - Intronic
969052077 4:4380175-4380197 CAGCAAAGCTCCCAACCCCCAGG - Intronic
969469668 4:7380173-7380195 CAGGTAAGCCCCCAAACCCCAGG - Intronic
972406480 4:38751410-38751432 CATATAAACCCCAAACCCCCAGG + Intergenic
973959447 4:56095274-56095296 CAGAAGAGCCCCAACCACCCGGG - Intergenic
974077634 4:57182201-57182223 CTGAAAATCCCCACACCCTCAGG - Intergenic
974527486 4:63062143-63062165 CAGAAAGACCACAAACCCACTGG + Intergenic
974767957 4:66372318-66372340 AAGTAAAGACCCAAACGCCCTGG - Intergenic
976105643 4:81614226-81614248 CAGAAAAGCCCCTGACCCGGGGG - Intronic
981197884 4:141942277-141942299 AAAAAAAGCCCCAAACCCTGGGG + Intergenic
982317947 4:154050157-154050179 GAGAAAGGCCCCACACCCCTGGG + Intergenic
983736918 4:171073146-171073168 CAGCAAGGCCACAAACCCACCGG - Intergenic
983743804 4:171169184-171169206 TAGAAAAGCCCCCTACCCCAGGG - Intergenic
984026759 4:174551994-174552016 CAGCAAGACCACAAACCCCCTGG - Intergenic
984710394 4:182879728-182879750 CAAAAAAACCCAAAACCCCTGGG + Intergenic
987106354 5:14643618-14643640 CAGAAAAGCCCAAAACCAGACGG - Intergenic
987363813 5:17130439-17130461 CAGCAAAACCACAAACCCACCGG - Intronic
991074080 5:62515787-62515809 CAGAAAAGCCCCGACCACCAAGG - Intronic
992442370 5:76808212-76808234 CAGCAAAGCTCCAAAGACCCAGG + Intergenic
992620813 5:78590933-78590955 CAGAAATGTCACAAACCCCCAGG - Intronic
993205403 5:84872391-84872413 TAGAAAAGCCTCACACCCCTGGG + Intergenic
994257824 5:97620871-97620893 AGGAAAAGCCCCAGACCCCATGG - Intergenic
995796797 5:115949776-115949798 CAGAAATGCCGCAAACACACAGG + Intergenic
997981856 5:138472611-138472633 CAGAACCGCCCCTATCCCCCAGG + Intergenic
998931571 5:147187317-147187339 CAGAAAAGCATCAATCCCCCAGG + Intergenic
999272690 5:150306613-150306635 CCGATAAACCCCAAACTCCCAGG - Intronic
999714530 5:154349496-154349518 CACTAAAGCCCCAAACTCCTGGG - Intronic
1000059234 5:157638363-157638385 CAGAAGTGCTCCAATCCCCCAGG - Exonic
1001772836 5:174308841-174308863 CAGGGAAGACCCACACCCCCTGG - Intergenic
1002353197 5:178600087-178600109 AAAAAAACCCCAAAACCCCCAGG - Intergenic
1003224331 6:4190722-4190744 CAGAAAGACCACAAACCCACCGG - Intergenic
1004166643 6:13262606-13262628 CAGAAATGCCCCAATCCTCATGG + Intronic
1006880216 6:37332491-37332513 GAGAAGAGCCCCAAACCCGAGGG - Exonic
1008496280 6:52137372-52137394 GAGAAAAGCCCCCAACCCCCAGG + Intergenic
1009653172 6:66503252-66503274 CAATATAGCCTCAAACCCCCGGG + Intergenic
1010551776 6:77232160-77232182 CAGAAAAGACCCAAACCCCAGGG + Intergenic
1018850780 6:167588865-167588887 CAGAATAGCCCCACACCCCTTGG - Intergenic
1021825064 7:24542071-24542093 CACTACAGCCCCAAACTCCCAGG + Intergenic
1023017517 7:35982639-35982661 CAGTAAAGACTCAAACCCTCAGG + Intergenic
1023770196 7:43550143-43550165 CAGACAAGCCCCACTCCGCCTGG - Intronic
1023972553 7:45001931-45001953 CAGAAAAAACACAAAACCCCTGG - Intronic
1027047609 7:75001468-75001490 CAGAGAGGCCACAAACCCCGGGG + Intronic
1029038030 7:97542131-97542153 CAGCAAGGCCACAAACCCACTGG + Intergenic
1029385381 7:100240171-100240193 CAGAGAGGCCACAAACCCCGGGG - Intronic
1029467136 7:100732962-100732984 CATTACAGCCTCAAACCCCCGGG - Intergenic
1029562044 7:101309047-101309069 CAGAACAGCCACCAATCCCCAGG - Intergenic
1030100570 7:105941623-105941645 TAAAAAAGCCCCAACCCCCAGGG - Intronic
1031484370 7:122310412-122310434 CAGAAAAGCTGAAAACTCCCCGG + Intronic
1032530549 7:132616079-132616101 CAGATAACGCCCAAACTCCCTGG + Intronic
1033665948 7:143440606-143440628 CATAAAAGCCCCAAAACACTTGG + Intergenic
1034223261 7:149461118-149461140 CACAAAAGCACCCAACCCCCTGG - Exonic
1034998337 7:155592546-155592568 CAGAGAACCCCCAAATCCCTCGG - Intergenic
1035296692 7:157871371-157871393 CAGAACAACCCAAATCCCCCAGG - Intronic
1035351456 7:158249706-158249728 CAGAAAAGCCCCATCCCCTGGGG + Intronic
1037239346 8:16759815-16759837 CAGCAAGACCACAAACCCCCCGG - Intergenic
1037951471 8:23021077-23021099 CAGAAAAGACCAAAAACTCCTGG + Exonic
1037980394 8:23249269-23249291 CAGGAAGACCCCAACCCCCCAGG - Exonic
1040287632 8:46108547-46108569 CAGAAAAGCTGCAAAGCCCCAGG - Intergenic
1041226048 8:55699186-55699208 CACAATGGCCCCAAAGCCCCAGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041871270 8:62637368-62637390 CAGAAAAGAGCAAAACCACCTGG - Intronic
1041905929 8:63033368-63033390 CAGAAAAGCCCAAGACCAGCTGG - Intronic
1043927671 8:86056215-86056237 CAGTGCAGCCCCAAACTCCCTGG - Intronic
1044219495 8:89652137-89652159 CAGAAAATCACCAAACCACAAGG + Intergenic
1044726764 8:95200699-95200721 CAGAAATGGCCTAACCCCCCAGG - Intergenic
1044934439 8:97279172-97279194 GAGATAAGCCCAAAAGCCCCGGG + Intergenic
1046754031 8:117955143-117955165 CAGAAAAGTCCCAAACACAGAGG + Intronic
1048309835 8:133312905-133312927 CACTGAAGCCTCAAACCCCCAGG - Intergenic
1048967907 8:139627393-139627415 CAGTCAAGCCCCAAACCCTGAGG - Intronic
1049081343 8:140445585-140445607 CAGAAAAGGCCCACAACCCAGGG + Intronic
1049126200 8:140791260-140791282 CACCACAGCCTCAAACCCCCGGG + Intronic
1049160580 8:141095323-141095345 GAGAAAAGCCTGAAACTCCCTGG + Intergenic
1050682784 9:8133523-8133545 CAGGGATGCCCCAAACCCACTGG + Intergenic
1051841465 9:21402733-21402755 AATAAAAGCCCCAAACCCAGGGG + Intergenic
1055303376 9:74904655-74904677 CACTACAGCCCCAAACCCCTGGG + Intergenic
1055502612 9:76916548-76916570 AAGCAAAGCCCCAAAGACCCAGG - Intergenic
1055579706 9:77695350-77695372 AAGAAAAGCCCCAGACCCAATGG - Intergenic
1057012690 9:91619794-91619816 CAGGAATCCCCAAAACCCCCAGG + Intronic
1058162538 9:101585404-101585426 CAGAAAAGCCCCCAACTCTTGGG - Intronic
1060004949 9:119991770-119991792 CAGAAAAGCCAGAAGCACCCTGG + Intergenic
1060064255 9:120489316-120489338 GAGAAAAGACCCATACCCCATGG - Intronic
1060736825 9:126071389-126071411 GAGAAGAGCCCCAAAAACCCAGG - Intergenic
1061278528 9:129583671-129583693 GAGCAAAACCCCCAACCCCCAGG + Intergenic
1061329159 9:129881409-129881431 CAGCAAGGCACCAAAGCCCCTGG + Exonic
1061420802 9:130472055-130472077 CAAAGAAGCCCCCTACCCCCGGG - Intronic
1061513064 9:131072560-131072582 CACAAAAGCCCCCACCCCCAGGG - Intronic
1061624866 9:131835665-131835687 CAGAGAAGCCCCAAGTCCCCGGG - Intergenic
1061865505 9:133490069-133490091 CAGTATAGCCCCACAGCCCCCGG - Intergenic
1062549626 9:137079998-137080020 CAGCAAAGGCTCAAACTCCCTGG - Exonic
1187441777 X:19327444-19327466 CATAATAGCCTCAAACTCCCAGG + Intergenic
1189682743 X:43534016-43534038 CGGAACAACCCCAAATCCCCTGG + Intergenic
1189869753 X:45369506-45369528 CATGCAAGTCCCAAACCCCCAGG - Intergenic
1191253667 X:58270776-58270798 CAGAAAAGCCGTGACCCCCCGGG + Intergenic
1194520962 X:94918336-94918358 CATAATAGCCCTCAACCCCCAGG - Intergenic
1194708460 X:97203693-97203715 CAAAAAAGCCCCAAACCAGATGG + Intronic
1194818475 X:98475011-98475033 CAGGATAGCCTCAAACCCCTGGG - Intergenic
1196297980 X:114021102-114021124 GACAAAAGCCCCAAACTTCCAGG + Intergenic
1197773661 X:130106593-130106615 GAGAAAAGCCCCTGACCCCTAGG + Intronic
1198228764 X:134670187-134670209 CTGAAAAGCCCAACACCCCTGGG + Intronic
1201468476 Y:14310366-14310388 CAGAAAGACCACAAACCCACCGG + Intergenic